KR102304878B1 - Method for Treating Alzheimer's Disease Using microRNA-485-3p Inhibitor - Google Patents

Abstract

The present invention relates to a method for providing information for diagnosing Alzheimer's disease or brain disease using miR-485-3p, a composition for diagnosing Alzheimer's disease or brain disease, and a diagnostic kit. According to the present invention, objective data analysis for the diagnosis of Alzheimer's disease or brain disease is possible by measuring the expression level of miR-485-3p in the blood, and the risk of the patient is minimized by measuring the concentration of amyloid beta 42 in saliva. , enabling fast and accurate diagnosis. Therefore, it is very useful for the prevention of Alzheimer's disease or a brain disease.

Description

Method for Treating Alzheimer's Disease Using microRNA-485-3p Inhibitor

The present invention relates to an information providing method for diagnosing Alzheimer's disease or brain disease using miR-485-3p, and more particularly, comprising measuring the expression level of miR-485-3p microRNA from a sample collected It relates to an information providing method for diagnosing Alzheimer's disease or brain disease. Also, it relates to a composition and diagnostic kit for diagnosing Alzheimer's disease or brain disease using miR-485-3p or amyloid beta 42.

Recent therapeutic trends for Alzheimer's disease are centered on the possibility that Alzheimer's disease is caused by impaired cholinergic signaling and transmission in the cerebral cortex and hippocampus (Bartus et al. , Science. 217(4558): 408-14 (1982) and Coyle et al., Science. 219(4589):1184-90 (1983)).

Because these areas of the brain are connected to memory and intelligence, functional defects in these parts of the brain impair memory and judgment and lead to intellectual loss. Although the exact process by which neuronal signaling is impaired is controversial, senile plaques and neurofibrillary tangles (NFTs) are considered to be the major pathological phenomena.

In particular, senile plaque due to the accumulation of amyloid beta (Aβ) is the most characteristic of this disease, and Alzheimer's disease can be confirmed by post-mortem autopsy (Khachaturian, Arch. Neurol. 42(11):1097-105(1985)).

In Alzheimer's disease, drugs and treatments that increase the amount of acetylcholine to inhibit damage to cholinergic neurotransmission, allow acetylcholine to exist for a long time, or make acetylcholine more effective in neuronal transmission are available. As suggested, various compounds that increase acetylcholine activity in Alzheimer's disease patients are being used.

Currently, the most effective approach is to inhibit the activity of acetylcholinesterase, which rapidly breaks down acetylcholine at the synapse and blocks nerve signal transmission. In fact, these inhibitors (e.g. tacrine, donepezil, galantamine and rivastigmine) are currently on the market as FDA-approved drugs for treating Alzheimer's disease. have.

In addition, some compounds aim to improve the general health of the nerves, thereby maintaining normal cell function as we age. For example, some drugs, such as NGF and estrogen, have a neuroprotective role by slowing nerve degeneration, while others, such as antioxidants, reduce cellular oxidation, thereby reducing the increase in harmful cellular damage that results from normal aging. make it

If the accumulation of amyloid beta peptide is high, Alzheimer's disease becomes serious. It is thought that lowering the accumulation of amyloid beta in the neuritic space will slow the progression of Alzheimer's disease. In addition, it is thought that amyloid precursor protein (APP) proceeds in many different forms in combination with intracellular proteolytic enzymes such as α-, β-, and γ-secretases. However, since the formation process of amyloid beta has not been fully scientifically elucidated, it is not yet possible to control the formation of amyloid beta.

The process by which the accumulation of amyloid beta causes abnormalities in nerve signal transmission is not clear, and when APP is abnormally cleaved and amyloid beta is produced and accumulated in the neuritis space, plaque formation is induced. Thus, many other factors involved in this cleavage response (eg, inflammation, etc.) increase phosphorylation of tau protein and increase the accumulation of NFTs and paired helical filaments (PHFs), which eventually leads to neuronal growth. increase the damage of All of these factors cause nerve dysfunction and ultimately accelerate the progression of Alzheimer's disease to dementia.

Although the development of treatment methods to reduce the effects of Alzheimer's disease is being actively developed, it currently provides temporary symptomatic improvement. In conclusion, current Alzheimer's disease treatment focuses on improving the symptoms of the disease rather than reversing the course of the disease. not.

In this regard, U.S. Patent No. 5,532,219 discloses a composition for treating Alzheimer's disease comprising 4,4'-diaminodiphenylsulfone, and the like, and U.S. Patent No. 5,506,097 discloses para-amidinophenylmethanesulfonyl fluoro Disclosed is a composition for treating Alzheimer's disease containing lead or everlactone A, and US Patent No. 6,136,861 discloses a composition for treating Alzheimer's disease containing bicyclo[2.2.1]heptane.

ELAVL2 is an ELAVL-like neuron-specific RNA binding protein 2 and is one form of nELAVL2. nELAVL2 is an RNA-binding protien that is specifically expressed in the brain and is known to be involved in neurodegenerative diseases. As a result of performing high-throughput RNA sequence using brain tissue after post-mortem autopsy of Alzheimer's disease patients, it is known that ELAVL2 is underexpressed.

Alzheimer's disease is the most common form of dementia and 75% of dementia patients have Alzheimer's disease. In most cases, Alzheimer's disease develops beyond the age of 65, but in rare cases it can develop before that. In the United States, approximately 3% of the population aged 65-74 years, approximately 19% of the population 75-84 years old, and 50% of the population aged 85 years and older have the disease. According to a recent study report centered on a rural area in Korea, about 21% of the population over 60 years of age in rural areas show dementia, and 63% of them are reported to have Alzheimer's type dementia. In 2006, 266,000 people worldwide had a disease. It is predicted that by 2050, 1 in 85 people will have the disease.

There is no cure for Alzheimer's disease, and the only way to diagnose it is to prescribe a symptom reliever. Also, there is no early diagnosis system. In the case of the existing diagnosis, various methods are used, but there are many disadvantages. The questionnaire method may have errors due to cognitive differences, structural brain imaging is expensive, and nuclear medicine brain imaging has disadvantages in the use of radioactive isotopes and high cost. Tau protein measurement through cerebrospinal fluid analysis has risks due to invasive methods and cerebrospinal fluid extraction.

Accordingly, the present inventors selected a marker capable of diagnosing cranial nerve diseases such as Alzheimer's disease and at the same time made intensive efforts to develop a more accurate diagnostic method. As a result, it was confirmed that the expression level of miR-485-3p extracted from blood increases was completed.

The information described in the background section is only for improving the understanding of the background of the present invention, and it does not include information forming prior art known to those of ordinary skill in the art to which the present invention pertains. may not be

An object of the present invention is to provide an information providing method for early diagnosis of Alzheimer's disease or brain disease by measuring the expression level of miR-485-3p. Another object of the present invention is to provide a method for diagnosing Alzheimer's disease or a brain disease, a composition for diagnosis, and a kit for diagnosis.

In order to achieve the above object, the present invention provides an information providing method and a diagnostic method for diagnosing Alzheimer's disease or brain disease, comprising measuring the expression level of miR-485-3p from the collected sample.

The present invention also provides a composition for diagnosing brain diseases such as Alzheimer's disease and a diagnostic kit for measuring the expression level of miR-485-3p or the concentration of amyloid beta 42.

According to the present invention, objective data analysis for the diagnosis of Alzheimer's disease or brain disease is possible by measuring the expression level of miR-485-3p in the blood, and the risk of the patient is further reduced by measuring the concentration of amyloid beta 42 in saliva. Minimized, fast and accurate diagnosis is possible. Therefore, according to the present invention, early diagnosis of Alzheimer's disease or brain disease is very useful for preventing Alzheimer's disease or brain disease.

Figure 1 (A) is the miRNA expression pattern analysis (volcano blot) results in the patient group compared to the normal group, (B) is a graph comparing the expression of miR-485-3p in the patient group compared to the normal group.
2 is a seed sequence of 3'-untranslated region (UTR) mRNA of 5xFAD and miR-485-3p.
Figure 3 (A) is a graph comparing the expression of miR-485-3p in the hippocampus and cortex, (B) and (C) are comparison results of ELAVL2 expression and related protein expression in the hippocampus and cerebral cortex of 5xFAD.
Figure 4 (A) is a quantitative comparative analysis graph of Aβ 42 in the cerebral cortex of 5xFAD, (B) is a quantitative comparative analysis graph of Aβ 42 in the hippocampus.
5 is a schematic diagram of a magnetic particle collection device. It shows the process by which antigen, antibody, magnetic particle and fluorescent substance form a complex.
6 is a result of quantification of Aβ derived from saliva using a magnetic particle collection device.
7 shows that dementia patients can be distinguished by measuring the Aβ concentration derived from saliva using a magnetic particle collection device.
8 is a schematic diagram of a process of measuring the level of a nucleic acid expressing amyloid beta (Aβ) 42 .
9 is a comparison result of ELAVL2 expression according to AM485-3p transfection in Hippocampal primary cells.
10 is a quantitative comparison analysis result of ELAVL2-containing related protein and Aβ 42 in 5xFAD treated intranasally with AM485-3p.
11 is a graph comparing the cognitive function in 5xFAD treated intranasally with AM485-3p.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art.

