CN115074438A

CN115074438A - Circular RNA circTFDP2 and application of siRNA thereof in diagnosis and treatment of prostate cancer

Info

Publication number: CN115074438A
Application number: CN202210630595.3A
Authority: CN
Inventors: 夏李群; 李恭会; 丁理峰; 薛丁玮
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2022-06-06
Filing date: 2022-06-06
Publication date: 2022-09-20

Abstract

The invention discloses an application of circular RNA circTFDP2 and siRNA thereof in diagnosis and treatment of prostate cancer, wherein a fluorescent quantitative PCR method is used for finding that the expression of circTFDP2 in prostate cancer tissues is remarkably increased, the expression level is positively correlated with a Gleason score, and the expression level of circTFDP2 in urine after prostate massage of a prostate cancer patient is positively correlated with the expression level of the prostate cancer tissues; the expression level of circTFDP2 in prostate cancer cells is obviously higher than that of normal epithelial cells of prostate, and after the overexpression of circTFDP2, the expression level can obviously promote the proliferation, migration and invasion of prostate cancer, and the tumor growth and tumor distal metastasis of an in vivo xenograft mouse tumor model; targeted knock-down of circTFDP2 with siRNA significantly inhibited prostate cancer cell proliferation, migration, invasion, and in vivo tumor growth and distant metastasis. The circTFDP2 has important functions in prostate cancer diagnosis and/or prognosis evaluation and treatment, and can be used as a prostate cancer diagnosis biomarker and a prostate cancer treatment target.

Description

Circular RNA circTFDP2 and application of siRNA thereof in diagnosis and treatment of prostate cancer

Technical Field

The invention belongs to the field of tumor diagnosis and biomedical engineering, relates to a new application of endogenous circular RNA and antisense nucleic acid thereof, and particularly relates to an application of circular RNA circTFDP2 and antisense nucleic acid thereof in diagnosis and treatment of prostate cancer.

Background

Prostate cancer is the most common solid organ malignancy in men. In recent years, the incidence of prostate cancer in China is on the rise year by year, and the prostate cancer is an important disease affecting the health of middle-aged and old men in China. The determination of Prostate Serum Antigen (PSA) is currently the most prominent method for early screening for prostate cancer. However, PSA screening often results in over-diagnosis and over-treatment of patients. Clinical treatment of prostate cancer patients requires consideration of a variety of factors including staging, histopathology, molecular characteristics, and patient background. The Chinese medicinal composition has good treatment effect on early localized prostate cancer and radical prostate cancer treatment, and can even cure the localized prostate cancer. However, nearly 30% of prostate cancer patients in China have metastasis during initial diagnosis, endocrine therapy of metastatic prostate cancer can prolong the survival time of the patients and improve the quality of life, but finally, the prostate cancer can progress to hormone-resistant prostate cancer (CRPC). The most major therapeutic drugs for CRPC include docetaxel chemotherapy and novel endocrine therapies such as enzalutamide, abiraterone, etc., but the clinical treatment cost is high and the patient benefit is limited. Therefore, the discovery of new prostate cancer biomarkers for early detection and targeted therapy of prostate cancer is urgently needed, the mortality rate of prostate cancer patients is reduced, and the life quality of the patients is improved.

Circular RNAs are a new class of non-coding RNAs, formed by reverse splicing of precursor RNAs. A large number of circular RNAs have been discovered and play important roles in a variety of physiological and pathological processes. Previous studies have shown that circular RNAs exert their function by adsorbing micrornas (mirnas) or binding to proteins. Recent studies have shown that circular RNAs can encode unique polypeptides by cap structure-independent translation or m 6A-dependent translation. In the development of tumors, circRNA is found to be involved in the processes of stem cell pluripotency maintenance, cell differentiation, cell cycle and apoptosis, angiogenesis and the like to influence the progression and metastasis of tumors.

Exosomes are nanoscale (30-150nm) extracellular vesicles surrounded by lipid bilayer membranes. Exosomes are produced by the endosomal pathway and can be released into body fluids by most types of cells. The exosome carries a large number of specific proteins, functional DNA, mRNA, miRNA, circular RNA and the like, participates in physiological processes such as cell communication, cell migration, angiogenesis promotion and the like in vivo, and is closely related to the occurrence and the process of various diseases including tumors. The exosome is distributed in body fluids such as peripheral blood, urine, saliva, milk, ascites, amniotic fluid and the like, and each component of the exosome can be a marker for disease diagnosis and a specific target for disease treatment.

