CN114432452A

CN114432452A - Application of RNA Hsa _ circ _0063865 inhibitor in preparation of anti-esophageal squamous cell carcinoma drug

Info

Publication number: CN114432452A
Application number: CN202210168374.9A
Authority: CN
Inventors: 刘冉; 高志奎; 孙明军
Original assignee: Southeast University
Current assignee: Southeast University
Priority date: 2022-02-23
Filing date: 2022-02-23
Publication date: 2022-05-06
Anticipated expiration: 2042-02-23
Also published as: CN114432452B

Abstract

The invention discloses an application of an RNAHSsa _ circ _0063865 inhibitor in preparation of an anti-esophageal squamous cell carcinoma medicament, which is characterized in that the expression level of a cyclic RNA in esophageal squamous cell carcinoma tissues is remarkably higher than that of paracancerous tissues, the expression level of the cyclic RNA in esophageal squamous cell carcinoma cells is changed by constructing molecular biology means such as Hsa _ circ _0063865 specific siRNAs, and the like, so that the interference of the expression of Hsa _ circ _0063865 can remarkably inhibit the proliferation and invasion migration of esophageal squamous cell carcinoma cells and promote tumor cell biological phenotypes such as cancer cell apoptosis, and therefore, the Hsa _ circ _0063865 specific siRNAs constructed by the invention can be applied to preparation, screening or treatment of esophageal squamous cell carcinoma or medicaments for inhibiting esophageal squamous cell carcinoma metastasis, and a novel treatment method is provided for the intervention or treatment of esophageal squamous cell carcinoma.

Description

Application of RNA Hsa _ circ _0063865 inhibitor in preparation of anti-esophageal squamous cell carcinoma drug

Technical Field

The invention relates to an application of an RNA Hsa _ circ _0063865 inhibitor in preparation of an anti-esophageal squamous cell carcinoma drug, belonging to the technical field of biological medicines.

Background

Esophageal cancer is a tumor of the digestive tract characterized by high morbidity, mortality, and recurrence. According to the global cancer statistical data in 2020, the incidence rate of esophageal cancer is the seventh global and the mortality rate is the sixth global, and the esophageal cancer is one of high-incidence malignant tumors threatening human health worldwide. The pathological types of the esophageal cancer mainly comprise squamous cell carcinoma and adenocarcinoma, and in the high-incidence areas of the esophageal cancer such as south Africa, east Africa and east Asia, 90 percent of the pathological types are esophageal squamous cell carcinoma. China is the world with the highest incidence and mortality of esophageal cancer, and due to the factors of large population base, rapid progress of disease course and the like, new cases and death cases of esophageal cancer occupy about 53.7% and 55.7% of the world each year in China, and serious disease burden is brought to China. With the rapid development of medical technology, certain improvements are made in the treatment of esophageal cancer, such as chest opening operation, minimally invasive esophageal cancer operation, immunosuppression treatment and the like, but the 5-year survival rate of patients is still lower than 15%. Currently, there is still no effective control means for postoperative high recurrence and high metastasis of esophageal squamous cell carcinoma. Therefore, the molecular mechanism of the esophageal squamous cell carcinogenesis and development is clarified, a new target for regulating esophageal squamous cell carcinogenesis, invasion and metastasis and apoptosis is found, and the research and development of a targeted anti-tumor drug are carried out, so that the targeted intervention strategy is formulated on the basis, a new choice is expected to be brought to the esophageal squamous cell carcinoma treatment, and the method has important significance for the research and development of related drugs and reagents.

