CN111172289B - Marker of miRNA for diagnosing and treating liver cancer - Google Patents

Abstract

The invention discloses a miRNA marker for diagnosing and treating liver cancer, records that miR-4326 is up-regulated in liver cancer, and has higher diagnosis efficiency by verifying miR-4326in TCGA. The invention also records that the inhibitor of miR-4326 can reduce the proliferation activity of the liver cancer cells and reduce the number of transmembrane membranes of the cells, and prompts that the miR-4326 can be applied to diagnosis and treatment of liver cancer.

Description

Marker of miRNA for diagnosing and treating liver cancer

Technical Field

The invention belongs to the field of biomedicine, and relates to a miRNA marker for diagnosing and treating liver cancer.

Background

Primary liver cancer (HCC) ranks fourth in the incidence of cancer in our country, and ranks second in death of human beings due to malignant tumor. Due to the lack of clear early diagnosis markers, specific clinical symptoms, etc., liver cancer patients are usually diagnosed at an advanced stage, most patients lose surgical opportunities, and the total 5-year life cycle is short. Therefore, research on inducing factors affecting liver cancer and the invasion and metastasis processes and research and development of liver cancer treatment drugs are the focus of research at present.

MicroRNA (miRNA) is a highly conserved single-stranded endogenous non-coding RNA small molecule segment with the length of 21-25nt, the transcription of miRNA is mainly catalyzed by polymerase II in a cell nucleus, and the main steps are as follows: during the transcription initiation phase, the miRNA is converted into a starting miRNA (Primary miRNA, Pri-miRNA) by polymerase II. Under the action of RNase III, the Pri-miRNA forms one or more hairpin structures in the leader region of the self-structure, and the miRNA is called Pre-miRNA. Pre-miRNA is divided into small segments by a series of specific endogenous enzymes, such as Drosha, Dicer, Argonaute, etc.; then, binding partially or completely to the 3' -UTR region of messenger RNA (mRNA) of the target gene further results in a decrease or increase in the expression level of the target gene by degrading the mRNA or inhibiting the post-transcriptional translation stage of the mRNA (He L, Thomson J M, Hemann M T, et al. A microRNA polycistron as a potential human oncogene [ J ] Nature,2005,435(7043): 828-. mirnas do not encode proteins, and only alter the expression level of a gene by affecting transcription or translation of a target protein. During the process of regulating protein expression, miRNA can participate in various biological processes in cells, such as proliferation, differentiation and apoptosis of cells. It has been found and administered to humans that up to about 2500 proven mirnas are present, and about more than one third of the genes in humans are translated and regulated by them. With the further intensive research on miRNA, human beings have found that basic research on miRNA regulation of a target gene and further influence on liver cancer development is increasing during the whole development process of liver cancer.

In recent years, more and more upstream regulatory genes are found to have greater relevance to tumor metastasis, and play a very key role in the process of tumor cell invasion and metastasis. Moreover, researches find that miRNA plays an important role in regulating cell level in multiple aspects of hepatocyte proliferation and differentiation, cytoskeletal rearrangement, apoptosis and the like, thereby inducing organisms to generate a series of pathological and physiological changes. Therefore, the research on the miRNA marker related to the liver cancer is beneficial to disclosing the pathogenesis of the liver cancer and realizing clinical diagnosis and treatment.

Disclosure of Invention

The invention aims to provide a biomarker for diagnosing and treating liver cancer.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides application of a reagent for detecting miR-4326in preparation of a product for diagnosing liver cancer, wherein the miR-4326 is selected from at least one of the following groups: miR-4326 initial miRNA, miR-4326 precursor miRNA and mature miR-4326; the miR-4326 initial miRNA can be cut and express mature miR-4326in human cells; the miR-4326 precursor miRNA can be cut off in human cells and express mature miR-4326.

Further, the miR-4326 is mature miR-4326.