According to the invention, the paired prostate cancer and para-carcinoma tissues are screened by RT-PCR technology, and the result shows that the circular RNA circTFDP2(circbase ID: hsa _ circ _0008304) is significantly highly expressed in the prostate cancer tissues, and the expression level of the circular RNA circTFDP2 is positively correlated with the prostate cancer Gleason score. The relation between circTFDP2 and prostate cancer is disclosed for the first time. In addition, functional experiments prove that over-expression of circTFDP2 promotes prostate cancer proliferation and metastasis, and interference of circTFDP2 expression can inhibit prostate cancer proliferation and metastasis. And circTFDP2 is present in prostate cancer cell culture fluid and urine exosomes after prostate massage in prostate cancer patients. The invention provides a target for diagnosing and treating prostatic cancer, and has important clinical application value.

Disclosure of Invention

An object of the present invention is to provide a circTFDP2 and its siRNA for use in prostate cancer diagnosis and treatment, which confirm that circTFDP2 is circRNA with upregulated expression in cancer tissues and urine exosomes after prostate massage in prostate cancer patients, and apply circTFDP2 and its siRNA for diagnosis and treatment of prostate cancer.

It is another object of the present invention to provide a kit for diagnosing and/or assessing prostate cancer disease.

The third purpose of the invention is to provide a medicine for treating prostate cancer.

In order to achieve the purpose, the technical scheme of the invention is as follows:

use of circTFDP2 as a diagnostic marker in the manufacture of a reagent for the diagnosis and/or assessment of prostate cancer, the nucleotide sequence of circTFDP2 being as shown in SEQ ID No. 1.

Prostate cancer can be diagnosed and/or assessed by detecting the expression level of circTFDP2 in the prostate or urine exosomes after prostate massage.

A kit for diagnosing and/or assessing prostate cancer comprising primers for the specific amplification of circTFDP 2. The kit can adopt a fluorescent quantitative PCR kit; further, the primers for specifically expanding circTFDP2 are: the sequence of the upstream primer is SEQ ID No.2, and the sequence of the downstream primer is SEQ ID No. 3.

Use of circTFDP2 as a therapeutic target in the manufacture of a medicament for the treatment of prostate cancer.

The application of circTFDP2 siRNA in preparing a medicament for treating prostate cancer, wherein the medicament takes circTFDP2 as a treatment target, and the circTFDP2 siRNA comprises at least one of nucleotide sequences shown as SEQ ID No.4 and SEQ ID No. 5.

A therapeutic agent for prostate cancer, said agent comprising a nucleic acid, biologically active functional fragment or variant having at least one of the sequences shown as SEQ ID No.4 and SEQ ID No. 5. Furthermore, the medicine comprises a pharmaceutically acceptable carrier or auxiliary material, including chitosan, cholesterol, liposome, nano-particles and the like.

Has the advantages that:

the invention discovers that circTFDP2 has important function in the aspects of diagnosis and/or prognosis evaluation of the prostate cancer and treatment for the first time, and can be used as a biomarker for diagnosing the prostate cancer and a therapeutic target.

According to the invention, the fluorescent quantitative PCR method is used for discovering that the expression of circTFDP2 in prostate cancer tissues is obviously increased, and the expression level is positively correlated with the Gleason score. And circTFDP2 was detected in urine following prostate massage in prostate cancer patients and its expression level positively correlated with prostate cancer tissue expression level. Therefore, noninvasive and rapid diagnosis of prostate cancer can be realized by detecting the expression level of circTFDP2 in urine after prostate massage.

The invention discovers that the expression level of circTFDP2 in prostate cancer cells is obviously higher than that of normal epithelial cells of prostate, and after the overexpression of circTFDP2, the invention can obviously promote the proliferation, migration and invasion of prostate cancer, and the tumor growth and tumor distal metastasis of an in vivo xenograft mouse tumor model; conversely, knockdown of circTFDP2 significantly inhibited prostate cancer cell proliferation, migration, invasion and tumor growth in vivo and distant metastasis. The above findings indicate the importance of circTFDP2 for tumor growth and metastasis and suggest the feasibility of targeted knock-down of circTFDP2 with siRNA for prostate cancer treatment.