Circular RNA (circular RNA) is a nonlinear non-coding RNA with a covalent closed structure, has no 5 'end cap or 3' end polyA tail structure, has stability superior to other linear RNA molecules, and is not easily degraded by RNA exonuclease and RNase, so that the circular RNA has high conservation, stability and tissue specificity. In recent years, the relation between circ RNA and cancer has become a major problem in the field of cancer research, and hundreds of circ RNAs have been shown to be abnormally expressed in various human cancers including esophageal squamous cell carcinoma, mainly play roles in miRNA molecular sponges, regulation of host gene expression, regulation of alternative splicing and the like, and further participate in regulation of tumor cell proliferation, epithelial mesenchymal transformation, tumor cell invasion and metastasis. With the advent of the "mRNA era," circular RNA therapy "has come into the line of sight of researchers in the treatment of cancer, autoimmune diseases, regenerative medicine, genetic diseases, etc., such as the engineering of circular RNA (oana) with the potential to efficiently encode proteins, which can efficiently and stably express proteins in eukaryotic cells, meaning that oana can be used to achieve the desired therapeutic effect in patients at smaller doses, and may be more suitable for diseases that require high levels of protein and beyond linear mRNA expression. However, at present, research on the expression and regulation of circRNA in the esophageal cell cancerization process is unclear, and no clear molecular target of the circRNA of esophageal squamous cell carcinoma exists, so that further systematic mining of the circRNA playing a role in esophageal squamous cell carcinoma is provided, and the research on the molecular target of novel esophageal squamous cell carcinoma therapeutic molecule is of great significance for further understanding the occurrence and development mechanism of esophageal squamous cell carcinoma, promoting 'circular RNA therapy' to enter IND (acquired New drug) stage and bringing novel therapeutic drugs for tumor patients all over the world.

Disclosure of Invention

The invention aims to provide application of an RNA Hsa _ circ _0063865 inhibitor in preparation of an anti-esophageal squamous cell carcinoma medicament, and mainly solves the problems of single treatment, poor treatment effect and the like of esophageal squamous cell carcinoma medicaments.

The first aspect of the invention provides application of a gene drug and/or chemical inhibitor combination for inhibiting expression of the ring Hsa _ circ _0063865 in preparation of an anti-tumor drug.

Further, the inhibitor includes siRNA; the nucleotide sequence of the siRNA consists of SEQ ID NO.4 and SEQ ID NO. 5.

Further, the inhibitor was packaged into DH5 α to construct a lentiviral vector.

Preferably, the siRNA is applied to preparing and screening drugs for inhibiting the proliferation of esophageal squamous cell carcinoma cells;

preferably, the siRNA is applied to the preparation and screening of drugs for inhibiting the invasion and migration of esophageal squamous cell carcinoma cells;

preferably, the siRNA is applied to preparation and screening of drugs for promoting esophageal squamous cell carcinoma cell apoptosis.

Advantages and advantageous effects of the invention

The research discovers differential expression of Hsa _ circ _0063865 in esophageal squamous cell carcinoma and cancer tissues for the first time, the function of Hsa _ circ _0063865 in esophageal squamous cell carcinoma cells is verified by preparing siRNA with specificity, the knocking-down Hsa _ circ _0063865 can obviously inhibit the proliferation, invasion and migration of esophageal squamous cell carcinoma and promote cancer cell apoptosis, the siRNA with specificity of Hsa _ circ _0063865 is a very important biomolecule for treating the esophageal squamous cell carcinoma, a new effective treatment method is provided for treating tumor patients, the treatment cost of the patients is reduced, the survival rate of the patients is improved, and the drug development prospect is good.

The various aspects and advantages of the disclosure will become more readily apparent and may be understood in more detail with reference to the following detailed description and the accompanying drawings, which are not to be taken in a limiting sense. Equivalents of the art made in accordance with the present disclosure are intended to be covered by the present invention.

Drawings

FIG. 1 is a schematic diagram of the biosynthesis and structure of Hsa _ circ _ 0063865;

FIG. 2 is a graph showing the differential expression levels of Hsa _ circ _0063865 in esophageal squamous cell carcinoma tissue and paracancerous tissue;

FIG. 3 is a graph of the expression level of Hsa _ circ _0063865 in Het-1A of Hsa _ circ _0063865 knockdown;

FIG. 4 is a diagram showing the results of 35-generation plate cloning experiments, soft agar cloning experiments and nude mouse subcutaneous transplantation tumor dissection of Hsa _ circ _0063865 low-expression Het-1A cells infected with microcystin and nitrosamine;

FIG. 5 is a graph showing the results of inhibition of siRNAs interfering with Hsa _ circ _0063865 in regulating cell proliferation, invasion, migration and apoptosis;

FIG. 6 is a graph showing the results of the inhibition of siRNAs on the proliferation and metastasis of Hsa _ circ _0063865 transplanted tumor cells under the skin of nude mice.

Detailed Description

The present invention is further described in detail with reference to the following examples, which should be construed as merely illustrative, and not a limitation of the present invention, but rather as any modification or replacement of the teachings of the present invention.

