CN112011620B - Application of circ-SLC38A1 as target in medicine for inhibiting bladder cancer cells - Google Patents

Abstract

The invention belongs to the technical field of tumor biological gene therapy, relates to a biological marker and a target point for diagnosing and treating bladder cancer, and particularly relates to application of circ-SLC38A1 as a target point in medicines for inhibiting bladder cancer cells. The invention discloses the expression of circ-SLC38A1 in tumor tissues of patients with bladder cancer and the function of circ-SLC38A1 in bladder cancer cells. The first discovery shows that the circ-SLC38A1 can be used as a bladder cancer diagnosis biomarker and a drug treatment target. As compared to normal controls, circ-SLC38A1 was significantly upregulated in tumor tissue in bladder cancer patients. The result of the invention shows that the interference with circ-SLC38A1 can inhibit the migration and invasion capacity of bladder cancer cells, shows that the circ-SLC38A1 plays the role of cancer promotion genes in the occurrence and development of bladder cancer, and provides a new target for clinical treatment of bladder cancer.

Description

Application of circ-SLC38A1 as target in medicine for inhibiting bladder cancer cells

Technical Field

The invention belongs to the technical field of tumor biological gene therapy, relates to a biological marker and a target point for diagnosing and treating bladder cancer, and particularly relates to application of circ-SLC38A1 as a target point in medicines for inhibiting bladder cancer cells.

Background

Bladder Cancer (BC) is the most common malignant tumor of the urinary system and is one of ten common tumors of the whole body. The medicine takes the first place of the disease rate of genitourinary tumors in China, and the disease rate of the medicine is second to that of prostatic cancer in the West and is 2 nd. The incidence of bladder cancer in the national tumor registration area in 2012 was 6.61/10 ten thousand, which is the 9 th position of the incidence of malignant tumors. Bladder cancer can occur at any age, even in children, and cancer morbidity and mortality continue to rise in recent decades. About 25% of urothelial cancers are diagnosed as muscle-invasive bladder cancer, of which about half of patients with muscle-invasive bladder cancer can develop distant metastases with poor prognosis. However, since conventional cystoscopy is invasive, patients suffer much pain, risk of bleeding and infection, and have low sensitivity to in situ cancer diagnosis. In addition, most patients have unobvious symptoms at the early stage of the disease, have advanced to the middle and late stage of disease development during treatment, develop muscle layer infiltrations, and have distant metastasis, which seriously affects the life quality and life health of the patients and brings heavy burden to families of the patients. Therefore, early diagnosis is closely related to clinical treatment and patient survival in prognosis, a strict and scientific detection method is used in the initial diagnosis period, and the search for a new efficient and stable monitoring index is a hot point concerned in recent years.

Circular RNA (circRNA) is a special non-coding RNA molecule, is in a covalent closed circular structure, has no 5 'cap and no 3' poly-adenine tail, and compared with the traditional linear RNA, can not be influenced by RNA exonuclease, has more stable expression and is not easy to degrade. circrnas can be expressed in a tissue-specific or developmental stage-specific manner, suggesting their widespread involvement in a variety of physiological and pathophysiological processes. In recent years, the unique structural features and properties of circRNA have attracted interest to biomedical researchers, and its formation and function are being analyzed. Unlike the way in which linear RNA is produced, circRNA is formed by "reverse splicing" in a non-classical manner. According to different sources and sequences, the circular RNAs are mainly divided into three types, namely exon circular RNAs (ecircRNAs), intron RNAs (circular RNAs) and circular RNAs (exon-intron RNAs and EIcRNAs) which are jointly formed by exons and introns.

The biological functions of the circRNA are mainly four (1) as miRNA sponges, wherein the circRNA can compete to bind with related miRNA to influence the action of the miRNA on the target mRNA. (2) the biological function is exerted by regulating gene transcription, and some circRNAs positioned in a nucleus have U1 snRNA binding sites, can form an RNA-RNA complex and are combined with RNA polymerase II (Pol II) in a promoter region to regulate the transcription of a parent gene. (3) binding to RNA binding proteins is involved in regulating a variety of biological activities, including cell proliferation, differentiation, motility, apoptosis, aging, and the like. (4) Has the function of coding protein, and certain circRNAs have a highly conserved Intracellular Ribosome Entry Site (IRES) and have the function of translation.