In a specific example of the present invention, it was confirmed that the expression of miR-485-3p in the blood obtained from a patient diagnosed with Alzheimer's dementia by a doctor was significantly increased.

Accordingly, in one aspect, the present invention relates to an information providing method for diagnosing Alzheimer's disease or brain disease, comprising measuring the expression level of miR-485-3p from a sample collected. Also, it relates to a method for diagnosing Alzheimer's disease or brain disease, comprising measuring the expression level of miR-485-3p from the collected sample.

The present invention may be characterized in comprising the step of extracting microRNA miR-485-3p from the sample. The sample may be characterized as blood or plasma, but is not limited thereto.

In one embodiment of the present invention, Sod. About 3 ml of blood was collected in a blood tube (Becton Dickinson, Germany) to which citrate (3.2% w/v) was added. Blood was centrifuged at 3,500 rpm for 10 minutes to separate plasma and stored at -80°C until RNA extraction. miRNA was extracted using the miRNeasy Serum/Plasma Kit (Qiagen, USA) according to the manufacturer's recommendations. miRNA extraction is performed in the following order. Plasma or serum samples are dissolved in QIAzol Lysis Reagent, chloroform is added, and the lysate is separated into an aqueous phase and an organic phase by centrifugation. The RNA portion is divided into an upper aqueous phase, the DNA portion into an intermediate layer, and the protein into an intermediate or lower organic phase. The upper aqueous phase is extracted, and ethanol is added to provide suitable conditions for binding to RNA molecules of about 18 nucleotides or more. By applying the sample to an RNeasy MinElute spin column, all RNA is bound to the membrane and phenol and other contaminants are efficiently washed away. High-quality RNA is eluted in a small amount of RNase-free water. Since serum and plasma mainly contain small RNA, it is not necessary to separately purify small RNA and large RNA fractions.

The present invention includes the step of measuring the expression level of the micro RNA miR-485-3p.

In the present invention, the expression level of miR-485-3p is selected from the group consisting of rea-time PCR, quantitative PCR primer extension analysis, nucleic acid chip analysis, sequencing, aptamer-based assay, and gel chromatography by electrophoresis. It may be characterized in that it is measured by a method, but is not limited thereto.

In one embodiment of the present invention, the concentration and purity of the extracted RNA was analyzed using Bioanalyzer 2100 (Agilent, USA). The extracted RNA was screened using a miRNA array containing 84 different miRNAs known to be associated with the progression of Human Neurological Development and Neurological Disease.

Quantitative PCR assay method can be summarized as follows. Mature miRNAs are generally 22nt, noncoding RNAs and are responsible for post-transcriptional regulation. Mature miRNAs were polyadenylated by poly(A) polymerase and synthesized into cDNA with oligo-dT primers. The oligo-dT primers have a 3' degenerate anchor and a universal tag sequence at the 5' end, enabling mature miRNA amplification in real-time PCR. Mature miRNAs were quantified in real-time PCR using the miScript SYBR Green PCR Kit (Qiagen).

In the present invention, when the expression level of miR-485-3p is 5 times, more specifically, 9 times or more compared to the normal group, it can be characterized as having Alzheimer's disease or a brain disease. The normal group was between 59 and 64 years old, and was selected as those who had no history of Alzheimer's disease or brain disease.

In the present invention, the brain disease may be any one selected from the group consisting of autism spectrum disorder, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, and spinal cord injury, but is not limited thereto.

The information providing method and diagnostic method according to the present invention may additionally use non-marker clinical information of a seizure disease test subject when diagnosing or prognosing Alzheimer's disease and/or various brain diseases by using the expression level of the marker. . Non-marker clinical information of the test subject includes the subject's age, sex, weight, diet, body mass, underlying disease and EEG, seizure type, brain MRI, brain CT, or cerebrospinal fluid test, blood test, and saliva test. , but is not limited thereto.

In the present invention, the information providing method for diagnosing Alzheimer's disease or brain disease may further include measuring the concentration of amyloid beta 42 (Aβ42) from the collected sample.

The sample may be characterized as saliva or blood, but is not limited thereto. The use of saliva as a sample minimizes the risk to the patient and enables a quick and accurate diagnosis.

The concentration of the amyloid beta 42 may be measured using an antigen-antibody reaction or a nucleic acid aptamer, but is not limited thereto. The antigen-antibody reaction may be one widely known in the art including enzyme-linked immunosorbent assay (ELISA). When measuring the concentration of amyloid beta 42 from the collected saliva, although not limited thereto, preferably refer to Korean Patent Application Laid-Open No. 10-2014-0025978 or Korean Patent Publication No. 10-2013-0140528.

In the present invention, the term 'aptamer' refers to a nucleic acid having a specific binding affinity for a target molecule, and in the present invention, in particular, the target molecule is amyloid beta 42.

The specific binding affinity of an aptamer for a target means that the aptamer binds its target with a generally higher degree of affinity than binding to other components in the sample. An aptamer refers to a set of one or more such molecules. Different aptamers may have the same or a different number of one of the nucleotides. Aptamers may be DNA or RNA or chemically altered nucleic acids, and may contain single-stranded, double-stranded or double-stranded regions, and may contain higher ordered structures. An aptamer may also be a photoaptamer so long as a photoreactive or chemically reactive functional group is included in the aptamer so that it can be covalently bound to its corresponding target. Any of the aptamer methods described herein may involve the use of two or more aptamers that specifically bind the same target molecule.

Aptamers can be identified using any known method, including SELEX. Once identified, aptamers can be prepared or synthesized according to any known method, including chemical synthesis methods and enzymatic synthesis methods.

The terms "SELEX" and "SELEX process" refer to (1) the selection of an aptamer that interacts with a target molecule in a preferred manner, for example, a high-affinity binding to a protein, and (2) the selection of the selected nucleic acid. Used interchangeably herein to refer generically to a combination of amplification. The SELEX process can be used to identify aptamers having high affinity for a specific target or biomarker. SELEX generally prepares a candidate mixture of nucleic acids, binds the candidate mixture to a desired target molecule to form an affinity complex, separates the affinity complex from unbound candidate nucleic acid, and removes the affinity complex from the affinity complex. isolating and isolating the nucleic acid, purifying the nucleic acid, and amplifying a specific aptamer sequence. The process may include multiple rounds to further refine the affinity of the selected aptamer. The process may include amplification steps at one or more points in the process (eg US 5,475,096: Nucleic Acid ligands). The SELEX process can be used to generate aptamers that covalently bind to its target as well as aptamers that non-covalently bind to its target (see, e.g., US 5,705,337: Systematic Evolution of Nucleic Acid Ligands by Exponential Enrichment: Chemi-SELEX). The SELEX process can be used to identify high affinity aptamers comprising modified nucleotides that confer improved properties on the aptamer, such as, for example, improving in vivo stability or improving transport properties. have. Examples of such alterations include chemical substitutions at ribose and/or phosphate and/or base positions. The aptamer identified in the SELEX process is U.S. Patent No. 5,660,985 ("High Affinity Nucleic Acid Ligands Containing Modified Nucleotides"), which describes an oligonucleotide containing a chemically modified nucleotide derivative at the 5'- and 2'-positions of pyridine. is described in With reference to the above, US Pat. No. 5,580,737 discloses one or more of the modifications to 2'-amino (2'-NH2), 2'-fluoro (2'-F) and/or 2'-O-methyl (2'-OMe). A high-specificity aptamer comprising the above nucleotides is described. Reference may also be made to US 2009/0098549 (SELEX and PHOTOSELEX), which describes nucleic acid libraries with extended physical and chemical properties in SELEX and optical SELEX and their use. SELEX can also be used to identify aptamers with desirable off-rate properties. Reference may be made to US 2009/0004667 (Method for Generating Aptamers with Improved Off-Rates), which describes an improved SELEX method for generating aptamers capable of binding to a target molecule.