Example 1: the expression level of Hsa _ circ _0063865 in esophageal squamous cell carcinoma tissues is obviously higher than that in paracarcinoma tissues detected by RT-QPCR;

1. RNA extraction of esophageal squamous cell carcinoma tissue sample

1) After approval of medical ethics committee of southeast university and informed consent of patients/family members, 96 patients diagnosed as esophageal squamous cell carcinoma in first people hospital of Huai' an city, Jiangsu province in 2009 were selected, and 96 cancer tissues and corresponding tissues beside cancer were collected;

2) taking 0.1cm³Shearing the tissue with scissors, placing into 1.5mL EP tube, adding 1mL Trizol, 3 grinding steel balls, grinding at 70Hz for 10min (pre-cooling with grinding box), and performing conventional extraction according to Trizol reagent;

3) taking 1 mu L of RNA sample, and detecting the concentration and the purity of the RNA sample in an ultraviolet spectrophotometer, wherein the ratio of A260/A280 of the obtained RNA sample is between 1.8 and 2.0.

2. Reverse transcription of RNA into cDNA

Reverse transcription is carried out by using MMLV reverse transcriptase, and the reverse transcription reaction system and conditions are as follows:

RNA	1μg
		Random primer	1μL
enzyme-free water	To 15 μ L

The reaction was carried out at 70 ℃ for 10min in an ice bath for 2 min.

The above reaction mixture	15μL
			5×First strand Buffer	5μL
10mM dNTP	1.25μL
		Ribonuclease inhibitor	1μL
MMLV	1μL
		Water supplement	To 25 μ L

Reaction conditions are as follows: reacting at 37 deg.C for 60min, at 90 deg.C for 10min, and maintaining at 4 deg.C.

3、RT-QPCR：

Specific primers were designed based on the structure of Hsa _ circ _0063865 and the linker sequence (see FIG. 1 for results):

the nucleotide sequence of Hsa _ circ _0063865-F is CCTCAGATGTAAAGTGTTATGACCAGC (SEQ ID NO. 2); the nucleotide sequence of Hsa _ circ _0063865-R is AATGCATAGAAGGGCAAATCCATGATC (SEQ ID NO. 3);

reaction system and conditions:

cDNA	1μL
		SYBR Green Mix	5μL
Plus Solution	1μL
		upstream and downstream primers	0.6. mu.L each
Water supplement	To 10 μ L

Reaction conditions are as follows: preheating at 94 ℃ for 5min, at 94 ℃ for 30s, at 60 ℃ for 30s, reacting for 40 cycles, collecting fluorescence at 60 ℃ in each cycle, heating at 60-95 ℃, collecting fluorescence, and calculating a melting curve.

4. Data processing and analysis

The expression level of Hsa _ circ _0063865 in the sample to be detected is calculated by the Ct value and the internal reference beta-actin Ct value method to obtain the delta Ct, and the larger the delta Ct value is, the lower the actual expression quantity is. The statistical analysis method adopts t test for analysis, and P <0.05 is used as difference to have statistical significance.

5. Results and analysis of the experiments

The expression level of Hsa _ circ _0063865 in the cancer tissue of the patients with the esophageal squamous cell carcinoma in the cohort is obviously higher than that of the paracarcinoma tissue, and the difference has statistical significance (the result is shown in figure 2), thereby indicating that Hsa _ circ _0063865 can be an important molecular target for treating esophageal squamous cell carcinoma.

Example 2Hsa _ circ _0063865 is involved in nitrosamine in combination with algal toxin malignant transformation of esophageal carcinoma

1. Two Hsa _ circ _0063865siRNA sequences constructed by constructing an Hsa _ circ _0063865 low expression cell model are siRNA 1: AGCGGCUCAGGCAGCUGAGG (SEQ ID NO.4) and siRNA 2: CCUCAGCUGCCUGAGCCGCU (SEQ ID NO.5), and the NC-selected sequence is NC 1: UUCUCCGAACGUGUCACGU (SEQ ID NO.6) and NC 2: ACGUGACACGUUCGGAGAA (SEQ ID NO. 7). The Hsa _ circ _0063865siRNA sequence was used for interfering lentivirus construction. The interference plasmid is pHBLV-U6-Puro-RFP, U6 promoter universal primer GGACTATCATATGCTTACCG. The subsequent steps were performed according to conventional lentivirus transfection procedures. And extracting RNA of the stably transfected cell strain, and detecting the interference efficiency of Hsa _ circ _0063865 by using RT-QPCR.