Further, the product comprises reagents for detecting the level of miR-4326 or a homolog thereof by using qRT-PCR, blot hybridization, in situ hybridization, array hybridization, gene chip, or next generation sequencing.

The invention provides a product for diagnosing liver cancer, which comprises a reagent for detecting miR-4326.

Further, the product comprises a chip, an array or a kit.

Further, the reagent comprises a primer and/or a probe aiming at miR-4326.

The invention provides application of miR-4326in preparation of a pharmaceutical composition for treating liver cancer.

Further, the pharmaceutical composition comprises an inhibitor of miR-4326 or a homolog thereof.

Further, the inhibitor is an agent for reducing the level of miR-4326. The inhibitor is an antisense oligonucleotide or antagonist of miR-4326 or a homolog thereof. Specific antisense oligonucleotides are designed according to miR-4326 sequences, and after the antisense oligonucleotides are transferred into a human body, the antisense oligonucleotides can obviously reduce the expression of miR-4326. Antisense mirnas may comprise a total of 5-100 or 10-60 nucleotides. Antisense mirnas can also include a total of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. Preferably, the sequence of the antisense miRNA may include (a) at least 5 nucleotides identical to the miRNA5 ' end and at least 5-12 nucleotides fully complementary to the flanking region of the target site at the miRNA5 ' end, or (b) at least 5-12 nucleotides fully complementary to the flanking region of the target site at the miRNA 3' end.

An antagonist of the miR-4326 gene is designed according to the miR-4326 sequence, the antagonist is single-stranded small RNA which is specially marked and chemically modified, and after the antagonist is transferred to a target site, the expression of miR-4326 can be efficiently blocked, and the expression level of miR-4326 is reduced.

The invention provides a pharmaceutical composition for treating liver cancer, which comprises an inhibitor of miR-4326 or a homolog thereof, and/or a pharmaceutically acceptable carrier. The miR-4326inhibitor can inhibit the expression of miR-4326 or can inhibit the function of miR-4326. The inhibition target of the miR-4326inhibitor is not limited to miR-4326 per se, but also includes the upstream and downstream of miR-4326, such as: a genome sequence for coding miR-4326, a miR-4326 target gene, and a protein or gene for regulating miR-4326.

Further, the medicine also comprises a pharmaceutically acceptable carrier. Such vectors include, but are not limited to: diluents, buffers, suspensions, emulsions, granules, encapsulating agents, excipients, fillers, adhesives, sprays, transdermal absorbents, wetting agents, disintegrants, absorption enhancers, surfactants, colorants, flavors, or adsorptive carriers.

The medicament can be prepared into a micro-injection, a dosage form suitable for transfection, an injection, a tablet, a powder, a granule and a capsule. The medicaments in various dosage forms can be prepared according to the conventional method in the pharmaceutical field. For solid drugs, conventional non-toxic solid pharmaceutically acceptable carriers can be used such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For example, a solid pharmaceutical for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25% -75%, of at least one miR-4326 gene product (or at least one nucleic acid comprising a sequence encoding them). Pharmaceutical compositions for aerosol (inhalation) administration may comprise from 0.01% to 20% by weight, preferably from 1% to 10% by weight, of the gene product of the miR-4326 (or at least one nucleic acid comprising sequences encoding them) encapsulated in liposomes as described above and a propellant. A carrier, such as lecithin for intranasal delivery, may also be included when desired.

The invention provides application of miR-4326in screening of candidate drugs for treating liver cancer.

Further, the method for screening a candidate drug for treating hepatocellular carcinoma is as follows:

providing a test agent to a cell and measuring the level of miR-4326, wherein an increase in the level of miR-4326in the cell, relative to a suitable control cell, is indicative of the test agent being a candidate drug for the treatment of liver cancer.