The aptamer is immobilized on a solid support prior to contact with the sample. However, under some circumstances, immobilization of the aptamer prior to contact with the sample may not provide an optimal assay. For example, pre-immobilization of the aptamer may lead to inefficient mixing of the aptamer with the target molecule on the surface of the solid support, possibly with a long reaction time, so A long incubation period is required for efficient binding. Moreover, when a photoaptamer is used in an assay and depends on the material used as a solid support, the solid support will tend to scatter or absorb the light used to effect the formation of a covalent bond between the photoaptamer and its target molecule. can Moreover, depending on the method used, the detection of the target molecule bound to its aptamer may affect the imprecision, as the surface of the solid support may also be exposed to and affected by any labeling reagent. easy to receive Finally, immobilization of the aptamer on a solid support generally involves an aptamer-preparation step (i.e. immobilization) prior to exposure of the aptamer to the sample, which preparation step affects the activity or functionality of the aptamer. can go crazy

The aptamer can be configured to facilitate separation of the assay component from the aptamer biomarker complex (or photoaptamer biomarker covalent complex) and to allow isolation of the aptamer for detection and/or quantification. In one embodiment, this construct may include a cleavable or releasable element within the aptamer sequence. In other embodiments, additional functionality may be incorporated into the aptamer, such as a labeled or detectable component, a spacer component or a specific binding tag or immobilization component. For example, the aptamer may include a tag linked to the aptamer through a cleavable moiety, a label, a spacer component separating the label, and the releasable moiety.

The nucleic acid aptamer is not limited thereto, but DNA, RNA, anti-miR, antisense molecule, fire-fighting RNA molecule (siRNA), bovine hairpin RNA molecule (shRNA), 2'-O-modified oligonucleotide , phosphorothioate-backbone deoxyribonucleotides, phosphorothioate-backbone ribonucleotides, decoy oligonucleotides, PNA (peptide nucleic acid) oligonucleotides or LNA (locked nucleic acid) oligonucleotides that are any one selected from the group consisting of oligonucleotides can be characterized.

In one embodiment of the present invention, a structural feature in which a quencher is dropped and fluorescence is expressed at the same time when binding to amyloid beta 42 using a sequence that specifically binds to amyloid beta 42 and a sequence that binds to itself inside a nucleic acid Multi-nucleic acids were synthesized with Since the size of the multi-nucleic acid is smaller than that of an antibody, it is excellent in specificity and selectivity, and since sampling and mass analysis within 1 hour are possible, it is possible to provide a diagnostic method with high diagnostic ease.

In the present invention, when the concentration of amyloid beta 42 is 0 or more and less than 500 pg/ml, it is normal, 500 pg/ml or more and less than 1 ng/ml, mild cognitive impairment (MCI) or 1 ng/ml or more is diagnosed as a severe patient. can do.

In one embodiment of the present invention, amyloid beta 42 was quantified in more than 100 dementia patients through a previous study, and it was successful in distinguishing mild cognitive impairment from moderate dementia (consistent with the diagnosis of a clinician by more than 90%).

In one embodiment of the present invention, it was confirmed that the increase pattern of miR-485-3p significantly affects the expression level of APP, known as an amyloid beta precursor.

In another aspect, the present invention relates to a composition for diagnosing Alzheimer's disease or brain disease, comprising a primer capable of amplifying miR-485-3p or a probe capable of hybridizing with miR-485-3p.

In the present invention, the primer is constructed to have substantially complementarity with each strand of miR-485-3p to be amplified, and contains appropriate G or C nucleotides. This means that the primer has sufficient complementarity to hybridize with the corresponding nucleic acid strand under the conditions for performing the polymerization reaction. The primers of the present invention are used in the amplification process, and the amplification process is, for example, an enzymatic sequence in which the target locus increases exponentially through many reaction steps, such as PCR. Typically, one primer (antisense primer) has homology to the negative (-) strand of the locus and the other primer (sense primer) has homology to the positive (+) strand. When the primer is annealed to the denatured nucleic acid, the chain is extended by enzymes and reactants such as DNA polymerase I (Klenow) and nucleotides, and as a result, the + and - strands containing the target locus sequence are newly synthesized. When the newly synthesized target locus is also used as a template and cycles of denaturation, primer annealing, and chain extension are repeated, exponential synthesis of the target locus sequence proceeds. The product of the sequencing reaction is an independent double-stranded nucleic acid having a terminus corresponding to the terminus of the specific primer used in the reaction.

The amplification reaction is preferably PCR, which is commonly used in the art. However, alternative methods such as real-time PCR or linear amplification using isothermal enzymes can also be used, and a multiplex amplification reaction can also be used.

In the present invention, the probe is labeled so as to be detectable, for example, it may be labeled with a radioactive isotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelate, or an enzyme. Appropriate labeling of the probe as described above is a technique well known in the art, and can be performed by a conventional method. As the probe, a probe that specifically binds to a known nucleic acid biomarker for diagnosing a disease may be used, and the presence of a specific biomarker or a fragment thereof may be checked through binding to the probe to diagnose a disease.

In the present invention, the sequence of miR-485-3p may be characterized in that it is derived from a mammal, for example, a human, a mouse, or a rat.

In one embodiment of the present invention, the sequence of miR-485-3p is human-derived, and the mature sequence (5' GUCAUACACGGCUCUCCUCUCUCU 3' (SEQ ID NO: 1)) as well as the precursor sequence (5'- ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCUCUCUUUUAGU-3' (SEQ ID NO: 1)) number 2)).

Accordingly, in the present invention, the primer or probe may be characterized in that it has a sequence complementary to all or part of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, but is not limited thereto.

In the present invention, the composition for diagnosing Alzheimer's disease or brain disease may further include an antibody or nucleic acid aptamer that specifically binds to amyloid beta 42. The antibody or nucleic acid aptamer is for detecting amyloid beta 42, and may be used in any form for detecting amyloid beta 42 from a sample.

In another aspect, the present invention relates to a kit for diagnosing Alzheimer's disease or brain disease, comprising the composition for diagnosing Alzheimer's disease or brain disease.

The diagnostic kit of the present invention can be used for diagnosing Alzheimer's disease and/or various brain diseases, and most preferably, it can be used for diagnosing Alzheimer's disease.

The kit of the present invention may further include other components in addition to the above components. For example, when the kit of the present invention is applied to a PCR amplification process, it may optionally contain reagents necessary for PCR amplification, such as a buffer, DNA polymerase, DNA polymerase cofactor, and dNTP, limited thereto. it is not The kit of the present invention may be manufactured in a number of separate packaging or compartments containing the reagent components described above.

In addition, the kit according to the present invention may be a microarray, preferably a gene amplification kit. When the kit is a microarray, a probe is immobilized on the solid surface of the microarray. When the kit of the present invention is a gene amplification kit, primers are included. The probe or primer specifically recognizes miR-485-3p according to the present invention and has a sequence complementary to the sequence. As used herein, the term 'complementary' means having a degree of complementarity to selectively hybridize to the nucleotide sequence under predetermined hybridization or annealing conditions, as defined above, and the probe or primer of the present invention is completely As long as it is capable of selectively hybridizing to the nucleotide sequence other than the complementary one, it may have one or more mismatched nucleotide sequences. The nucleotide sequence of the miRNA of the present invention to be referenced when preparing a primer or probe can be confirmed in miRBase, and a primer or probe can be designed with reference to this sequence.

The composition comprising a substance capable of inhibiting miR-485-3p activity and a pharmaceutically acceptable carrier according to the present invention may be provided as a pharmaceutical composition for preventing or treating Alzheimer's disease or brain disease.

It is based on the finding that the decrease in the expression of ELAVL2 by miR-485-3p of the present invention is associated with Alzheimer's disease. , It provides a pharmaceutical composition for treating or preventing Alzheimer's disease.

In this case, the "miR" is known as a regulatory factor involved in the transcription step after gene expression by mainly inhibiting translation or promoting degradation of the target RNA, and refers to non-coding RNA consisting of 21 to 23 deoxyribonucleotides.

In addition, the mature sequence of the miR can be obtained from the miR database (http://www.mirbase.org). As of August 2012, 25,141 mature miRs from 193 species have been registered according to the miR database (19th edition, miRBase).

In the present invention, miR-485-3p is not limited thereto, but is expressed in the brain, particularly the hippocampus and cortex, and binds to the 3' untranslated region of ELAVL2 mRNA encoding the ELAVL2 protein, thereby inhibiting its expression, Reduces ELAVL2 protein concentration in the brain.

In the present invention, inhibition of miR-485-3p activity means inhibiting or interfering with the intracellular action or function of miR-485-3p. Typically, miR-485-3p is its target, for example, ELAVL2 protein. Directly inhibits binding to an mRNA molecule encoding including those that are indirectly controlled using

Furthermore, the inhibition or inhibition of the activity of miR-485-3p includes directly or indirectly inhibiting the activity of the precursor sequence (SEQ ID NO: 2) and the mature sequence (SEQ ID NO: 1). In addition, inhibition of miR-485-3p activity involves suppressing the transcription of miR-485-3p and lowering its intracellular concentration.