Drawings

FIG. 1 shows the comparison of the expression level of circTFDP2 in 50 pairs of prostate cancer tissues and paracarcinoma tissues;

FIG. 2 is a graph showing the comparison of the relative expression levels of circTFDP2 in prostate cancer tissues with different Gleason scores;

FIG. 3 is a graph comparing the correlation of 10 prostate cancer tissues with circTFDP2 expression in urine exosomes following prostate massage in corresponding prostate cancer patients;

FIG. 4 is a graph showing the relative expression of circTFDP2 in normal prostate epithelial cells and prostate cancer cell lines;

FIG. 5 shows the circTFDP2 expression level after transfection of si-circTFDP2 and the overexpression plasmid for circTFDP2 in prostate cancer cells.

FIG. 6 is a graph showing the effect of interference and overexpression of circTFDP2 on the proliferative capacity of prostate cancer cells;

FIG. 7 is a graph showing the results of interference and overexpression of circTFDP2 on the proliferative capacity of subcutaneous prostate cancer transplants;

FIG. 8 is a graph showing the effect of interference and overexpression of circTFDP2 on the migration and invasion capacity of prostate cancer cells;

FIG. 9 is a graph showing the results of interference and overexpression of circTFDP2 on prostate cancer metastasis in vivo.

Detailed Description

The invention firstly designs a specific primer capable of amplifying the circular RNA, PCR amplifies the circular RNA of the TFDP2 gene, and determines the accurate cyclization site of circTFDP2 by a first-generation sequencing method, thereby determining that the circTFDP2 is a circular RNA molecule consisting of 174 nucleotides and having a closed circular structure. The nucleotide sequence of circTFDP2 is shown in SEQ ID No. 1.

Further, the invention detects the expression difference of the circTFDP2 gene in prostate cancer tissues and paired normal tissues by adopting a fluorescent quantitative PCR method, and the result shows that the expression level of the circTFDP2 in the prostate cancer tissues is obviously higher than that of paracarcinoma tissues, and the expression level is positively correlated with the prostate cancer Gleason score. And the abundance of circTFDP2 in urine exosomes was positively correlated with the abundance in prostate cancer tissue after prostate massage in prostate cancer patients. Therefore, a kit for detecting the expression change of the circRNA can be prepared, and the prostate cancer can be diagnosed by detecting the expression level of the circTFDP2 in urine exosomes of a patient.

Next, in vitro and in vivo functional studies were performed on circTFDP2 to successfully modulate the expression level of circTFDP2 in prostate cancer cells by transfecting prostate cancer cell lines with a sequence-specific siRNA sequence of the circTFDP2 gene or a circTFDP2 overexpression plasmid. Functional experimental research results show that the proliferation, migration and invasion of cells and the growth and metastasis of the prostate cancer xenograft tumor are remarkably inhibited after the circTFDP2 is knocked down, and conversely, the proliferation, migration and invasion of the prostate cancer cells and the growth and metastasis of the prostate cancer xenograft tumor can be remarkably promoted by over-expressing circTFDP 2. Therefore, the circTFDP2 can be used as a target to prepare or screen a medicament for treating the prostate cancer.

The technical solutions of the present invention will be described clearly and completely with reference to the accompanying drawings, and it should be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 analysis of expression levels of circTFDP2 in prostate cancer tissue and paired Normal tissue

Materials (I) and (II)

All tissue specimens were pathologically confirmed as prostate cancer patients from 10 months in 2018 to 10 months in middle 2021. 50 prostate cancer tissues and matched normal tissues are selected for grouping and numbering.

Second, method

1) Extraction of RNA: 30mg of a tissue sample is put into 500 mu of LRNA lysis buffer (Yihua organism), clean signal grinding beads are added, the tissue sample is put into a homogenizer for homogenization, RNA is extracted according to the operation of a Yihua tissue RNA rapid extraction kit, the purity and the concentration of the extracted RNA are quantified by a NanoDrop ND-1000 nucleic acid quantifier, and the integrity of the extracted RNA is ensured by agarose quality inspection.

2) And (3) cDNA synthesis: cDNA is synthesized by reverse transcription of the extracted total RNA by using a Kangji century reverse transcription kit HiFiScript gDNA Removal RT MasterMix.