In recent years, the association of circRNA with cancer has become a major issue in the field of cancer research, and hundreds of circrnas have been shown to be abnormally expressed in various human cancers, including bladder cancer. circRNA has been found to be involved in cell proliferation, apoptosis, Epithelial Mesenchymal Transition (EMT), invasion and metastasis of cancer cells, and thus, circRNA can be used as a biomarker for disease diagnosis.

Currently, the clinical diagnosis methods for bladder cancer mainly include cystoscopy and urine cytology, but cystoscopy is invasive, has bleeding and infection risks, and has low sensitivity to in situ cancer diagnosis. The urine cytology examination is easily influenced by calculus and inflammation to generate false positive results, and the sensitivity is low. The early diagnosis marker of bladder cancer can reduce the use of cystoscope and supplement the use of cystoscope to replace urine cytology examination, so that the early diagnosis of bladder cancer is more accurate and economic.

Disclosure of Invention

The invention provides a novel bladder cancer diagnosis and treatment biological marker and target aiming at the problems in the traditional bladder cancer diagnosis and treatment.

In order to achieve the purpose, the invention is realized by adopting the following technical scheme:

the invention provides application of circular RNA (circular RNA/circular RNA) SLC38A1 (circular-SLC 38A1) which is divided into biological markers in diagnosis and treatment of bladder cancer. The circBase ID is has _ circ _0000396, is derived from human chromosome 12, is generated by reverse splicing and cyclization of exons 2 to 5 of an SLC38A1 host gene, the length of a cyclized mature sequence is 522nt, and a linear base sequence is shown as SEQ ID NO. 1.

The corresponding linear deoxyribonucleotide sequence of the circular RNA SLC38A1 is shown in SEQ ID NO. 1.

>hsa_circ_0000396|NM_030674|SLC38A1：

ATATTTATTGAGTGTCTACTGTGTGCCAGGCACTATATCTATGTGCATAGAAAAACCCTGGAAGGCCATACAACAATATATATAGAGTGATCGTCTCTGCTTGCTGAGCTAACAGGGGTGTCAAGCTTCCATTTTGGTATCTACTTCTAAATACACTCAGAACAGGAGAAATTTGGACTAATTTTCAAACTACAGACACTTTCTAATCATGATGCATTTCAAAAGTGGACTCGAATTAACTGAGTTGCAAAACATGACAGTGCCCGAGGATGATAACATTAGCAATGACTCCAATGATTTCACCGAAGTAGAAAATGGTCAGATAAATAGCAAGTTTATTTCTGATCGTGAAAGTAGAAGAAGTCTCACAAACAGCCATTTGGAAAAAAAGAAGTGTGATGAGTATATTCCAGGTACAACCTCCTTAGGCATGTCTGTTTTTAACCTAAGCAACGCCATTATGGGCAGTGGGATTTTGGGACTCGCCTTTGCCCTGGCAAACACTGGAATCCTACTTTTTCT。

（SEQ ID NO .1）。

The invention provides a potential diagnosis biomarker and a treatment target of bladder cancer, which is circ-SLC38A1(hsa _ circ _0000396| chr12:46229153-46243314- | SLC38A1) (the nucleotide sequence is shown as SEQ ID No. 1). The circ-SLC38A1 is formed by reverse splicing of exon 2-5 of the SLC38A1 gene, with the circularized sequence 522 nt.

The present invention proposes to detect the expression level of circ-SLC38a1 in a sample from a subject likely to have bladder cancer, wherein a higher expression level of circ-SLC38a1 correlates with an increased likelihood that the subject has bladder cancer and an unfavorable prognosis.

The invention provides an application of a detection reagent of circ-SLC38A1 (has _ circ _ 0000396) content in preparation of a bladder cancer diagnosis kit, wherein the detection reagent is a primer capable of being amplified, and the base sequence of the primer is shown as SEQ ID NO. 2 and SEQ ID NO. 3.

A diagnostic kit for bladder cancer, the kit comprising primers capable of amplifying circ-SLC38a1 (has _ circ _ 0000396), including an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown as SEQ ID No. 2; the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3.

The application of the above molecular marker circ-SLC38A1 (has _ circ _ 0000396) in bladder cancer diagnostic reagents, and the detection method of the circ-SLC38A1 molecular marker comprises the steps of total RNA extraction of a sample, reverse transcription of RNA and real-time quantitative PCR amplification.