The substance capable of inhibiting the activity of miR-485-3p includes any substance capable of inhibiting its expression and/or activity, for example, a compound (small molecule, high molecular weight), antagomere, antisense molecule, bovine hairpin RNA molecule (shRNA), fire-fighting RNA molecule (siRNA), seed-targeted Locked Nucleic Acid (LNA) oligonucleotide, decoiooligonucleotide, aptamer, ribozyme, or antibody that recognizes a DNA:RNA hybrid can do.

The antisense oligonucleotide encompasses a nucleic acid-based molecule capable of forming a duplex with a miRNA by having a sequence complementary to all or part of a seed sequence of a target miRNA, particularly a miRNA. Thus, the antisense oligonucleotide can be represented as a complementary nucleic acid-based inhibitor.

In addition, the antisense oligonucleotide includes various molecules, for example, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomere, 2'-O-modified oligonucleotide, phosphorothioate-backbone deoxyribonucleotide, A phosphorothioate-backbone ribonucleotide, a peptide nucleic acid (PNA) oligonucleotide or a locked nucleic acid (LNA) oligonucleotide, preferably ribonucleic acid.

The ribonucleic acid includes a double-stranded bovine hairpin RNA molecule (shRNA), a fire-fighting RNA molecule (siRNA) and a ribozyme.

The LNA has a locked form by applying additional modifications between the 2' to 4' carbons of the ribose sugar moiety compared to conventional oligonucleotides, thereby securing thermal stability.

The peptide nucleic acids (PNA) contain a peptide-based backbone instead of a sugar-phosphate backbone. The 2'-O-modified oligonucleotide is preferably a 2'-O-alkyl oligonucleotide, more preferably a 2'-O-C1-3 alkyl oligonucleotide, most preferably a 2'-O-methyl oligonucleotide are nucleotides.

The antisense oligonucleotide includes, in a narrow sense, antisense oligonucleotide, antagomere and inhibitory RNA molecules.

The antagomere is a single-stranded chemically modified oligonucleotide and is used for silencing of endogenous microRNA. The antagomere contains a sequence that is not complementary at the Arganoute 2 (Ago 2) cleavage site, or the base is substituted with a 2' methoxy group, 3' cholesterol group, phosphorothioate, for example, to inhibit Ago2 cleavage. It is modified and has a sequence complementary to the target sequence.

In the present invention, the antagomere has a sequence that is at least partially or completely complementary to miR-485-3p. In embodiments of the present invention, antagomere comprises one or more modifications (eg, a 2'-0-methyl-sugar modification, or a 3' cholesterol modification). In another embodiment, the antagomere comprises one or more phosphorothioate linkages and has at least partially a phosphorothioate backbone.

In the present invention, the length of an antagomere suitable for inhibiting the expression of miR-485-3p is 7-50 nucleotides, in particular 10-40 nucleotides, especially 15-30 nucleotides, even more particularly 15-25 nucleotides, especially 16 to 19 nt, but is not limited thereto.

As used herein, the term 'complementary' means that the antisense oligonucleotide is sufficiently complementary to selectively hybridize to the miR-485-3p target under predetermined hybridization or annealing conditions, preferably physiological conditions, and some or It has a meaning encompassing both partially substantially complementary (substantially complementary) and perfectly complementary (perfectly complementary), and preferably means completely complementary. Substantially complementary, although not completely complementary, refers to complementarity to the extent that it binds to a target sequence and produces an effect sufficient to interfere with the effect according to the present invention, that is, miR-485-3p activity.

The 'nucleic acid' includes oligonucleotides, DNA, RNA, and polynucleotides, analogs and derivatives thereof, for example, peptide nucleic acids (PNA) or mixtures thereof. In addition, the nucleic acid may be single or double stranded, and may encode a molecule including mRNA, microRNA, siRNA, or polypeptide.

In an embodiment of the present invention, a substance capable of inhibiting the activity of miR-485-3p complementarily binds to all or a part of the precursor and/or mature sequence of miR-485-3p, in particular, the seed sequence, so that its activity It is an antisense oligonucleotide capable of inhibiting Inhibition of the activity is to inhibit the transcription of miR-485-3p and/or the binding of miR-485-3p to the target mRNA. The antisense oligonucleotide according to the present invention may or may not include one or more of the following modifications in the nucleotides constituting it or the backbone (backbone) connecting the nucleotides. That is, in the antisense oligonucleotide, at least one nucleotide constituting the same is LNA, or the sugar of at least one nucleotide constituting the same is 2'-O-methylated and medoxylethyl, or at least one phosphothioate in the backbone thereof. have.

In an embodiment of the present invention, the antisense oligonucleotide or nucleic acid molecule comprises a sequence complementary to all or part of the seed sequence of miR-485-3p. The seed sequence is a conserved sequence in various species that is very important for the recognition of miRNA target molecules (Krenz, M. et al., J. Am. Coll. Cardiol. 44:2390-2397 (2004); H. Kiriazis, et al., Annu. Rev. Physiol. 62:321 (2000)). Since miRNA binds to the target through the seed sequence, when the interaction of the seed sequence with the target is inhibited, the translation of the target mRNA can be effectively inhibited.

In an embodiment of the present invention, it comprises a sequence that is completely or partially complementary to the first or second to the seventh or eighth nucleotide sequence among the nucleotide sequence of SEQ ID NO: 1, for example, the antisense oligonucleotide of the present invention 5'-GUGUAUGAC-3' (SEQ ID NO: 3), 5'-UGUAUGAC-3' (SEQ ID NO: 4), 5'-GUGUAUGA-3' (SEQ ID NO: 5), 5'-UGUAUGA-3' (SEQ ID NO: 6 ) or 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 7), wherein each of the one or more nucleotides constituting the oligonucleotide is 2'-O-methylated or medoxyethylated, or each of the one or more nucleotides is LNA Alternatively, at least one of the chemical bonds constituting the backbone may be phosphothioate, but may not include the above modification.

The present invention is based on the discovery that miR-485-3p is involved in the development of Alzheimer's disease and various brain diseases by excessively inhibiting the expression of ELAVL2.

It is known that decreased ELAVL2 expression is associated with Alzheimer's disease, autism spectrum disorder, mental retardation, and amyotrophic lateral sclerosis. In particular, the protein level of ELAVL2 decreases in substances such as kainic acid, NMDA, quisulate, AMPA, and glutamate, which cause excitotoxicity, and causes brain nerve cell death, which causes brain function disorders, such as convulsions, stroke, Parkinson's disease, and spinal cord. It is known to cause various brain diseases such as injury (Kaminska, B. et al., Acta Biochim Pol. 44:781-789).

Therefore, the recovery of ELAVL2 protein through inhibition of miR-485-3p activity of the present invention is effective in Alzheimer's disease and/or autism spectrum disorders, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, spinal cord injury, etc. It can be used for the treatment of diseases.

In an embodiment of the present invention, a pharmaceutical composition comprising a substance capable of inhibiting the activity of miR-485-3p is used for the treatment of Alzheimer's disease, and brain diseases include Alzheimer's disease, autism spectrum disorders, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, spinal cord injury.

As used herein, the term 'treatment', 'alleviation' or 'improvement' refers to any action of improving or beneficially changing the symptoms of a related disease by administering the present composition. Those of ordinary skill in the art to which the present application belongs will be able to know the exact criteria of the disease by referring to the data presented in the Korean Medical Association, etc., and determine the degree of improvement, improvement and treatment.

As used herein, the term 'prevention' refers to any action that suppresses or delays the onset of a related disease. In the present invention, it will be apparent to those skilled in the art that the pharmaceutical composition can prevent early symptoms or related diseases when administered before they appear.

In the present invention, the pharmaceutical composition contains one or more active ingredients exhibiting the same, similar or synergistic function or miR-485 for the treatment of related diseases in addition to the substance capable of inhibiting the activity of miR-485-3p of the present invention. It may further contain a substance capable of inhibiting the activity of -3p and a compound that maintains/increases solubility and/or absorption of the active ingredient. In addition, optionally, an immunomodulatory agent and/or a chemotherapeutic agent may be further included.

The pharmaceutical composition may include one or more pharmaceutically acceptable diluents, carriers and/or adjuvants in addition to the above-mentioned active ingredients. The pharmaceutically acceptable carrier may be used in a mixture of saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and one or more of these components, and, if necessary, an antioxidant , buffers, bacteriostatic agents, and other conventional additives may be added.

In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to form injectable formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules or tablets, and may specifically act on target organs. A target organ-specific antibody or other ligand may be used in combination with the carrier.

Furthermore, it can be preferably formulated according to each disease or component using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Remington's Pharmaceutical Science (latest edition), Mack Publishing Company, Easton PA). . For example, it can be formulated in any one of suspension, liposome formulation, emulsion, tablet, capsule, gel, syrup or suppository.

The administration method of the pharmaceutical composition according to the present invention is not particularly limited, and a known inhibitor administration method may be applied, and parenteral administration (eg, intranasal, intravenous, subcutaneous, intraperitoneal) according to the desired method may be applied. or topical) or oral administration, and administration by intranasal injection is preferred in order to obtain a rapid therapeutic effect.