It is to be understood that miR-4326 of the present invention includes functional equivalents, i.e., variants, of constitutive nucleic acid molecules, by "variant" is meant a miRNA that has less than 100% identity to a corresponding wild-type miRNA gene product and has one or more biological activities corresponding to the wild-type miRNA gene product. Examples of such biological activities include, but are not limited to, inhibition of cellular processes (e.g., cell differentiation, cell growth, cell death) that progress with liver cancer. These variants include species variants and variants resulting from one or more mutations (e.g., substitutions, deletions, insertions) of the miRNA gene. In certain embodiments, the variant is at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the corresponding wild-type miRNA gene product. It shows the same function as the complete miR-4326 nucleic acid molecule, which can be mutated by deletion, substitution or insertion of nucleotide residues.

It is well known in the art that in order to ensure the stability of miRNA, protective bases such as TT may be added to one or both ends of miRNA, and miRNA bases may also be modified, but the function of miRNA is not affected. Therefore, the sequence obtained by base modification of miR-4326 or base addition at both ends under the condition of not influencing the function of miR-4326 is well known to those skilled in the art and is also included in the protection scope of the invention.

The miR-4326 nucleic acid molecules of the invention can exist in single-stranded or double-stranded form. Mature miR-4326 is predominantly in single-stranded form, whereas miR-4326 precursors are partially self-complementary to form a double-stranded structure. The nucleic acid molecules of the invention may be in the form of RNA, DNA, PNA, LNA.

In the present invention, a representative miR-4326 has the sequence shown in SEQ ID No.1, and suitable probes for northern blot hybridization of a given miRNA gene product can be generated based on the nucleic acid sequence shown in SEQ ID No.1, including, but not limited to, probes having at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or complete complementarity to the miRNA gene product of interest. Labeled DNA and RNA are prepared by a conventional method, for example, a nucleic acid probe is labeled with, for example, a radionuclide 3H, 32P, 33P, 14C or 35S, a heavy metal, a ligand capable of functioning as a specific binding pair member of a labeled ligand such as biotin, avidin or an antibody, etc., a fluorescent molecule, a chemiluminescent molecule, an enzyme, etc.

The probes can be labeled with high specific radioactivity by nick translation or random priming, which is a selection method for synthesizing 32P-labeled probes with high specific radioactivity from single-stranded DNA or from RNA templates. For example, by replacing an existing nucleotide with a highly radioactive nucleotide according to the nick translation method, a 32P-labeled nucleic acid probe having a specific radioactivity much exceeding 108 cpm/microgram can be prepared. Autoradiographic detection of hybridization can then be performed by exposing the hybridized filters to photographic film. Densitometric scanning of the exposed photographic film of the hybridized filters provides an accurate measurement of miRNA gene transcript levels.

In the present invention, the level of miRNA in a sample can be measured using any technique suitable for detecting the level of RNA expression in a biological sample. Suitable techniques (e.g., northern blot analysis, RT-PCR, in situ hybridization) for determining RNA expression levels in biological samples (e.g., cells, tissues) are well known to those skilled in the art.

In the present invention, an "array" or "microarray" is an ordered arrangement of hybridization array elements, such as polynucleotide probes (e.g., oligonucleotides) or binding agents (e.g., antibodies), on a substrate. The matrix may be a solid matrix, for example, a glass or silica slide, beads, a fiber optic binder, or a semi-solid matrix, for example, a nitrocellulose membrane. The nucleotide sequence may be DNA, RNA or any permutation thereof. Microarrays can be prepared from gene-specific oligonucleotide probes generated from known miRNA sequences. The array may contain 2 different oligonucleotide probes for each miRNA, one containing an active mature sequence and the other specific for the precursor of the miRNA. The array may also contain controls, such as one or more mouse sequences that differ from the human orthologs by only a few bases, which can serve as controls for hybridization stringency conditions. tRNAs from both species can also be printed on a microchip, providing an internal, relatively stable positive control for specific hybridization. One or more suitable controls for non-specific hybridization may also be included on the microchip.

