CN115006455A - Application of traditional Chinese medicine compound Xinmaijia in preparation of medicines for treating or preventing atherosclerosis diseases - Google Patents

Abstract

The invention discloses an application of a traditional Chinese medicine compound Xinmaijia in preparing a medicine for treating or preventing atherosclerosis diseases, wherein the traditional Chinese medicine compound Xinmaijia is prepared from the following raw materials in parts by weight: 1-5 parts of ginseng, 10-30 parts of salvia miltiorrhiza, 10-30 parts of earthworm, 10-30 parts of kudzuvine root, 10-30 parts of giant knotweed and 10-20 parts of coptis chinensis, and the traditional Chinese medicine compound heart vessel can be used for inhibiting the formation of foam cells mediated by NLRP3 inflammatory corpuscles. The traditional Chinese medicine compound Xinmaijia can reduce the release of an inflammatory factor IL-1 beta by inhibiting an NLRP3 inflammatory corpuscle channel in macrophages, and effectively prevent the macrophages from converting into foam cells. The invention not only discloses the action mechanism of good heart pulse anti-inflammatory and anti-atherosclerosis, but also provides a new choice for preventing and treating atherosclerosis diseases.

Description

Application of traditional Chinese medicine compound Xinmaijia in preparation of medicines for treating or preventing atherosclerosis diseases

Technical Field

The invention belongs to the technical field of new medical application of a traditional Chinese medicine compound Xinmaijia, and particularly relates to application of the traditional Chinese medicine compound Xinmaijia in preparation of a medicine for treating or preventing atherosclerosis diseases.

Background

Cardiovascular and cerebrovascular diseases are serious diseases seriously endangering human health, and the incidence rate and the mortality rate of the cardiovascular and cerebrovascular diseases are the first world diseases. Atherosclerosis (AS) is the basis of cardiovascular and cerebrovascular events such AS myocardial infarction and cerebral infarction, and the formation of foam cells is the key to the occurrence of AS. Foam cells are primarily macrophages and smooth muscle cells engulfed by large amounts of oxidized low density lipoprotein (ox-LDL), and the accumulation of large amounts of foam cells can lead to the formation of lipid streaks and plaques. Among the pathological mechanisms of AS, the immune theory of inflammation has gained wide academic acceptance in recent years. The NLRP3 inflammasome is a macromolecular polyprotein complex important in AS inflammatory response, and mainly consists of intracytoplasmic NLRP3, procaspase-1 and ASC. Generally, upon stimulation of cells by etiologically-associated and risk-associated molecular patterns, intracellular NLRP3 and its associated components are upregulated, while NLRP3 recruits ASCs and procaspase-1 to form NLRP3 inflammasome by changing conformation. The NLRP3 small inflammatory bodies can cut procaspase-1 to form caspase-1, thereby promoting the maturation and release of IL-1 beta and IL-18, and further causing inflammatory response. Studies have shown that gene knockout or drug intervention in NLRP3 inflammasome activity can significantly inhibit the progression of AS. Currently, most of NLRP3 inflammasome inhibitors are small-molecule compounds and natural products, and no medicament targeting NLRP3 inflammasome is put into clinical application due to serious adverse reaction or poor treatment effect.

The main pathological feature of AS is the massive deposition of lipids in the foam cells to form plaques, leading to luminal narrowing and small vessel occlusion. Western medicines for treating AS mainly relieve the vascular occlusion by taking medicines for regulating blood fat, resisting platelet aggregation, resisting coagulation and the like, are similar to the traditional Chinese medicines for promoting blood circulation and removing blood stasis and treating blood stasis caused by blood coagulation and vein, but have weaker treatment effect on blood stasis caused by fat coagulation and vein wall. Blood stasis caused by the wall of the blood vessel due to coagulation is pathogenic essence of AS, the pathological mechanism of the blood stasis is very complex, and inflammatory reaction plays an extremely important role in the pathogenic mechanism. Traditional medicine development mostly focuses on a specific inhibitor of a single target, and medicines are basically monomer compounds, act on the single target, and are difficult to obtain obvious curative effect in treatment of complex diseases such AS AS. Therefore, development of a multi-component, multi-target and multi-channel anti-inflammatory treatment strategy is expected to bring a new breakthrough for clinically treating AS.