In addition, the pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. The 'pharmaceutically or therapeutically effective amount' means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs, and other factors well known in the medical field may be determined.

The pharmaceutical composition may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

The dosage varies greatly depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate and severity of disease, etc. It may vary depending on the amount of the drug and/or the specific efficacy of the polynucleotide used. In general, it can be calculated based on the EC50 measured to be effective in in vivo animal models and in vitro, for example, it can be 0.01 μg to 1 g per 1 kg of body weight, in units of daily, weekly, monthly or yearly unit periods, It may be administered in divided doses from once to several times per period, or may be administered continuously for a long period of time using an infusion pump. The number of repeated administrations is determined in consideration of the length of time the drug stays in the body, the concentration of the drug in the body, and the like. According to the course of disease treatment, even after treatment has been performed, the pharmaceutical composition may be administered for recurrence.

In an embodiment of the present invention, the method comprises contacting miR-485-3p with a test substance and determining the activity of miR-485-3p contacted with the test substance, When the activity is reduced compared to the activity of miR-485-3p of the control that has not been contacted with the test substance, it is selected as a candidate substance, and a screening method for a substance for treating or preventing Alzheimer's disease or brain disease is presented.

The miR-485-3p is provided in the form of a cell expressing it, and the activity is analyzed by the expression of miR-485-3p. For example, after contacting a cell expressing miR-485-3p according to the present invention with a test substance, the change in the expression level of miR-485-3p is compared with a control cell that is not contacted or before the contact. Those with fluctuations, especially reductions, are selected as candidates. The expression level of the miR-485-3p may be measured using known methods such as Northern blot, RT-PCR, and a hybridization method using a microarray.

The miR-485-3p is provided in the form of a cell expressing it, and the activity is between the 3'-UTR of the miR-485-3p and its target ELAVL2 protein (ELAV-like neuron-specific RNA binding protein 2). It is determined by interaction analysis. For example, after contacting a cell expressing miR-485-3p according to the present invention with a test substance, the degree of interaction between the 3'-UTR of the ELAVL2 protein and miR-485-3p before or without contact with a control cell Compared with , those with fluctuations, especially reductions, in the interaction are selected as candidates. The method for detecting RNA-RNA interaction used in the method according to the present invention is known in the art, for example, those described in RNA Walk (Lusting et al., Nucleic Acids Res. 2010; 38(1):e5). reference) or Yeat two hybrid system (Piganeau et al., RNA 2006; 12: 177-184), and the like, and RNA: A Laboratory Manual (Cold Spring Harbor Laboratory Press 2011) may be referred to.

The type of cell used in the screening method, the amount and type of the test substance, etc., vary depending on the specific experimental method and the type of the test substance used, and those skilled in the art will be able to select the appropriate cell type, amount and/or conditions. . As a result of the experiment, a substance that causes a decrease in miR-485-3p activity in the presence of the test substance compared to the control that has not been contacted with the test substance is selected as a candidate substance. About 99% or less reduction, about 95% or less reduction, about 90% reduction, about 85% reduction, about 80% reduction, about 75% reduction, about 70% reduction, about 65% or less reduction, about 60% or less compared with control reduction, about 55% reduction, about 50% or less reduction, about 45% or less reduction, about 40% or less reduction, about 30% or less reduction, about 20% or less reduction, but not excluding the range therefrom.

The 'test substance' means a substance expected to inhibit miR-485-3p activity as described above, and a low molecular weight compound, a high molecular weight compound, or a mixture of compounds (eg, natural extract or cell or tissue culture) , or biopharmaceuticals (eg, proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzyme and DNAzyme), or sugars and lipids, but are not limited thereto. The test substance may be a polypeptide having two or more amino acid residues, such as 6, 10, 12, 20 or less or more than 20 such as 50 amino acid residues. The test substance may be obtained from a library of synthetic or natural compounds, and methods for obtaining a library of such compounds are known in the art. Synthetic compound libraries are available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA), and natural compound libraries are available from Pan Laboratories (USA) and It can be purchased from MycoSearch (USA). Test substances can be obtained by various combinatorial library methods known in the art, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution It can be obtained by the required synthetic library method, the "1-bead 1-compound" library method, and the synthetic library method using affinity chromatography selection. Methods for synthesizing molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, et al.

For the purpose of screening a drug for treating Alzheimer's disease and/or various brain diseases according to the present invention, a compound having a low molecular weight therapeutic effect may be used. For example, a compound having a weight of about 1000 Da, such as 400 Da, 600 Da, or 800 Da, may be used. Depending on the purpose, these compounds may form a part of a compound library, and the number of compounds constituting the library varies from tens to millions. Such compound libraries include peptides, peptoids and other cyclic or linear oligomeric compounds, as well as template-based small molecule compounds such as benzodiazepines, hydantoins, biaryls, carbocycles and polycyclic compounds such as naphthalene, phenothi azine, acridine, steroids, etc.), carbohydrates and amino acid derivatives, dihydropyridine, benzhydryl and heterocycles (such as triazine, indole, thiazolidine, etc.), but these are merely exemplary. It is not limited to this.

In addition, cells or biomolecules can be used for screening. The biomolecule refers to a protein, a nucleic acid, a carbohydrate, a lipid, or a substance produced using a cell system in vivo or in vitro. The biomolecule may be provided alone or in combination with other biomolecules or cells. Biomolecules include, for example, polynucleotides, peptides, antibodies, or other proteins or biological organisms found in plasma.

In an embodiment of the present invention, detecting the expression of the miR-485-3p marker from the sample; And providing information necessary for the diagnosis or prognosis of Alzheimer's disease and/or various brain diseases, including the step of correlating the detected expression level of the marker with the diagnosis or prognosis of Alzheimer's disease and/or various brain diseases of a test subject In order to do this, a method for detecting the marker is provided.

In the present invention, the linking step compares the expression level of the determined marker with the detection result for each marker determined in the control, and the expression level of miR-485-3p among the markers is increased compared to that of the control group. .

The non-marker clinical information of the test subject for seizure disease may be additionally used when diagnosing or prognosing the expression level of the marker for Alzheimer's disease and/or various brain diseases of the test subject. Non-marker clinical information of the test subject includes the subject's age, sex, weight, diet, body mass, underlying disease and EEG, seizure type, brain MRI, brain CT, or cerebrospinal fluid test, blood test, and saliva test. It is not limited thereto.

In an embodiment of the present invention, miR-485-3p is based on the discovery that it is involved in the development of Alzheimer's disease and/or various brain diseases by excessively inhibiting the expression of ELAVL2 protein, and in another embodiment, in cells or tissues of a subject , In particular, it provides a method for treating or preventing Alzheimer's disease and/or brain disease through inhibition of miR-485-3p activity in brain cells or brain tissue or brain.

Alzheimer's disease of a subject and or A method for treating or preventing a brain disease is provided.

Furthermore, an embodiment of the present invention provides a substance capable of inhibiting the activity of miR-485-3p for use in the treatment or prevention of brain diseases, wherein the substance capable of inhibiting the activity of miR-485-3p is particularly transmitted to the brain.

In addition, for the inhibitor of miR-485-3p activity used, regulation or inhibition of miR-485-3p activity, administration method, types of treatable diseases, etc., those described above may be referred to.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1: Analysis of miRNA expression patterns using miRNA qPCR array in plasma of Alzheimer's patients

(1) patient and sample preparation

Table 1 shows the characteristics of the patients used in the study. Sod. About 3 ml of blood was collected in a blood tube (Becton Dickinson, Germany) supplemented with citrate (3.2% w/v). Healthy adults matched with the age of four (±4 years) were included as the normal group. .