A compound that inhibits miR-4326 expression can be administered to a subject by any method suitable for delivering a drug described herein to cancer cells in a subject. For example, compounds that inhibit miR-4326 expression can be administered by methods suitable for transfecting cells of a subject with these compounds or with nucleic acids comprising sequences encoding these compounds. Preferably, the cells are transfected with a plasmid or viral vector comprising the sequence of a compound that inhibits the expression of the miR-4326 gene.

Transfection methods for eukaryotic cells are well known in the art and include, for example, direct injection of nucleic acids into the nucleus or pronuclei of a cell, electroporation, liposome transfer or transfer mediated by lipophilic materials, receptor-mediated nucleic acid delivery, particle acceleration, calcium phosphate precipitation and transfection mediated by viral vectors.

The compound that inhibits expression of miR-4326 can be administered to a subject by any suitable enteral or parenteral route of administration. Suitable enteral routes of administration for use in the present methods include, for example, oral, rectal or intranasal delivery. Suitable parenteral routes of administration include, for example, intravascular administration, peripheral and intratissue injection, subcutaneous injection or deposition, direct administration to the tissue of interest, such as through a catheter or other mounting device, and inhalation. Preferred routes of administration are injection, infusion and injection directly into the tumor.

The invention has the advantages and beneficial effects that:

the expression of miR-4326in a liver cancer patient is found to be up-regulated for the first time, whether the patient suffers from liver cancer or risks of suffering from the liver cancer can be judged by detecting the level of miR-4326, meanwhile, the invention discovers that miR-4326 can influence proliferation, migration and invasion of liver cancer cells for the first time, and provides a personalized means for treating the liver cancer.

Drawings

FIG. 1 is a graph of miR-4326 expression in tissues;

FIG. 2 is a ROC plot demonstrating the diagnostic efficacy of miR-4326;

FIG. 3 is a graph of the effect of miR-4326 on the proliferative capacity of cells;

FIG. 4 is a graph of the effect of miR-4326 on cell migration and invasion, wherein Panel A is a graph of the effect of cell migration and Panel B is a graph of the effect of cell invasion.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are provided only for the purpose of illustration and are not meant to limit the scope of the present invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 QPCR detection of miR-4326 expression in hepatocellular carcinoma

First, experimental material

1. Experimental reagents and instruments

Synthesizing miRNA first chain cDNA, performing production, with a product number of B532451-0020,

miRNA fluorescent quantitative PCR kit, birth control, cat number B532461-0002,

NanoVue Plus, BIOCHROM LTD, model 28956057,

fluorescent quantitative PCR instrument, Applied Biosystems, model ABI7300

2. Experimental sample

32 cancer tissues of patients with primary liver cancer and corresponding para-cancer tissue samples of more than 3cm are collected, all samples are put into a freezing storage tube after surgical excision and separation for 30min, and are quickly put into a liquid nitrogen tank and transferred to a laboratory at the ultralow temperature of-80 ℃.

Exclusion criteria: the patient has a history of malignant tumor of other organs after the preoperative anti-tumor treatment.

Second, Experimental methods

1. Primer design

A primer for synthesizing miR-4326 is designed in Bomaide company, and a U6 internal reference primer is purchased from Tiangen company, wherein the specific primer sequence is as follows: TGTTCCTCTGTCTCCCAGAC (SEQ ID NO.2)

2. Extraction of RNA

Tissue total RNA was extracted using the TRIzol method.

1) Adding 1mL of TRIzol into a glass homogenizing bottle in an ultraclean bench, pressing the homogenizing bottle onto an instrument, weighing 50-100mg of tissues into the glass homogenizing bottle, adjusting the rotation speed to about 1500 revolutions, starting homogenizing in an ice-water bath, grinding for 30s, stopping 30s, and repeating for 3-4 times. The sample volume should not exceed 10% of the TRIzol volume.

2) The sample added with TRIzol was left at room temperature for 10min to completely separate the nucleic acid-protein complex.