The application of the circ-SLC38A1 (has _ circ _ 0000396) molecular marker in the bladder cancer diagnostic reagent, and the concrete steps of sample total RNA extraction, RNA reverse transcription and real-time quantitative PCR amplification comprise that the total RNA extraction uses Feijefast 2000 kit, the second step uses Prime-Script to reverse transcribe RNA into cDNA, TM one-step method RT-PCR kit, Gapdh is used as internal control, and SYBR Green PCR Master Mix is used for all qRT-PCR reactions.

The invention provides application of circular RNA SLC38A1 in inhibition of biological functions of bladder cancer cells, relates to discovery, detection and application of a circ-SLC38A1 molecular marker, and designs and synthesizes a detection primer specifically used for real-time quantitative PCR and small interfering RNA (siRNA) for interfering the circ-SLC38A1 in vitro. As compared with the normal control, the expression of circ-SLC38A1 in the tissue sample of the bladder cancer patient is obviously up-regulated. In vitro experiments show that circ-SLC38A1 can promote invasion and metastasis of bladder cancer. The research result of the invention shows that the circ-SLC38A1 can inhibit the biological function of bladder cancer cells, and an ideal molecular early warning signal is found in the pathological process of the bladder cancer aiming at the current situations that the compliance of a target population to cystoscopy screening is poor and most of clinically diagnosed bladder patients are in middle and late stages, so that cystoscopy and pathological diagnosis are performed in a targeted manner, the pain of the patients is relieved, over-treatment is avoided, and medical resources are saved.

Compared with the prior art, the invention has the advantages and positive effects that:

1. the invention discloses the expression of circ-SLC38A1 in tumor tissues of patients with bladder cancer and the function of circ-SLC38A1 in bladder cancer cells.

2. The first discovery shows that the circ-SLC38A1 can be used as a bladder cancer diagnosis biomarker and a drug treatment target.

3. As compared to normal controls, circ-SLC38A1 was significantly upregulated in tumor tissue in bladder cancer patients.

4. The result of the invention shows that the interference with circ-SLC38A1 can inhibit the migration and invasion capacity of bladder cancer cells, shows that the circ-SLC38A1 plays the role of cancer promotion genes in the occurrence and development of bladder cancer, and provides a new target for clinical treatment of bladder cancer.

Drawings

FIG. 1 is a biological synthesis, schematic structure and post sequencing circularization site map of circ-SLC38A 1.

FIG. 2 is a graph showing the results of electrophoresis after RT-PCR, in which yellow (odd) triangles represent reverse primers (reverse primers) and green (even) triangles represent forward primers (reverse primers); it was confirmed that circ-SLC38A1 was expressed in the bladder cancer cell line.

FIG. 3 shows the relative expression levels of circ-SLC38A1 and its linear transcript SLC38A1 after RNase R digestion. It proves that circ-SLC38A1 is insensitive to exonuclease and has higher stability;

FIG. 4 is a graph showing the results of tissue expression level measurement in bladder cancer patients using the circ-SLC38A1 primer. Represents a p value < 0.05.

FIG. 5 is a qRT-PCR validation graph of the transfection knockdown efficiency of circ-SLC38A1 small interfering RNA (siRNA) in both T24 and 5637 cell lines. si-NC stands for negative control group; si-circSLC38a1#1, si-circSLC38a1#2 represent groups of sirnas transfected with two reverse splice sites targeting circ-SLC38a1, respectively; represents a p value < 0.01, and represents a p value < 0.001.

FIG. 6 is a graph showing the results of the migration and invasion changes of the bladder cancer cell lines T24 and 5637 after the knock-down of circ-SLC38A 1.

Detailed Description

In order that the above objects, features and advantages of the present invention may be more clearly understood, the present invention will be further described with reference to specific embodiments. It should be noted that the embodiments and features of the embodiments of the present application may be combined with each other without conflict.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced in other ways than those specifically described herein, and thus the present invention is not limited to the specific embodiments of the present disclosure.