2. Hsa _ circ _0063865 is involved in malignant transformation of esophageal cancer caused by nitrosamine and algal toxin

1) Malignant transformation of cells: expressed as Hsa _ circ _0063865 low (Hsa _ circ _ 0063865)^Low) And Hsa _ circ _ 0063865-Low expression control (Si-NC) Het-1A cells were infected at 100nmol/L MC-LR +100nmol/LNMBzA in medium for 35 passages, and the role played by Hsa _ circ _0063865 in malignant transformation was observed and analyzed. The experiment is divided into an infected group and a control group, and the control group is added with DMSO solution with the same dose in a culture medium.

2) Plate cloning experiment: taking logarithmic growth-promoting cells, digesting and centrifuging with 0.25% pancreatin to prepare single cell suspension, and performing centrifugation at 2 × 10²And (3) planting the cells into a six-well plate at a certain density, normally culturing, observing the growth condition of cell clones every other day, taking out the cells after culturing for 2 weeks, staining by using crystal violet, photographing and counting clones of more than 50 cells, and calculating the clone formation rate.

3) Soft agar cloning experiments: preparing 100mL of 1.2% and 0.7% agar, DMEM medium containing 20% serum and 2 × antibiotics; according to the following steps: 1, mixing 1.2 percent of agar and prepared 2 Xculture medium, quickly adding 1.5mL of mixed solution into a six-hole plate, and standing at room temperature until the mixed solution is gelled and solid for use; taking logarithmic phase growth cells, digesting with 0.25% pancreatin, and adjusting the concentration to 8X 10 with 2X culture medium²Mixing cell suspension with 0.7% agar solution, quickly dripping into the prepared lower layer gel, adding 1mL into each hole, solidifying the upper layer gel, and adding cells into the gel containing 5% CO₂Culturing in an incubator at 37 ℃ for 3 weeks; supplementing 200 mu L of culture medium containing 10% FBS every three days; the growth of the clones was observed every other day, the colony formation was counted under a microscope after the culture was completed, and the clone formation rate was calculated by counting clones of > 50 cells.

4) Nude mice subcutaneous tumor formation experiment: selecting the materials with the age of 3-4 weeks, SPF grade, BALB/c Nude CRLJ male Nude mice. Exponential growth term Hsa _ circ _0063865^LowSi-NC group Het-1A-T plate, the cell density is 4 multiplied by 10⁷Adding equal volume of Matrigel gel into the single cell suspension; injecting 200 mu L of cell suspension into the left axilla of each nude mouse subcutaneously; observing the growth condition of subcutaneous tumor after inoculation every day, measuring every 3 days after the tumor appears, stopping feeding after the tumor body is generated for two weeks, killing by adopting a cervical dislocation method, taking out subcutaneous transplanted tumor, measuring the size of the tumor and taking a picture for recording.

5) The results show that: hsa _ circ _0063865 stably transformed low-expression cells, the expression of Hsa _ circ _0063865 was significantly reduced, the expression was 0.36 times that of control cells (FIG. 3), the clone number of Hsa _ circ _0063865 low-expression cells was significantly lower than that of control cells (FIG. 4A) at 35 th generation of contamination, the clone number of Hsa _ circ _0063865 low-expression cells was significantly lower than that of control cells (FIG. 4B), and the volume comparison of dissected transplants showed that the volume of the Hsa _ circ _0063865 low-expression cell transplants was significantly lower than that of control cells (FIG. 4C). It is suggested that Hsa _ circ _0063865 plays a crucial role as a protooncogene in the development of esophageal cancer.

Example 3 construction of Hsa _ circ _0063865 specific siRNA to verify its effect on biotypes

1) Constructing an Hsa _ circ _0063865 low-expression stable cell model: hsa _ circ _0063865siRNA and interference control lentivirus are used for transfecting Het-1A-T, and purine screening is used for obtaining Hsa _ circ _0063865^LowSi-NC cell line.