3) Real-time quantitative PCR: specific primers are designed according to the nucleic acid sequences of circTFDP2 and GAPDH, and PCR reaction is carried out by adopting UltraSYBR mix of the Kangji century, wherein the upstream primer and the downstream primer of circTFDP2 are respectively SEQ ID NO.2 and SEQ ID NO.3, and the upstream primer and the downstream primer of GAPDH are respectively SEQ ID NO.6 and SEQ ID NO. 7. The reaction system is as follows:

TABLE 1 PCR reaction System

The components are uniformly mixed according to the following procedures: pre-denaturation at 95 ℃ for 10min, 40 cycles: 95 ℃ for 15s and 60 DEG CFor 30 s. The specificity of the reaction is judged according to the dissolution curve, which is shown in formula 2 ^-ΔΔCt The relative expression of circTFDP2 was calculated and the results are shown in figure 1. As can be seen from fig. 1, the expression of circTFDP2 was detected in 50 clinical tissue specimens of prostate cancer, and the results showed that circTFDP2 was significantly upregulated in cancer tissues. Analysis was performed in combination with Gleason score information of 50 prostate cancer samples, and the results are shown in fig. 2, which shows that the Gleason score high group circTFDP2 expression level is relatively high.

Example 2 detection of circTFDP2 expression levels in urine exosomes following prostate massage in prostate cancer patients

1) Extracting urine exosomes of prostate cancer patients after prostate massage: urine is collected after prostate massage is carried out before radical prostate cancer treatment of a prostate cancer patient, and 300g of urine supernatant is obtained after centrifugation for 30 minutes. 50ml of urine supernatant was centrifuged at 100000g for 70 minutes in an ultracentrifuge. The pellet obtained by centrifugation was resuspended in PBS buffer and filtered through a 0.22. mu.M filter.

2) Detection of circTFDP2 expression levels in exosomes: the filtered product was further subjected to RNA extraction, cDNA synthesis and real-time quantitative PCR as described in example 1 to obtain the relative expression level of circTFDP2 in the exosomes.

3) The correlation of urine exosomes with circTFDP2 expression in prostate cancer tissue was calculated by Graphpad prism8.0.2 software and the results are shown in figure 3. As shown in fig. 3, the expression level of circTFDP2 in the prostate cancer urine exosome is positively correlated with the expression level of circTFDP2 in the prostate cancer tissue, the correlation coefficient reaches 0.8, and the data have significant difference.

Example 3 detection of circTFDP2 expression in prostate cancer cells and prostate Normal epithelial cells

Materials (I) and (II)

Prostate cancer cell lines C4-2B, LNCap,22Rv-1, DU145, PC-3 and prostate normal epithelial cells RWPE-1J were all purchased from ATCC cell banks, USA.

Second, method

The relative expression of circTFDP2 in each cell was obtained according to the RNA extraction, cDNA synthesis and real-time quantitative PCR procedures described in example 1 and the results are shown in figure 4. circTFDP2 was significantly elevated in 5 prostate cancer cells compared to normal prostate epithelial cells RWPE-1.

Example 4circTFDP2 interference fragment and overexpression plasmid construction

1) circTFDP2 interference fragment design: the Shanghai Jima biosynthesizes siRNA sequence. The siRNA sequences of 2 circTFDP2 are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.

2) Construction of overexpression vector: synthesizing a circTFDP2 linear complete sequence, annealing the sequence to form a double-stranded DNA fragment, inserting the double-stranded DNA fragment into a pcircRNA vector through a multiple cloning site, identifying the recombinant plasmid through sequencing, and using a pcircRNA empty vector as a negative control without the inserted sequence.

3) And (3) verifying interference and overexpression efficiency:

after cell digestion, the cells were plated in 24-well plates and incubated overnight at 37 ℃ in a 5% CO2 incubator. The next day the cell density was about 80%. siRNA transfection according to lipofectamine RNAimax instructions for transfection; circRNA overexpression plasmid according to lipofectamine ^TM 3000 Instructions for transfection. Cells were harvested 24 hours after transfection and the relative expression of circTFDP2 was determined using RNA extraction, cDNA synthesis and real-time quantitative PCR as described in example 1. From the results shown in fig. 5, the designed siRNA fragment interfering with the expression of circTFDP2 can significantly reduce the expression of circTFDP2, while transfection of the circTFDP2 overexpression plasmid can significantly improve the expression level of circTFDP 2.