Example 1

5 cases of bladder cancer and paracancer normal tissues are selected from a tissue specimen library, an Illumina Hiseq4000 sequencing platform is adopted after quality inspection of the prepared RNA library is qualified, high-throughput deep sequencing is carried out in a PE150 sequencing mode, signal data are processed (default thresholds of genes with obvious differences are set to be p less than or equal to 0.05 and Fold change more than or equal to 2.0), 2196 circRNAs with obvious differences in expression are obtained, wherein 1797 shows up-regulation expression, 399 shows down-regulation expression, clustering analysis is carried out on the circRNAs with obvious differences in expression, GO and KEGG circRNA function enrichment analysis is carried out, and circ SLC-38A 1 (has _ circ _ 0000396) shows obvious up-regulation in bladder cancer tissues.

The exact circularization site of circ-SLC38A1 (has _ circ _ 0000396) was determined by designing specific primers that amplify the circular RNA and by one-generation sequencing (see FIG. 1).

The expression difference of circular RNA circ-SLC38A1 (has _ circ _ 0000396) in bladder cancer tissue samples was verified by real-time fluorescent quantitative PCR and tissue chip method (as shown in FIG. 4).

Total RNA of the invasive bladder cancer-derived cell line T24 was extracted, RNA was divided into two portions, each of which was < 5. mu.g, 3. mu.l RNaseR (20U/. mu.l), 2. mu.l 10 × Reaction Buffer was added to one portion of RNA, 20. mu.l of RNase-free water was added to the other portion of RNA to make up 20. mu.l of the system for the experimental group, RNase-free water was added to the other portion of RNA to make up 20. mu.l of the system for the control group, the Reaction was carried out at 37 ℃ for 20min, and the Reaction was maintained at 70 ℃ for 10min to inactivate RNaseR. The reaction RNA was reversed and qRT-PCT with convergent and digigent primers amplified for linear transcripts SLC38A1 and circSCL38A1, respectively, showing that after RNaseR treatment, circ-SLC38A1 was more stable than the linear transcript SLC38A1 (as shown in FIG. 3).

Experimental materials and methods:

and (3) collecting clinical samples: bladder cancer and corresponding paracancerous fresh tissue were collected, with the sample collection criteria being: firstly, bladder cancer is confirmed by pathological examination; ② no other malignant tumors or diseases; ③ before operation, the patient does not receive any treatment such as radiotherapy and chemotherapy; fourthly, the follow-up has determined prognosis information. Washing residual blood on the surface of the postoperative tissue with precooled PBS, subpackaging on ice, and quickly freezing in liquid nitrogen for 30min in an ultra-low temperature refrigerator at-80 ℃.

Cell lines and cell culture: human bladder cancer lines T24 and 5637, available from shanghai life science research institute of chinese academy of sciences. Bladder cancer cell T24 was cultured in medium containing 10% fetal bovine serum (Gibco) McCOY' 5A (Gibco), bladder cancer cell 5637 was cultured in medium containing 10% fetal bovine serum (Gibco) 1640 (Gibco), and 100U/ml penicillin and 100. mu.g/ml streptomycin (Gibco, NY, USA) were added. At 37 deg.C, contains 5% CO₂Culturing the cells in the environment of (a).

RNA extraction and real-time fluorescent quantitative PCR (qRT-PCR): total RNA of the tissue was extracted using Trizol (Invitrogen, Carlsbad, CA, USA); total RNA of cells is extracted by adopting an RNA extraction kit fast2000 (Shanghai Feijie). The reverse transcription Kit adopts PrimeScript RT reagent Kit (TaKaRa, Dalian, China); the fluorescent quantitative PCR kit adopts TB Green TM Premix Ex TaqTM II (TaKaRa, Dalian, China): performing PCR reaction by using a CFX96 real-time fluorescent quantitative PCR instrument (Berle); GAPDH is used as an internal reference; calculating the relative expression quantity of RNA by adopting a 2-delta Ct method; the primer is synthesized by Jinan Boshang biotechnology, Inc.; the primer sequences are shown in Table 1.

Table 1 primer sequences used for qRT-PCR:

transfection: specific small interfering RNA (siRNA) targeting the reverse splice site of circ-SLC38A1 and a negative control (si-NC) were synthesized from the Gima gene (Shanghai); 2.5. mu.g of siRNA or Negative control were transfected into bladder cancer cells T24 and 5637, respectively, using Lipofectamine3000(Invitrogen, Carlsbad, Calif., USA) according to the instructions for use; the siRNA sequences are shown in Table 2. There are two small interfering RNAs (siRNAs), si-circSLC38A1# and si-circSLC38A1# 2. Negative control is a control, and the interference efficiency of small interfering RNA needs to be compared with the control. The interference efficiency is shown in figure 5. In the bladder cancer cell T24, the interference efficiency of si-circSLC38A1#1 and si-circSLC38A1#2 is lower than 0.5. In bladder cancer cells 5637, the interference efficiency of si-circSLC38A1#1 and si-circSLC38A1#2 was less than 0.6.