Gender and age of normal and patient groups Group Sample No. gender age normal group N1 female 78 normal group N2 male 72 normal group N3 female 74 normal group N4 male 79 patient group S1 female 72 patient group S2 female 82 patient group S3 female 84 patient group S4 male 75

Blood was centrifuged at 3,500 rpm for 10 minutes to separate plasma and stored at -80°C until RNA extraction. According to the manufacturer's recommendation, miRNA was extracted using the miRNAeasy Serum/Plasma kit (Qiagen, USA). The concentration and purity of the extracted RNA were analyzed using Bioanalyzer2100 (Agilent, USA). Eight groups met the quality standards and were used in the study. (2) miRNA qPCR array

Table 2 shows miRNA qPCR array The RNA extracted as a gene list used in the analysis was screened using a miRNA array containing 84 different miRNAs known to be associated with the progression of Human Neurological Development and Neurological Disease.

miRNA qPCR array gene list used for analysis No. Mature miRNA list No. Mature miRNA list One hsa-let-7b-5p 43 hsa-miR-298 2 hsa-let-7c-5p 44 hsa-miR-29a-3p 3 hsa-let-7d-5p 45 hsa-miR-29b-3p 4 hsa-let-7e-5p 46 hsa-miR-29c-3p 5 hsa-let-7i-5p 47 hsa-miR-302a-5p 6 hsa-miR-101-3p 48 hsa-miR-302b-5p 7 hsa-miR-105-5p 49 hsa-miR-30d-5p 8 hsa-miR-106b-5p 50 hsa-miR-320a 9 hsa-miR-107 51 hsa-miR-328-3p 10 hsa-miR-124-3p 52 hsa-miR-337-3p 11 hsa-miR-125b-5p 53 hsa-miR-338-3p 12 hsa-miR-126-5p 54 hsa-miR-339-5p 13 hsa-miR-128-3p 55 hsa-miR-342-3p 14 hsa-miR-130a-3p 56 hsa-miR-346 15 hsa-miR-132-3p 57 hsa-miR-34a-5p 16 hsa-miR-133b 58 hsa-miR-376b-3p 17 hsa-miR-134-5p 59 hsa-miR-381-3p 18 hsa-miR-135b-5p 60 hsa-miR-409-3p 19 hsa-miR-138-5p 61 hsa-miR-431-5p 20 hsa-miR-139-5p 62 hsa-miR-432-5p 21 hsa-miR-140-5p 63 hsa-miR-433-3p 22 hsa-miR-146a-5p 64 hsa-miR-455-5p 23 hsa-miR-146b-5p 65 hsa-miR-484 24 hsa-miR-148b-3p 66 hsa-miR-485-3p 25 hsa-miR-151a-3p 67 hsa-miR-485-5p 26 hsa-miR-152-3p 68 hsa-miR-487a-3p 27 hsa-miR-15a-5p 69 hsa-miR-488-3p 28 hsa-miR-15b-5p 70 hsa-miR-489-3p 29 hsa-miR-181a-5p 71 hsa-miR-499a-5p 30 hsa-miR-181d-5p 72 hsa-miR-509-3p 31 hsa-miR-191-5p 73 hsa-miR-511-5p 32 hsa-miR-193b-3p 74 hsa-miR-512-3p 33 hsa-miR-195-5p 75 hsa-miR-518b 34 hsa-miR-19b-3p 76 hsa-miR-539-5p 35 hsa-miR-203a-3p 77 hsa-miR-652-3p 36 hsa-miR-20a-5p 78 hsa-miR-7-5p 37 hsa-miR-212-3p 79 hsa-miR-9-5p 38 hsa-miR-22-3p 80 hsa-miR-9-3p 39 hsa-miR-24-3p 81 hsa-miR-92a-3p 40 hsa-miR-26b-5p 82 hsa-miR-93-5p 41 hsa-miR-27a-3p 83 hsa-miR-95-3p 42 hsa-miR-28-5p 84 hsa-miR-98-5p

Quantitative PCR assay method can be summarized as follows. Mature miRNAs are generally 22nt, noncoding RNAs and are responsible for post-transcriptional regulation. Mature miRNAs were polyadenylated by poly(A) polymerase and synthesized into cDNA with oligo-dT primers. The oligo-dT primers have a 3' degenerate anchor and a universal tag sequence at the 5' end, enabling mature miRNA amplification in real-time PCR. Mature miRNAs were quantified in real-time PCR using the miScript SYBR Green PCR Kit (Qiagen). (3) Analysis of miRNA expression patterns through Volcano plot

1(A) is a miRNA expression pattern analysis (volcano blot) in the patient group compared to the normal group, and 84 miRNA expression patterns in the patient group compared to the normal group were analyzed.

The x-axis represents the fold change and the y-axis represents the p-value of -log10. A horizontal black line indicates a p value of 0.05 or less. Volcano blot analysis results from hsa-miR-105-5p, hsa-miR-98-5p, hsa-miR-15a-5p, hsa-miR-134-5p, hsa-miR-409-3p, hsa-miR-19b- 3p, hsa-miR-92a-3p, hsa-miR-28-5p, hsa-miR-30d-5p, hsa-miR-212-3p, hsa-miR-93-5p, hsa-miR-342-3p, hsa-miR-381-3p, hsa-miR-431-5p, hsa-miR-130a-3p, hsa-miR-146b-5p, hsa-miR-29a-3p, hsa-miR-132-3p, hsa- miR-376b-3p, hsa-miR-22-3p, hsa-miR-509-3p, hsa-miR-139-5p, hsa-miR-499a-5p, hsa-miR-203a-3p, hsa-miR- 95-3p, hsa-miR-128-3p, hsa-miR-487a-3p, hsa-miR-485-3p, hsa-miR-195-5p, hsa-miR-433-3p, hsa-miR-133b, hsa-miR-191-5p, hsa-miR-489-3p, hsa-miR-432-5p, hsa-miR-29c-3p, hsa-miR-485-5p, hsa-miR-652-3p, hsa- miR-126-5p, hsa-miR-328-3p, hsa-let-7b-5p, hsa-miR-539-5p, hsa-miR-106b-5p, hsa-miR-101-3p, hsa-miR- 302a-5p, hsa-miR-484, hsa-miR-518b, hsa-miR-148b-3p, hsa-miR-181d-5p, hsa-miR-7-5p, hsa-miR-512-3p, hsa- miR-151a-3p, hsa-miR-15b-5p, hsa-let-7e-5p, hsa-miR-135b-5p, hsa-miR-181a-5p, hsa-miR-138-5p, hsa-miR- 34a-5p, hsa-miR-346, hsa-miR-511-5p, hsa-miR-485-3p, hsa-miR-485-5p, hsa-miR-487 a-3p, hsa-miR-489-3p, hsa-miR-499a-5p, hsa-miR-509-3p, hsa-miR-511-5p, hsa-miR-512-3p, hsa-miR-518b, hsa-miR-539-5p, hsa-miR-652-3p, hsa-miR-7-5p, hsa-miR-92a-3p, hsa-miR-93-5p hsa-miR-95-3p, hsa-miR It was confirmed that the expression of -98-5p was increased in the patient group. However, the regulation of miRNAs except for hsa-miR-485-3p was not statistically significant. In the case of hsa-485-3p, the p-value was 0.00439, indicating that Alzheimer's patients significantly increased compared to the normal group. When the normal group was 1, the severe dementia showed a 9-fold difference, that is, between 1 and 9 times, can be classified as mild cognitive impairment (FIG. 1(B)). Therefore, hsa-miR-485-3p can be a promising indicator for diagnosing Alzheimer's disease.

Example 2: Human miRNA target gene prediction, same miRNA target gene preservation and anti-mmu-miR-485-3p synthesis in mice

To analyze the nucleotide sequence and target position of hsa-miR-485-3p, using target prediction software (miRDB), the 3-terminal untranslated region (UTR) of human ELAVL2 was identified as the target of hsa-miR-485-3p. Confirmed. It was confirmed that the seed sequence identified here is also conserved in mmu-miR-485-3p and the mouse-derived ELAVL2 3 terminal untranslated region.

Figure 2 is a list of ELAVL2 3'-untranslated region (UTR) mRNA known as a target of hsa-miR485-3p, and shows the target ELAVL2 3'-untranslated region (UTR) mRNA of miR-485-3p. The 5' seed sequence of miR-485-3p (ELAVL2) is shown in red. Table 3 shows the nucleotide sequence of has-miR-485-3p, and a functional study was conducted by synthesizing the sequence to elucidate the physiological function of miR-485-3p using the Alzheimer's disease model.

base sequence of has-miR-485-3p Gene Sequence(5'->3') SEQ ID NO: hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU One

Table 4 shows the nucleotide sequence and target position analysis of mmu-miR485-3p, and the 3'-untranslated region (UTR) and mmu-miR-485- of mouse ELAVL2 using target prediction software (TargetScan, PicTar, and microT). It was confirmed that the target sequence of 3p was conserved. It was confirmed that the 3'-untranslated region (UTR) of mouse ELAVL2 was the target of mmu-miR-485-3p.

Base sequence and target position analysis of mmu-miR485-3p Gene Sequence(5'->3') SEQ ID NO: mmu-miR-485-3p AGUCAUACACGGCUCUCCUCUC 8 target gene Gene name 3P-seq tags + 5 Total sites Representative miRNA ELAVL2 ELAV-like neuron-specific RNA binding protein 2 78 3 mmu-miR-485-3p

For mmu-miR-485-3p overexpressed in the Alzheimer's mouse model, antisense oligonucleotides modified with target genes related to Alzheimer's and brain diseases, specific sequences antagomir, 2'-O-methylation, and phosphorothioate were synthesized.