Example 5: determination of prostate cancer cell proliferation Capacity following knock-Down or overexpression of circTFDP2

1) Prostate cancer cells (C4-2B, 22Rv-1) transfected with circTFDP2 siRNA or over-expression plasmid were digested into single cell suspensions one day in advance, counted, adjusted to a cell concentration of 20000 cells/ml, and seeded into 96-well plates at 100. mu.L per well, i.e., 2000 cells per well.

2) Adding CCK8 reagent at different time points (1, 2, 3, 4, 5 days) to the wall of a cell, in a ratio of 1: 10, i.e.100. mu.L of culture medium was added to 10. mu.L of test medium.

3) After incubation for 2h at 37 ℃, absorbance at 450nm is detected by a microplate reader.

4) FIG. 5A is a schematic diagram showing the cell growth curve after specific siRNA interferes with the expression of circTFDP2 in prostate cancer cells, and it can be seen from FIG. 5A that the proliferation of prostate cancer cell line interfering with the expression of circTFDP2 is slow; FIG. 5B is a schematic diagram showing the growth curve of prostate cancer cells after overexpression of circTFDP2 plasmid, and it can be seen from FIG. 5B that the proliferation of prostate cancer cell line is accelerated by overexpression of circTFDP 2.

Example 6: determination of proliferative Capacity of prostate cancer xenograft tumors after knockdown or overexpression of circTFDP2

1) Construction of circTFDP2 knockdown and overexpression stable transgenic cell lines: pcircTFDP2 (the over-expression plasmid constructed in example 4) and pcirc-Vector (backbone plasmid without circTFDP2 inserted) plasmids were used directly for lentiviral packaging; the circTFDP2 knock-down sequence SEQ ID No.4 was inserted into plko.1 vector to obtain the circTFDP2 lentiviral knock-down plasmid for use in knocking down lentiviral packaging. Mu.g of the desired gene plasmid was thoroughly mixed with 7.5. mu.g of a virus packaging plasmid (pMDL: VSV-G: REV ═ 5:3:2) and 30ul of lipofectamine2000, and the mixture was allowed to stand for 15 minutes and then added dropwise to a 10cm 293T monolayer cell culture medium. After 6 hours of transfection, the medium was changed, the culture was continued for 48 hours, and the supernatant containing lentivirus was collected and concentrated by ultrafiltration to infect cells. Prostate cancer 22Rv-1 cells were then infected with the prepared lentivirus, the fluid was changed 24 hours after infection, and the level of circTFDP2 expression was measured by qPCR 2 weeks after puromycin screening.

2) Subcutaneous graft tumor model observation the effect of circTFDP2 on graft tumor proliferation: constructed cells stably knockdown and overexpress circTFDP2 were expressed as 10 ⁷ One mouse was inoculated subcutaneously into each of male BALB/c nude mice. Nude mice were sacrificed after 5 to 6 weeks, tumors were collected, and tumor volume was measured, and the results are shown in fig. 7. As shown in fig. 7, the growth of the transplanted tumor was significantly inhibited after knockdown of circTFDP2, while the growth of the transplanted tumor of the circTFDP2 over-expressed group was significantly accelerated.

Example 7: effect of knocking down or over expressing circTFDP2 on migration and invasion capacity of prostate cancer cells

The stably knockdown and overexpression circTFDP2 prostate cancer cells constructed in example 6 were seeded into a transwell chamber at 100 μ L per well (no FBS), 0.6ml of complete medium containing 10% FBS was added to the lower chamber of the transwell to stimulate cell migration, after culturing for 24 hours in a cell incubator, the aerial medium was discarded, fixed with tissue fixative at room temperature for 15 minutes, stained with 0.1% crystal violet for 10 minutes, rinsed with clear water, gently wiped off the upper layer of non-migrated cells with a cotton swab, observed under a microscope and counted by taking a photograph of four fields. Cell invasion experiments required 50ul Matrigel gel to be added to the upper chamber of the transwell chamber, and the rest was essentially the same as above. The experiment was repeated 3 times independently, cell migration, number of invasion counted by ImageJ software, and statistical t-test was performed, with statistical differences of significance at P <0.01 and of extreme significance at P < 0.001. As a result, it was found that the migration and invasion ability of prostate cancer cells was significantly reduced after knocking down circTFDP2, whereas overexpression of circTFDP2 promoted the migration and invasion of prostate cancer cells (fig. 8).