3) Adding 200 μ L chloroform into 1mL TRIzol, shaking vigorously for 2min, shaking for two times every 1min, and standing for 7min after 5-6 times.

4) Centrifuge at 12000rpm for 15min at 4 ℃. The sample was divided into three layers: the bottom layer is a yellow organic phase, and the upper layer is a colorless aqueous phase and an intermediate layer. The RNA is predominantly in the aqueous phase, which is about 60% of the volume of TRIzol used.

5) The upper aqueous phase was transferred to a new EP tube (about 400. mu.L, with as little intermediate layer as possible to avoid contamination). Add 500. mu.L of isopropanol and let stand at room temperature for 10 min.

6) Centrifugation was carried out at 12000rpm for 15min at 4 ℃ and a white precipitate appeared at the bottom of the tube after centrifugation. The supernatant was carefully removed with a pipette.

7) 1mL of 75% cold ethanol was added and the precipitate was washed with shaking. Centrifuge at 7500rpm for 5min at 4 ℃ and carefully discard the supernatant.

9) The EP tube is reversely buckled on the filter paper to absorb excessive water, a 10-microliter gun head is used for carefully absorbing liquid in the tube (the gun head does not contact RNA), the EP tube is placed for 5min at room temperature, and the RNA becomes transparent;

10) add 40. mu.L RNase-free water (DEPC water) and measure OD and concentration with naodrop, and mark on the tube.

2. Reverse transcription synthesis of miRNA cDNA

miRNA cDNA reverse transcription is carried out by adopting miRNA first strand cDNA synthesis (cargo number: B532451-0020), ToTal RNA 2 mu g, 2 xmiRNA RT Solution Mix 10 mu L, miRNA RT Enzyme Mix 2 mu L and RNase-Free water are respectively added into a test tube and supplemented to 20 mu L, the prepared reaction Solution is gently mixed by a pipettor, and the mixture is heated in a water bath kettle at 37 ℃ for 60min and at 85 ℃ for 5 min. After a short centrifugation, the mixture was stored in a refrigerator at-20 ℃.

3. Fluorescent quantitative detection

After diluting each sample micDNA 50 times, taking 1 mul as a template, and respectively amplifying by using a target gene primer and an internal reference gene primer. At the same time, the dissolution curve analysis is carried out at 60-95 ℃.

1) The PCR reaction system was configured as shown in Table 1

TABLE 1 reaction System

Composition of matter	20 μ l system
		2×miRNA qPCR masTer mix	10μl
Forward Primer (self-contained)	0.5μl
		Reverse Primer(10μM)	0.5μl
miRNA first strand cDNA	1μl
		ROX Reference Dye(H)	1μl
ddH2O	To 20. mu.l

2) PCR reaction program was set up as in Table 2

TABLE 2 reaction conditions

3) Relative quantification

According to RealTimePCR original detection result, according to 2^-△△ctRelative quantitative calculation formula, i.e.

And calculating the relative quantitative result of the target gene of each sample, namely the difference of the target gene miRNA transcription level of other samples relative to the control sample.

Three, result in

The QPCR result is shown in figure 1, compared with the tissue beside the cancer, the expression of miR-4326in the liver cancer tissue is obviously up-regulated, and the difference has statistical significance (P is less than 0.05).

Specifically, there were 29 samples exhibiting significant upregulation of miR-4326, 27 samples exhibiting significant upregulation in cancer tissues, and 2 samples exhibiting significant upregulation in paracancerous tissues.

Example 2 validation of diagnostic efficacy of biomarkers

1. Data collection

Collecting miRNA expression profile data of 342 liver cancer tissues and 50 paracarcinoma tissues from a TCGA database, and analyzing the expression level of miR-4326in the liver cancer tissues and the paracarcinoma tissues.

2. ROC curve analysis

And (3) analyzing the working characteristics of the testee of the miR-4326 by using a pROC package in the R language, calculating a two-term accurate confidence space, and drawing an ROC curve.