2) And (3) detecting the cell proliferation capacity: at 1 × 10⁴Cells were seeded in 96-well plates, EdU incubation for 2h when cells grew to 50% confluence, followed by BeyoClick^TMEdU cell proliferation assay kit instructions; finally, washing twice with PBS for 5min each time; discarding the washing PBS, adding 50 mu L of new PBS into each hole, and observing and photographing under a microscope; the number of green cells (proliferating cells) and blue cells (total cells) was counted by randomly selecting 5 fields per well.

3) And (3) detecting the invasion capacity of the cells: taking logarithmic growth-period cells for plating, dissolving Matrigel at-20 ℃ in a refrigerator at 4 ℃ when the cell fusion degree is 70 percent, and dissolvingPlacing the Transwell chamber into a refrigerator at 4 ℃ for precooling; diluting matrigel with serum-free medium according to the ratio of 1:9, and quickly adding the diluted matrigel into the chambers, wherein 50 mu L of matrigel is added into each chamber; placing the small chamber into an incubator at 37 ℃ and heating for 1h to solidify the matrigel, taking out the small chamber, and absorbing the upper layer of non-solidified liquid; digesting and collecting cells, preparing single cell suspension by using serum-free medium according to 5 × 10⁵Well, add cells into the chamber and add 600 μ L of complete medium containing 50% FBS to the lower chamber; after 24h of culture, taking out the small chamber, wiping off cells and matrigel which are not penetrated by the membrane by using a cotton swab, fixing by using methanol, air-drying, and dyeing by using 0.1% crystal violet; observing under a microscope, randomly selecting 5 visual fields for each chamber to take pictures, and counting the number of transmembrane cells.

4) Cell migration ability test: cell migration ability was measured using Transwell chambers with 8 μm pore size, exponential-growth cells were taken and single cell suspensions were prepared by trypsinization, each chamber was inoculated with 5X 10⁴Cells, 200. mu.L serum-free medium was added to the upper chamber of the chamber and 600. mu.L complete medium containing 20% FBS was added to the lower chamber. And (3) taking out the small chamber after the conventional culture is carried out for 24h, sucking the residual liquid of the small chamber by using a gun head, rotationally wiping off cells which do not pass through the inner side of the small chamber by using a cotton swab, soaking for 10min by using methanol, taking out the small chamber, dying by using 0.1% crystal violet dye solution after the membrane is air-dried, dying for 15min at normal temperature, rinsing by using PBS, naturally air-drying, and then putting back to a 24-pore plate. Observing under a microscope, randomly selecting 5 visual fields for each chamber to take pictures, and counting the number of transmembrane cells.

5) And (3) detecting the apoptosis capacity: using six-hole plate one day before experiment, using EDTA-free 0.25% pancreatin digested cell to prepare single cell suspension, counting and adjusting cell concentration, taking 2 × 10 per well⁵Centrifuging cells at 800rpm at room temperature for 5min, removing cell supernatant, resuspending cell precipitate with 500 μ L Binding Buffer, adding 5 μ L Annexin V-APC and 7-AAD dyes into each well of cells respectively, staining, keeping out of the sun, reacting at room temperature for 10min, detecting on a computer, collecting 2 × 10 samples at medium cell flow rate, collecting each sample, and collecting the samples⁴The fluorescence signal of each cell is detected within 1h after staining the cells.

6) Functional analysis of Hsa _ circ _0063865 in nude mouse transplantable tumors: the subcutaneous tumor transplantation section of the nude mice obtained in the step 4 of the example 2 adopts the conventional immunohistochemical operation steps, and the antibody is an antibody of the subcutaneous tumor transplantation proliferation related gene PCNA of the nude mice and an antibody of the subcutaneous tumor transplantation migration related gene E-cadherin of the nude mice.

7) The results show that: low expression of Hsa _ circ _0063865 in Het-1A-T inhibited cell proliferation (FIG. 5A), migratory capacity (FIG. 5B) and cell invasion (FIG. 5C), promoting apoptosis (FIG. 5D). The PCNA expression in the subcutaneous transplanted tumor is detected by using immunohistochemistry, and the result shows that the PCNA expression in Hsa _ circ _0063865 low-expression cells is remarkably lower than that in a control (figure 6A), and the E-cadherin expression in the cells is remarkably higher than that in the control (figure 6B), which indicates that Hsa _ circ _0063865 has an important position in the esophageal cancer progression process, and the Hsa _ circ _0063865 inhibitor can remarkably inhibit the tumor progression and can be used as a new molecular target in drug development and esophageal cancer treatment.