Example 3: Analysis of miR-485-3p expression in hippocampus and cerebral cortex of 5xFAD mice (RT-qPCR)

(1) Research method

5xFAD transgenic mouse overexpresses mutant forms of APP and PSEN1, and is an animal model of Alzheimer's disease in which intraneuronal Aβ42 accumulation is severe from about 6 weeks.

According to the results of Example 1, RT-qPCR was performed to confirm the expression of miR-485-3p in the dementia animal model. A 10-month-old 5xFAD transgenic mouse and a wild type (WT) mouse were deeply anesthetized and sacrificed with a single head. The brain was immediately excised and the hippocampus and cerebral cortex were dissected from the remaining brain structures. Total miRNA was isolated from the hippocampus using the PAXgene Tissue miRNA Kit (Qiagen, USA) according to the manufacturer's method. cDNA was synthesized using miScript II RT Kit (Qiagen, USA), and qPCR was performed using mmu_miR-485-3p miScript Primer Assay and miScript SYBR Green PCR Kit. The miRNA level was quantified by normalizing it according to snoRNA202 (mouse control).

(2) Research results

3(A) is a comparison result of miR-485-3p expression in the hippocampus and cortex, and RT-PCR was performed to confirm the expression pattern of miR-485-3p in the hippocampus and cerebral cortex of 5xFAD. As a result, it was found that the expression of miR-485-3p was increased in the hippocampus of 5xFAD compared to WT. Therefore, together with the study results of Example 1, it is shown that the expression of miR-485-3p is increased in Alzheimer's dementia. Accordingly, we tried to identify the neuronal target mRNA or protein that miR-485-3p can affect.

Example 4: Confirmation of expression of related proteins including ELAVL2 and amyloid beta 42 in hippocampus and cerebral cortex of 5xFAD mice

(1) Research method

According to the results of Example 3, it was attempted to confirm the expression of ELAVL2-containing related proteins and amyloid beta 42 proteins in the hippocampus and cerebral cortex of 5xFAD. Anesthetized mice (9 months old) were sacrificed with a single head and their brains were removed immediately. An antibody against ELAVL2 (abcam, USA), cFOS antibody (cell signaling, USA), APP antibody (cell signaling, USA), amyloid beta antibody (cell signaling, USA) by preparing homogenates of brain regions (hippocampus, cerebral cortex) ) was used for western blot. The immunoreactive protein was visualized with a chemiluminescent reagent (GE health care, UK) and measured and quantified using a chemical image analyzer (Fusion SL). To quantify amyloid beta 42 protein in the hippocampus and cerebral cortex, mouse/rat amyloid beta (1-42) ELISA kit (IBL) was used to quantify it. For details, refer to the manufacturer's instructions.

(2) Research results

1) Confirmation of ELAVL2 expression in hippocampus and cerebral cortex

3(B) and 3(C) are comparison results of ELAVL2 expression and related protein expression in the hippocampus and cerebral cortex of 5xFAD. ELAVL2 is an ELAV-like RNA-binding protein known to regulate neuronal functions such as neuronal excitability or synaptic transmission, which are directly related to cognitive and behavioral functions. In addition, ELAVL2 is a neural-specific RNA-binding protein responsible for post-transcriptional gene regulation by recognizing the GAAA motif of RNA. As its target, the transcription factor cFOS, which affects the expression level of a protein, is known. Also, cFOS is known to affect the expression of APP protein, known as amyloid beta precursor, in brain cells. It was confirmed that the increase pattern of miR-485-3p significantly affected the APP expression level in a series of processes.

2) Comparison of Aβ42 expression in cerebral cortex and hippocampus

4 is a quantitative comparison analysis result of Aβ42 in 5xFAD, and Aβ42 expression in the cortex and hippocampus of 5xFAD was comparatively analyzed. In 5xFAD, it was confirmed that both the cerebral cortex (FIG. 4(A)) and hippocampus (FIG. 4(B)) significantly increased Aβ42 compared to WT. These results suggest that regulating miR-485-3p can be a way to reduce amyloid beta, which is known as the causative agent of Alzheimer's disease.

Example 5: Measurement of the concentration of amyloid beta (Aβ) 42 isolated from saliva

(1) Research method

Since amyloid beta is measured in saliva practically close to the brain, the accuracy is superior to that of blood, and it has the advantage of enabling early diagnosis by quantifying a small amount of amyloid beta. In addition, higher accuracy (over 99%) can be secured by double-checking as an auxiliary means (blood, miRNA).

By using a sequence that specifically binds to amyloid beta 42 and a sequence that binds to itself inside the nucleic acid, a multi-nucleic acid having a structural feature in which a quencher is dropped and fluorescence is expressed when binding to amyloid beta 42 was synthesized. Since the size of the multi-nucleic acid is smaller than that of an antibody, specificity and selectivity are excellent, and since sampling and mass analysis within 1 hour are possible, it is possible to provide a diagnostic method with high diagnostic ease. Amyloid beta 42 in saliva was quantified using a platform technology (magnetoimmunoassay system) capable of collecting trace amounts of biomarkers in a monolayer ( FIG. 5 ). It is possible to reproduce the collection of certain nanoparticles in a certain area. The aggregate of the saliva-derived amyloid beta and magnetic particle complex is within 300 μm in diameter, and the number of magnetic particles in the aggregate is ~1.0 X 10 ⁴ (Fig. 6(a)). The Region-of-interest (ROI) of the photomultiplier tube (PMT) analysis was 100 × 100 μm ² , and the fluorescence material was measured three times by PMT, and then the average value of each sample was calculated (FIG. 6(b)).

100 patients in the normal group and 100 patients ranging from mild cognitive impairment to severe dementia were recruited, and the ages ranged from the early 30s to the late 80s. Patients who may have other diseases that may affect dementia were excluded.

(2) Research results

A very small amount of amyloid beta was measured in saliva, and amyloid beta that was not released by ELISA was reproduced. As a result of comparison with ELISA on the market for research, it was not detected in normal people in their 30s.

The magnetoimmunoassay system according to this embodiment can simply detect salivary amyloid beta peptide at a concentration of ~20 pg/ml, which is somewhat higher than that of a commercial ELISA system. According to the protocol of the ELISA system used as a reference, the lowest measurable concentration of standard amyloid beta peptide is 7.4 pg/ml, because the curve-fit for the measurement does not satisfy the exact linearity for a very low concentration range. It can be a bit vague.

As a result of measuring salivary amyloid beta 42 for each dementia patient, it was possible to distinguish between normal, mild cognitive impairment (MCI), and severe patients. That is, normal (0~500 pg/ml), mild cognitive impairment (500 pg~1ng/ml), and severe (1 ng/ml~) amyloid beta concentrations were confirmed (FIG. 7). In addition, by quantifying amyloid beta in more than 100 dementia patients, we succeeded in distinguishing mild cognitive impairment from moderate dementia (consistent with the diagnosis of a clinician by more than 90%).

Example 6: Hippocampal primary cell line production and in vitro transfection

(1) Research method

Primary cells extracted from hippocampus and cortical tissues extracted from 5xFAD embryos were cultured. Reference was made to previous studies of fabrication and culture methods (Seibenhener, M.L & Woonten M.W, Isolation and culture of Hippocampal Neurons from Prenatal Mice, Jove, 2012). In Vitro Transfection Using Lipofectamine 2000, primary cells were transfected with 50 nM of miR-485-3p duplex (or scrambled miRNA duplex; Bioneer, Daejon, South Korea) and 50 nM of Antagomir (AM)485-3p. Cell homogenates obtained from 48 hours after transfection were prepared, and western blot was performed using ELAVL2 antibody (abcam, UK). The immunoreactive protein was visualized with a chemiluminescent reagent (GE health care, UK) and measured and quantified using a chemical image analyzer (Fusion SL). Amyloid beta 42 protein was measured using a mouse/rat amyloid beta (1-42) assay kit (IBL) with reference to the manufacturer's instructions.

(2) Research results

ELAVL2 expression according to AM485-3p transfection in hippocampal primary cells was compared (FIG. 9). ELAVL2 was expressed in hippocampus primary cells of 5xFAD, and it was confirmed that the expression of ELAVL2 was increased in cells transfected with AM485-3p compared to control. This means that miR-485-3p suppresses the expression of ElAVL2, and this was demonstrated in the cells treated with AM. Since ELAVL2 is an important factor affecting cognitive function by being involved in neuronal excitability, the development of drugs or compositions such as miR-485-3p inhibitors that increase ELAVL2 may be a key strategy for preventing/treating Alzheimer's disease.