3. Results

The ROC analysis result of the miR-4326 is shown in figure 2, the AUC value of the miR-4326 as the test result variable is 0.743, the area under the curve is higher, the miR-4326 has higher sensitivity and specificity when being used for diagnosing liver cancer, and the miR-4326 has better diagnosis efficiency when being applied to diagnosis of the liver cancer.

Example 3 detection of expression levels of miRNA in liver cancer cells

1. Cell culture

Culturing human normal liver cell line L-02, low invasion metastatic ability liver cancer cell line HepG2, and high invasion metastatic ability liver cancer cell line Huh7, culturing cells in 1640 cell culture medium containing 10% FBS, 100units/ml penicillin and 100ug/ml streptomycin at 37 deg.C and 5% CO₂And culturing under saturated humidity. Cells were changed every 2 days and passaged 1: 3.

2. Extraction of cellular RNA

Total cellular RNA was extracted using the TRIzol method.

Collecting cells in logarithmic phase, adding 1ml of TRIzol, and mixing uniformly; the cells were disrupted and the DNA sheared by repeated aspiration using a 1ml syringe and allowed to stand at room temperature for 5min, the rest being the same as in example 1.

3. Reverse transcription and fluorescent quantitative detection

The experimental procedure was as in example 1.

4. Statistical treatment

All data are expressed as mean ± standard deviation (mean ± SD). Comparisons between two groups were performed using a two-sided Student's t test, and three and more groups were analyzed using one-way anova. All results were plotted using GraphPad Software, with P <0.05 as the test level, and differences of P <0.05 were statistically significant.

5. Results

The results show that miR-4326 has significantly increased expression in hepatoma cell strains HepG2(4.327 +/-0.8001) and Huh7(6.42 +/-0.8173) compared with normal hepatocyte L-02(1 +/-0.06), and has the highest expression level in Huh7 cells, so Huh7 cells are selected for subsequent experiments.

Example 4 Effect of miR-4326 on hepatoma cells

1. Cell transfection

The inhibitor NC (negative control) and miR-4326inhibitor used in the experiments were both synthesized by Shanghai Jima.

Huh7 cells were cultured and digested with trypsin for passage when the cell growth was approximately 80-90% under the microscope. According to the transfection reagent Lipofectamine^TM3000 Instructions for transfection of Huh7 cells. The method comprises the following specific steps:

1) 24h before transfection, 6-well plates containing medium were inoculated with 3.0X 10⁵Individual cells, the cell fusion degree reaches 50% when the cells are transfected;

2) preparing a transfection substance, namely adding 125 mul of serum-free and antibiotic-free RMPI1640 culture medium into 9 mul of miR-4326inhibitor and NC, and adding 5 mul of Lipofectamine into each hole^TM3000 reagent, fully beating and uniformly mixing, and then standing for 5 min;

3) the culture medium in the 6-well plate was aspirated by a pipette, and then 800. mu.l of a culture medium containing 10% fetal bovine serum and a transfection product prepared in advance were added to each well;

4) and (5) slightly shaking the culture plate to fully mix the reagents, placing the mixture in an incubator to continue culturing, and replacing fresh culture solution after 6 h.

2. CCK8 experiment

1) The experiment is divided into 3 groups, namely a negative control group (inhibitor NC group), an experimental group (miR-4326inhibitor group) and a blank control group, wherein each group is provided with 5 multiple holes;

2) transfected Huh7 cells were cultured for 72h, cell counts were performed by digestion with 0.25% trypsin, and cells were plated in 96-well plates at a concentration of 1X 10⁴Per ml, 100 mul is added in each hole;

3) adding 10 μ l of CCK8 reagent into each well of 96-well plate under dark condition, shaking the culture plate for 3min, placing the culture plate into an incubator for continuous culture, taking out after 2h, and measuring OD value at 450nm wavelength of an enzyme labeling instrument.