Disclosure of Invention

The invention solves the technical problem of providing the application of the traditional Chinese medicine compound Xinmaijia in preparing the medicines for treating or preventing atherosclerosis diseases.

The invention adopts the following technical scheme for solving the technical problems, and the application of the traditional Chinese medicine compound Xinmaijia in preparing the medicines for treating or preventing atherosclerosis diseases is characterized in that: the traditional Chinese medicine compound Xinmaijia is prepared from the following raw materials in parts by weight: 1-5 parts of ginseng, 10-30 parts of salvia miltiorrhiza, 10-30 parts of earthworm, 10-30 parts of kudzuvine root, 10-30 parts of giant knotweed and 10-20 parts of coptis chinensis, and the traditional Chinese medicine compound heart vessel can be used for inhibiting the formation of foam cells mediated by NLRP3 inflammasome.

Further limited, the traditional Chinese medicine compound Xinmaijia is prepared from the following raw materials in parts by weight: 3 parts of ginseng, 20 parts of salvia miltiorrhiza, 10 parts of earthworm, 15 parts of kudzu root, 15 parts of giant knotweed and 10 parts of coptis chinensis.

Further limited, the specific preparation process of the traditional Chinese medicine compound Xinmaijia comprises the following steps:

step S1: respectively pulverizing Ginseng radix, Saviae Miltiorrhizae radix, Lumbricus, radix Puerariae, rhizoma Polygoni Cuspidati and Coptidis rhizoma in a refrigerating micronizer to obtain 6 kinds of Chinese medicinal coarse powder;

step S2: respectively sieving the 6 kinds of traditional Chinese medicine coarse powder obtained in the step S1 through a 300-mesh sieve to obtain 6 kinds of traditional Chinese medicine superfine powder;

step S3: mixing the 6 kinds of traditional Chinese medicine superfine powder obtained in the step S2 according to the weight part ratio, uniformly stirring by a stirrer to obtain traditional Chinese medicine compound Xinmaijia superfine mixed powder, and placing the mixed powder in an environment at 5-15 ℃ for later use;

step S4: weighing 1g of the ultramicro mixed powder of the Xinmaijia obtained in the step S3, adding 500mL of water, boiling for sterilization, and concentrating with slow fire to obtain the traditional Chinese medicine compound Xinmaijia.

Further limiting, the Chinese herbal compound Xinmaijia can inhibit the activation of NLRP3 inflammatory corpuscle, specifically reduce the protein expression of NLRP3, pro-caspase-1 and pro-IL-1 beta in macrophage BMDMs, and reduce the activation and release of caspase-1 and IL-1 beta; inhibiting foam cell formation is specifically the reduction of ox-LDL induced lipid deposition in BMDMs.

Compared with the prior art, the invention has the following advantages and beneficial effects: under the guidance of the traditional Chinese medicine theory, the invention adopts dialectical treatment and combines with the modern pathophysiology research of atherosclerosis; the formula is selected, and the proportion of the whole composition is scientific and reasonable. Experimental results show that the compound traditional Chinese medicine compound Xinmaijia can reduce the release of an inflammatory factor IL-1 beta by inhibiting an NLRP3 inflammatory corpuscle channel in macrophages, and effectively prevent the macrophages from converting into foam cells. The invention not only discloses the action mechanism of good heart pulse anti-inflammatory and anti-atherosclerosis, but also provides a new choice for preventing and treating atherosclerosis diseases.

Drawings

FIG. 1 shows the results of the effect of Xinmaijia on the activity of BMDMs cells provided by the present invention;

FIG. 2 shows the results of the effect of Xinmaijia provided by the present invention on the inflammatory factors IL-1 beta, IL-6, IL-18 and TNF-alpha in BMDMs;

FIG. 3 is a graph showing the effect of the present invention on the activation of NLRP3 inflammasome in BMDMs;

FIG. 4 shows the effect of Xinmaijia on apoptosis in BMDMs provided by the present invention;

FIG. 5 shows the effect of the present invention on the sensitization phase of NLRP3 inflammasome;

FIG. 6 is the result of the effect of the Xinmaijia provided by the invention on the activation stage of NLRP3 inflammasome;

FIG. 7 shows the results of the effect of Xinmaijia on foam cell formation provided by the present invention;

FIG. 8 is a schematic diagram of the mechanism of inhibition of foam cell formation by Xinmaijia according to the present invention.