TABLE 2 siRNA sequences

The 24-well cell pool was placed in a 24-well plate. Cells were trypsinized, digestion was stopped in medium containing 10% fetal bovine serum, and cells were counted, 50000 cells/well, the corresponding number of cells were removed, centrifuged at 800rpm for 5 minutes at room temperature, the supernatant was discarded, and resuspended in serum-free medium. 50000 cells/200. mu.l were seeded in a 24-well cell pool. The lower chamber was filled with medium containing 20% fetal bovine serum. After culturing at 37 ℃ in an environment of 5% CO2 for 24h, the supernatant and the culture medium in the lower chamber are discarded, the cells which are not migrated in the upper chamber are wiped off by a cotton swab, washed twice by PBS, and fixed for 1h by 4% paraformaldehyde. After fixation, the fixative was discarded, washed twice with PBS and the chamber was stained with Giemsa stain for 2-4 h. The cell was washed twice with PBS, the cell well membrane was cut off and fixed with neutral gum. Photographs were taken using a CZI microscope. The cells were counted.

The 24-well cell pool was placed in a 24-well plate. Adding 60 μ l matrigel into upper chamber, standing at 37 deg.C under 5% CO2 for 1-2h, and allowing the gel to solidify into jelly. Cells were trypsinized, digestion was stopped in medium containing 10% fetal bovine serum, and cells were counted, 100000 cells/well, the corresponding number of cells were removed, centrifuged at 800rpm for 5 minutes at room temperature, the supernatant was discarded, and resuspended in serum-free medium. 100000 cells/200. mu.l were seeded into 24-well cell pools. The lower chamber was filled with medium containing 20% fetal bovine serum. After culturing at 37 ℃ in an environment of 5% CO2 for 48h, the supernatant and the culture medium in the lower chamber were discarded, the uninfected cells in the upper chamber were wiped off with a cotton swab, washed twice with PBS, and fixed with 4% paraformaldehyde for 1 h. After fixation, the fixative was discarded, washed twice with PBS and the chamber was stained with Giemsa stain for 2-4 h. The cell was washed twice with PBS, the cell well membrane was cut off and fixed with neutral gum. Photographs were taken using a CZI microscope. The cells were counted.

Statistical analysis: the results were statistically analyzed using SPSS 23.0 software. Plots were made using GraphPad Prism 7.0 software. Statistical analysis was performed using either the t-test or Wilcoxon signed rank test as appropriate. Data were counted at least three times. Mean ± standard deviation of independent experiments showed that all P values were bilateral and P < 0.05 was considered statistically significant.

2. The experimental results are as follows:

as shown in FIG. 1, circ-SLC38A1 is formed by reverse splicing of exon 2-5 of the SLC38A1 gene, with the circularized sequence 522 nt. The sequencing of Sanger can see the cyclization sites, and the sequence information is compared with circbase, and the results are all consistent with the sequencing result of Illumina Hiseq 4000.

As shown in FIG. 2, the divergent primer and the convergent primer are designed according to the sequence of circSLC38A1 and the parent gene SLC38A1 from the circSLC38A1, and the two pairs of primers are used for amplifying cDNA and gDNA extracted from T24 cells, and the result shows that the divergent primer can amplify products in the cDNA but not corresponding products in the gDNA.

As shown in FIG. 3, after total RNA of T24 cells is extracted, RNase R digestion is carried out, and the relative expression amounts of circ-SLC38A1 and its linear transcript SLC38A1 are determined. It was confirmed that circ-SLC38A1 is not sensitive to exonuclease and has higher stability.

As shown by qRT-PCR results in fig. 4, circ-SLC38a1 was significantly up-regulated in gastric cancer tumor tissue compared to normal tissue. Represents a p value < 0.05.