In the description herein, references to the description of "one embodiment," "an example," "a specific example" or the like are intended to mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed.

Sequence listing

<120> molecular target for preparing medicine for diagnosing and treating esophageal squamous cell carcinoma and application thereof

<141> 2022-01-19

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1006

<212> DNA/RNA

<213> Homo sapiens

<400> 1

gcagctgagg ggaggaaccc taagggctca ttgagatcat ggatttgccc ttctatgcat 60

tgatggagca cctgctgccc acagcgtctg tatttggtgc tgggatgctg aggtatggcc 120

atgaatactc tctggcaagg agagaggcat gggacccccc agaaaggtgc ccagtacatg 180

ggcaagccct ttgcaaactc ctggaacatg cacatctgat ggatgatgtt cattccgagt 240

tcaggcaaac attccttgtt ctgctttcca ctttcatttg agcccctctg agtactgact 300

tttgtagtta cagcatcttc ctatgtgtgc tctttctctc tctccaagcc tccttcttta 360

tgaattttta aaaggacact gagatcttca aacagaggct gccactctaa gcaaacagat 420

cccgagccct ggactctgaa gcttgggccc agttctcctt ttctccgggt ttcagatccc 480

actgtgaagt gaggggtaag taccaggtgg tcctcatggt atctgcctgt ctgattctgc 540

ccttgatgga catcagccct cagtcacaga accagtttcc aaagagccat ctgtgtctgc 600

agggcccttc tgattcagga cccggggaag ccaggggcat gagcatcggt gcctcttctc 660

tatttcaagg acccttctgg gtgtaaagtt ctctgagatg ccttacatgg attcccacca 720

ctgcaagata accatcgtgt aagtattctg attgtttttc ttcctctctg ataaggtttt 780

aaaagtaata aaggaagatg ccccaaggaa acaagataac gggattaaag tgagaaaagg 840

agagaacagc caggcaatgt ttctgagatg ctctcgatga cctgcaggca aatccttcct 900

tttaattgtc actaaaggga ttatacaatt tcctcctcag atgtaaagtg ttatgaccag 960

cagagcgtaa ttgaagtgca ttccagaggg aaagacagcg gctcag 1006

<210> 2

<211> 27

<212> DNA/RNA

<213> Artificial Synthesis ()

<400> 2

cctcagatgt aaagtgttat gaccagc 27

<210> 3

<211> 27

<212> DNA/RNA

<213> Artificial Synthesis ()

<400> 3

aatgcataga agggcaaatc catgatc 27

<210> 4

<211> 20

<212> DNA/RNA

<213> Artificial Synthesis ()

<400> 4

agcggcucag gcagcugagg 20

<210> 5

<211> 20

<212> DNA/RNA

<213> Artificial Synthesis ()

<400> 5

ccucagcugc cugagccgcu 20

<210> 6

<211> 19

<212> DNA/RNA

<213> Artificial Synthesis ()

<400> 6

uucuccgaac gugucacgu 19

<210> 7

<211> 19

<212> DNA/RNA

<213> Artificial Synthesis ()

<400> 7

acgugacacg uucggagaa 19

Claims

1. The application of the combination of the gene drug and/or the chemical inhibitor for inhibiting the expression of the ring Hsa _ circ _0063865 in preparing the antitumor drug.

2. A drug for screening or treating esophageal squamous cell carcinoma, which takes circular RNA Hsa _ circ _0063865 as a molecular target, and is characterized in that the drug comprises a gene drug and/or a chemical drug for inhibiting the expression of Hsa _ circ _ 0063865.

3. The gene agent of claim 1 or 2, wherein the inhibitor comprises siRNA; the nucleotide sequence of the siRNA consists of SEQ ID NO.4 and SEQ ID NO. 5.

4. The use of the inhibitor according to claim 3, characterized in that the inhibitor comprises the pharmaceutical use for inhibiting the proliferation, invasion and migration of tumor cells including esophageal squamous cell carcinoma and for promoting the apoptosis of tumor cells.

5. The inhibitor according to claim 3, characterized in that it is packaged into DH 5a construction lentiviral vector.