3. Transwell migration and invasion experiments

1) Transwell cell preparation

Melting the Matrigel in an ice bath under aseptic conditions, diluting the Matrigel glue according to the proportion of 1:8, slowly adding the Matrigel glue to the bottom of an upper chamber of a Transwell, spreading the Matrigel glue, and quickly transferring the Matrigel glue to a cell culture box at 37 ℃ for incubation until the Matrigel glue is solidified into a gel;

2) the experiment was divided into 3 groups, negative control group (inhibitor NC group), experimental group (miR-4326inhibitor group) and blank group of untransfected RNA, each group was provided with 3 multiple wells, and 2X 10 of RNA was added into the upper chamber⁴Adding 600 μ l of culture medium containing 10% fetal calf serum into the lower chamber of the suspension of each cell, and culturing at 37 deg.C for 48 hr in a constant temperature incubator;

3) dyeing process

The Transwell was taken out and washed 3 times with PBS, fixed with paraformaldehyde for 30min and washed 3 times with PBS, stained with crystal violet for 30min, stopped with purified water, observed under a fluorescent microscope and counted.

4. Statistical analysis

All data are expressed as mean ± standard deviation (mean ± SD). Comparisons between two groups were performed using a two-sided Student's t test, and three and more groups were analyzed using one-way anova. All results were plotted using GraphPad Software, with P <0.05 as the test level, and differences of P <0.05 were statistically significant.

5. Results

Cell transfection results show that compared with a negative control group (0.94 +/-0.03) and a blank control group (1 +/-0.07), the expression level (0.223 +/-0.061) of miR-4326inhibitor transfected experimental group is remarkably reduced, and the negative control group and the blank control group have no remarkable difference.

The CCK8 detection result is shown in figure 3, compared with a negative control group (1.296 +/-0.0627) and a blank control group (1.4 +/-0.099), the cell proliferation of an experimental group (0.784 +/-0.105) transfected with miR-4326inhibitor is obviously inhibited (P is less than 0.05), and the miR-4326 has an obvious inhibiting effect on the cell proliferation capacity of Huh 7.

The results of Transwell chamber detection are shown in FIG. 4, and compared with the cell-penetrating number of the blank control group (migration: 156.7 + -6.028; invasion: 125.3 + -7.767) and the negative control group (migration: 142.3 + -13.32; invasion: 119 + -11.14), the cell-penetrating number of the experimental group (migration: 65.33 + -12.90; invasion: 59.33 + -9.609) is significantly reduced, which indicates that the cell migration and invasion capabilities of the experimental group are significantly reduced, and suggests that the miR-4326inhibitor has significant inhibition effect on the migration and invasion of Huh7 cells.

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> Hospital of Hebei medical university

<120> marker for miRNA for diagnosing and treating liver cancer

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> RNA

<213> Homo sapiens

<400> 1

uguuccucug ucucccagac 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgttcctctg tctcccagac 20

Claims (6)

1. Application of a reagent for detecting miR-4326in preparation of a product for diagnosing liver cancer, wherein the miR-4326 is selected from at least one of the following groups: miR-4326 initial miRNA, miR-4326 precursor miRNA and mature miR-4326; the miR-4326 initial miRNA can be cut and express mature miR-4326in human cells; the miR-4326 precursor miRNA can be cut off in human cells and express mature miR-4326.

2. The use of claim 1, wherein said miR-4326 is mature miR-4326.

3. The use according to claim 1 or 2, wherein the product comprises reagents for detecting the level of miR-4326 by using qRT-PCR, blot hybridization, in situ hybridization, array hybridization, gene chip or next generation sequencing.

4. The use of claim 1, wherein the product comprises a chip, an array or a kit.

5. The use according to claim 4, wherein the agent comprises primers and/or probes for miR-4326.

Application of the miR-4326inhibitor in preparation of a pharmaceutical composition for treating liver cancer.

Images