Example 7: Quantitative comparative analysis of ELAVL2-containing related protein and amyloid beta 42 protein in 5xFAD treated intranasally with AM485-3p

(1) Research method

Inhibition of miR-485-3p was induced by nasal administration of sequence-specific entagomere or scramble-sequence entagomere. Intranasal administration of entagomere was performed according to the method of targeting the brain without anesthetizing the mice. (Leah R.T., et al. (2013) Intranasal Administration of CNS Therapeutics to Awake Mice. J Vis Exp. 2013; (74): 4440). After completing the adaptation step described in this paper, fix the mouse for intranasal suction (intranasal grip), position the abdomen upward, and place a pipette in front of one nasal cavity. 6 μl is aspirated 2 times with a pipette, in the form of a drop (1 drop = 3 μl). After holding the position for 15 seconds, inhale the same into the right nasal cavity. After 2 minutes, repeat the same procedure and aspirate a total of 24 µl (AM485 (2'-O-Methylated)-5'-gagaggagagccguguaugacu-3'; 24 µl of 0.1% v/v diethylpyrocarbonate-treated 5 nmol in distilled water; Bioneer, Korea). Control mice were administered an equal volume of Vehicle. After 12 weeks (administration once a week) from the time of nasal administration (7 months), the anesthetized mice were sacrificed with a single head, and the brain was immediately removed. A homogenate of the brain region (hippocampus, and cortex) was prepared and the antibody against ELAVL2 (abcam, USA), cFOS antibody (cell signaling, USA), APP antibody (cell signaling, USA), amyloid beta antibody (cell signaling, USA) was used for western blot. The immunoreactive protein was visualized with a chemiluminescent reagent (GE health care, UK) and measured and quantified using a chemical image analyzer (Fusion SL). Amyloid beta 42 protein was measured using a mouse/rat amyloid beta (1-42) assay kit (IBL) with reference to the manufacturer's instructions.

(2) Research results

In 5xFAD treated with AM485-3p intranasally, quantitative comparison of ELAVL2-containing protein and amyloid beta 42 protein was analyzed (FIG. 10). In Example 6, since the treatment of AM485-3p in the mouse primary cell line induced ELAVL2 changes, it was attempted to confirm the role of AM485-3p in vivo by intranasally treating AM485-3p with 5xFAD. The expression of ELAVL2 was increased in the AM485-3p group compared to the control group. Upon recovery of ELAVL2, the expression of cFOS, a transcription factor involved in the expression of APP, was normalized, which reduced the expression of APP, which led to a decrease in amyloid beta 42 protein (FIGS. 10(A) and (B)). This suggests that the development of drugs or compositions such as miR-485-3p inhibitors is a key strategy for preventing/treating Alzheimer's disease. In addition, since it was confirmed that the treatment of AM485-3p in an animal model had an effect on the inhibition of Aβ42 production (Fig. 10(C)), it is likely that the related inhibitor or drug treatment could resolve the pathological symptoms of Alzheimer's dementia.

Example 8: Comparison of cognitive function in 5xFAD intranasally treated with AM485-3p in 5xFAD mice

(1) Research method

Y-maze and passive avoidance tests were conducted to check whether 5xFAD nasally treated with AM485-3p improved cognitive function.

1) Y-maze test

The Y-maze experiment apparatus consists of a Y-shaped closed maze made of a black acrylic plate (10 cm wide, 41 cm long, and 25 cm high), and each maze is arranged at a constant angle of 120° to each other. have. After defining each maze as areas A, B, and C, carefully place the experimental animals in one area and allow them to move freely for 8 minutes. evaluated. One point (actual alteration: actual alteration, that is, in the order of ABC, BCA, CAB, etc.) was recognized when sequentially entering three different areas. In the case of not entering consecutively, it was not recognized as a score. Therefore, % spontaneous alteration was calculated using the following formula.

% spontaneous alteration = total number of alterations/(total number of entries - 2) x 100

2) Passive avoidance test

The passive avoidance test, which is widely used to measure learning and memory, is a method to measure the working memory ability of rodents. The passive evasion test device is a shuttle box divided into two rooms, and a bright light bulb is installed in one room to create a bright environment that experimental animals do not like. made me feel After 2 hours of stress application, the passive avoidance response was tested (training test). On the floor of the dark room, aluminum rods are laid at regular intervals, which can give an electric shock to the paws of the animal. Experimental animals tend to enter a dark room, so if they were placed in a bright room and then entered a dark room, an electric shock (5V, 0.5 mA, 10 sec) was given to make the animals remember this. Thereafter, the time to enter a dark room without electric shock after 24 hours (latency time) was measured up to 90 seconds (retention tests 1, 2, 3).

(2) Research results

The cognitive function was compared in 5xFAD treated intranasally with AM485-3p (FIG. 11). As a result of the behavioral experiment, both spontaneous alteration (Fig. 11(A)) and retention time (latency time, Fig. 11(B)) were decreased in 5xFAD compared to WT. Since the main symptoms of Alzheimer's dementia are represented by behavioral disturbance and memory loss, the behavioral impairment of 5xFAD appears to be caused by excessive accumulation of amyloid beta and pathology. However, in the group treated with AM485-3p nasally, both the altered behavior and the retention time were significantly increased compared to 5xFAD. This means that AM485-3p treatment can improve the major symptoms of Alzheimer's by relieving pathological symptoms such as behavioral disorders and memory loss, which are caused by miR-485-3p promoting the production of amyloid beta 42 protein. Therefore, it is suggested that the preparation of a drug or composition that modulates miR-485-3p can be a new strategy to improve behavioral disorders and cognitive function, which are the main symptoms of Alzheimer's dementia.

Example 9: Statistical Analysis

Two groups were compared using Student's-t test, and three or more groups were compared using Krushall-Wallis analysis of variance. When the P-value obtained in the Krushall-Wallis test was <0.05, a post-hoc comparison between groups was performed using the Mann-Whitney U test. A two-tailed P-value of 0.05 or less was considered statistically significant.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. will be. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

<110> BIORCHESTRA Ltd. <120> Method for Diagnosing Alzheimer's disease Using microRNA-485-3p <130> HPC-9299 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 1 gucauacacg gcucuccucu cu 22 <210> 2 <211> 73 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 2 acuuggagag aggcuggccg ugaugaauuc gauucaucaa agcgagucau acacggcucu 60 ccucucuuuu agu 73 <210> 3 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 3 guguaugac 9 <210> 4 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 4 uguaugac 8 <210> 5 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 5 guguauga 8 <210> 6 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 6 uguauga 7 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 7 agagaggaga gccguguaug ac 22 <210> 8 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> mmu-miR-485-3p <400> 8 agucauacac ggcucuccuc uc 22

Claims (12)

A pharmaceutical composition for preventing or treating Alzheimer's disease in an Alzheimer's disease patient, comprising a substance capable of inhibiting the activity of miR-485-3p and a pharmaceutically acceptable carrier, wherein the Alzheimer's disease patient is miR-485-3p is increased compared to the normal group, and the substance capable of inhibiting the activity of miR-485-3p is an antisense oligonucleotide, a decoy oligonucleotide or an aptamer.
delete The pharmaceutical composition according to claim 1, wherein the substance capable of inhibiting the activity of miR-485-3p is an antisense oligonucleotide.
4. The method of claim 3, wherein the antisense oligonucleotide is ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomere, 2'-O-modified oligonucleotide, phosphorothioate-backbone deoxyribonucleotide, phosphorothioate- A pharmaceutical composition, characterized in that it is a backbone ribonucleotide, a peptide nucleic acid (PNA) oligonucleotide, or a locked nucleic acid (LNA) oligonucleotide.
5. The pharmaceutical composition according to claim 4, wherein the antisense oligonucleotide is antagomere.
The pharmaceutical composition according to claim 1, wherein the expression level of miR-485-3p is measured from blood or plasma collected from Alzheimer's disease patients.
The pharmaceutical composition according to claim 6, wherein the expression level of miR-485-3p is increased 5 times or more compared to the normal group.
According to claim 6, wherein the expression level of miR-485-3p is rea-time PCR, quantitative PCR primer extension analysis, nucleic acid chip analysis, sequencing, aptamer-based assay and gel chromatography by electrophoresis in the group consisting of A pharmaceutical composition, characterized in that it is measured by a selected method.
The method according to any one of claims 3 to 5, wherein the antisense oligonucleotide comprises a sequence that is completely or partially complementary to the nucleotide sequence from the 1st or 2nd to the 7th or 8th of the nucleotide sequence of SEQ ID NO: 1 A pharmaceutical composition comprising:
6. The pharmaceutical composition according to any one of claims 3 to 5, wherein the antisense oligonucleotide comprises the sequence of SEQ ID NO: 3, 4, 5, 6 or 7.
11. The pharmaceutical composition according to claim 10, wherein the antisense oligonucleotide comprises the sequence of SEQ ID NO: 7.
6. The antisense oligonucleotide according to any one of claims 3 to 5, wherein each of one or more nucleotides constituting the oligonucleotide is 2'-O-methylated or medoxyethylated, or each of the one or more nucleotides is LNA. Or, at least one of the chemical bonds constituting the backbone of the nucleotide is phosphothioate.

Images