As shown in FIG. 5, after transfection of si-circSLC38A1#1 and si-circSLC38A1#2, the expression level of circ-SLC38A1 in T24 and 5637 cell lines was significantly down-regulated, and the expression level of SLC38A1 mRNA, a linear transcript thereof, was not affected. Represents a p value < 0.05, represents a p value < 0.01, and represents a p value < 0.001.

As shown in FIG. 6, transfection of si-circSLC38A1#1 and si-circSLC38A1#2 significantly inhibited the migratory invasion capacity of bladder cancer cell lines T24 and 5637.

The above results indicate that circ-SLC38A1 is up-regulated in bladder cancer tissue; in vitro experiments show that the circ-SLC38A1 promotes the migration and invasion capacity of bladder cancer cells, and the circ-SLC38A1 plays a role of cancer-promoting genes in bladder cancer.

The above description is only a preferred embodiment of the present invention, and not intended to limit the present invention in other forms, and any person skilled in the art may apply the above modifications or changes to the equivalent embodiments with equivalent changes, without departing from the technical spirit of the present invention, and any simple modification, equivalent change and change made to the above embodiments according to the technical spirit of the present invention still belong to the protection scope of the technical spirit of the present invention.

SEQUENCE LISTING

<110> secondary Hospital of Shandong university

Application of <120> circ-SLC38A1 as target in drugs for inhibiting bladder cancer cells

<130> 1

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 522

<212> DNA

<213> Artificial sequence

<400> 1

atatttattg agtgtctact gtgtgccagg cactatatct atgtgcatag aaaaaccctg 60

gaaggccata caacaatata tatagagtga tcgtctctgc ttgctgagct aacaggggtg 120

tcaagcttcc attttggtat ctacttctaa atacactcag aacaggagaa atttggacta 180

attttcaaac tacagacact ttctaatcat gatgcatttc aaaagtggac tcgaattaac 240

tgagttgcaa aacatgacag tgcccgagga tgataacatt agcaatgact ccaatgattt 300

caccgaagta gaaaatggtc agataaatag caagtttatt tctgatcgtg aaagtagaag 360

aagtctcaca aacagccatt tggaaaaaaa gaagtgtgat gagtatattc caggtacaac 420

ctccttaggc atgtctgttt ttaacctaag caacgccatt atgggcagtg ggattttggg 480

actcgccttt gccctggcaa acactggaat cctacttttt ct 522

<210> 2

<211> 41

<212> DNA

<213> Artificial sequence

<400> 2

ttttgggact cgcctttgcc aatggaagct tgacacccct g 41

<210> 3

<211> 40

<212> DNA

<213> Artificial sequence

<400> 3

tggtcagcat tcccttggtc ttttctcggc gggtttcagt 40

<210> 4

<211> 43

<212> DNA

<213> Artificial sequence

<400> 4

acccactcct ccacctttga ctgttgctgt agccaaattc gtt 43

<210> 5

<211> 42

<212> DNA

<213> Artificial sequence

<400> 5

auccuacuuu uucuauauut taauauagaa aaaguaggau tt 42

<210> 6

<211> 42

<212> DNA

<213> Artificial sequence

<400> 6

aauccuacuu uuucuauaut tauauagaaa aaguaggauu tt 42

Claims (2)

1. The application of primers for amplifying circ-SLC38A1 in preparing a bladder cancer diagnostic reagent is characterized in that the primers comprise three groups with the sequences as follows:

5’-TTTTGGGACTCGCCTTTGCC-3’，5’-AATGGAAGCTTGACACCCCTG-3’；

5’-TGGTCAGCATTCCCTTGGTC-3’，5’-TTTTCTCGGCGGGTTTCAGT-3’；

5’-ACCCACTCCTCCACCTTTGAC-3’，5’-TGTTGCTGTAGCCAAATTCGTT-3’。

2. the application of two groups of specific small interfering RNA of a target circ-SLC38A1 reverse splice site in the preparation of a preparation for inhibiting the migration and invasion of bladder cancer cells is characterized in that the two groups of specific small interfering RNA sequences are respectively as follows:

Sense： 5’-AUCCUACUUUUUCUAUAUUTT-3’，

Antisense：5’-AAUAUAGAAAAAGUAGGAUTT-3’；

Sense：5’- AAUCCUACUUUUUCUAUAUTT-3’，

Antisense：5’-AUAUAGAAAAAGUAGGAUUTT-3’。

Images