Example 8: tail vein metastasis model observation of effect of circTFDP2 on prostate cancer metastasis in vivo using stably knockdown and over-expressing circTFDP2 cells constructed in example 6 as 10 ⁷ One/only was inoculated into male BALB/c nude mice by tail vein injection. After 6-8 weeks of culture, prostate cancer metastasis was observed by a small animal imaging system and the results are shown in FIG. 9. As can be seen from the experimental results, the tumor of the knockdown circTFDP2 group had significantly fewer metastases than the control group, while the metastases were significantly increased after overexpression of circTFDP 2.

SEQUENCE LISTING

SEQ ID NO.1

>hsa_circ_0008304|NM_001178138|TFDP2

GTTGTTCTTTTAAAGAATTATTGAAGACGAAGGTTTTTTTCTTTTTATTTTTT TAATGGCTTTACAGAATCTTAAATAGAATACAGTTTGACATGACGGCAAAA AATGTTGGTTTGACTTCCACAAATGCAGAAGTAAGAGGATTTATAGATCAG AATCTCAGTCCAACAAAAG

SEQ ID NO.2

TGGTTTGACTTCCACAAATGC

SEQ ID NO.3

AAACCTTCGTCTTCAATAATTC

SEQ ID NO.4

GTCCAACAAAAGGTTGTTC

SEQ ID NO.5

CCAACAAAAGGTTGTTCTT

SEQ ID NO.6

CAAGGTCATCCATGACAACTTTG

SEQ ID NO.7

GTCCACCACCCTGTTGCTGTAG。

Sequence listing

<110> Zhejiang university

<120> cyclic RNA circTFDP2 and application of siRNA thereof in diagnosis and treatment of prostate cancer

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 174

<212> DNA

<213> person (Homo sapiens)

<400> 1

gttgttcttt taaagaatta ttgaagacga aggttttttt ctttttattt ttttaatggc 60

tttacagaat cttaaataga atacagtttg acatgacggc aaaaaatgtt ggtttgactt 120

ccacaaatgc agaagtaaga ggatttatag atcagaatct cagtccaaca aaag 174

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggtttgact tccacaaatg c 21

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaaccttcgt cttcaataat tc 22

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtccaacaaa aggttgttc 19

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtccaacaaa aggttgttc 19

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caaggtcatc catgacaact ttg 23

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtccaccacc ctgttgctgt ag 22

Claims

Use of circTFDP2 as a diagnostic marker in the preparation of a reagent for diagnosing and/or assessing prostate cancer, wherein the nucleotide sequence of circTFDP2 is shown as SEQ ID No. 1.
2. Use according to claim 1, for the diagnosis and/or assessment of prostate cancer by detecting the expression level of circTFDP2 in the prostate or urine exosomes following prostate massage.
3. Kit for diagnosing and/or assessing prostate cancer, characterized in that it contains primers specifically amplifying circTFDP 2.
4. The kit for diagnosing and/or assessing prostate cancer according to claim 3, characterized in that the primers specifically extending circTFDP2 are: the sequence of the upstream primer is SEQ ID No.2, and the sequence of the downstream primer is SEQ ID No. 3.
5. The kit for diagnosing and/or assessing prostate cancer according to claim 3, wherein the test sample in the kit is post-prostate massage urine.
Use of circTFDP2 as a therapeutic target in the manufacture of a medicament for the treatment of prostate cancer.
The application of circTFDP2 siRNA in preparing a medicament for treating prostate cancer, wherein the medicament takes circTFDP2 as a treatment target, and the circTFDP2 siRNA comprises at least one of nucleotide sequences shown as SEQ ID No.4 and SEQ ID No. 5.
8. A medicament for the treatment of prostate cancer, said medicament comprising a nucleic acid, biologically active functional fragment or variant having at least one of the sequences shown as SEQ ID No.4, SEQ ID No. 5.
9. The medicament of claim 8, wherein the medicament comprises a pharmaceutically acceptable carrier or excipient.