Detailed Description

The present invention is described in further detail below with reference to examples, but it should not be construed that the scope of the above subject matter of the present invention is limited to the following examples, and that all the technologies realized based on the above subject matter of the present invention belong to the scope of the present invention.

Examples

The composition and the proportion of the raw material medicines are as follows: 1-5 parts of ginseng, 10-30 parts of salvia miltiorrhiza, 10-30 parts of earthworm, 10-30 parts of kudzu root, 10-30 parts of giant knotweed and 10-20 parts of coptis chinensis. The compound traditional Chinese medicine has the advantages of mild medicine property, good taste, safety, definite content of active ingredients, obvious effect, quality control, stable effect and long-term use, is an edible and medicinal dual-purpose traditional Chinese medicine with the protection effect on heart and cerebral vessels by professor of Wanguang Rui of New country medical college, and selects a traditional Chinese medicine formula with strong effect, safety and stable performance according to the research of modern traditional Chinese medicine pharmacology.

A method for preparing an active composition from the traditional Chinese medicine compound comprises the following steps: (1) respectively pulverizing 3 parts by weight of ginseng, 20 parts by weight of salvia miltiorrhiza, 10 parts by weight of earthworm, 15 parts by weight of kudzuvine root, 15 parts by weight of giant knotweed and 10 parts by weight of coptis chinensis in a refrigeration ultrafine pulverizer to obtain 6 kinds of traditional Chinese medicine coarse powder; (2) sieving the obtained 6 kinds of Chinese medicinal coarse powder with 300 mesh sieve respectively to obtain 6 kinds of Chinese medicinal superfine powder; (3) mixing the 6 kinds of traditional Chinese medicine superfine powder, uniformly stirring by using a stirrer to obtain traditional Chinese medicine compound Xinmaijia superfine mixed powder, and placing the mixed powder in an environment at 5-15 ℃ for later use; (4) weighing 1g of the traditional Chinese medicine compound Xinmaijia ultramicro mixed powder, adding 500mL of water, boiling for sterilization, and concentrating with slow fire to obtain the Xinmaijia active composition.

Experimental methods

1. Animals and reagents

All animal experiments were ethically reviewed and approved by the new county medical institute. C57/BL6J mice were purchased from Experimental animals technology, Inc., Viton, Beijing. Lipopolysaccharide (LPS) and nigericin (nigericin) were purchased from Sigma. All other materials and reagents were purchased from Thermo Fisher Scientific and Takara or otherwise described.

2. Cell isolation and culture

Bone Marrow Derived Macrophages (BMDMs) were isolated from femurs and tibias of healthy 6-8 week old C57 mice. The specific operation is as follows: anaesthetizing a mouse, taking down thighs after the neck of the mouse is cut off, carefully removing muscle tissues, soaking the mouse in 75% alcohol by volume fraction for 5 minutes, cutting the mouse from the knee joint, immediately transferring the mouse into PBS for cleaning, flushing 5mL of high-sugar DMEM into a 15mL centrifuge tube by using an injector, centrifuging the mouse at 1000rpm for 5 minutes, removing the supernatant, adding 10mL of macrophage culture medium (80 wt% high-sugar DMEM complete culture medium +20wt% L929 cell culture supernatant), re-suspending the mouse, transferring the mouse into a culture dish, placing the mouse into an incubator for static culture, changing the culture medium once after 3 days, and obtaining completely differentiated BMDMs on the 7 th day which can be used for subsequent experiments.

3. CCK-8 detection of cell Activity

BMDMs treated by the Chinese herbal compound Xinmaijia are determined by a CCK-8 kit of Shanghai Biyuntian biotechnology limited company.

4. Real-time quantitative PCR (qRT-PCR)

Total cellular RNA was extracted using Trizol reagent (Invitrogen), and the extracted total RNA was reverse-transcribed into cDNA using cDNA reverse transcription kit (Takara). According to the kit instruction, cDNA is taken as a template, and an SYBR Green fluorescent probe is adopted to detect the expression level of mRNA. The primer sequences (5 '-3') required for qRT-PCR are as follows:

IL-1β

Forward primer：GCAACTGTTCCTGAACTCAACT

Reverse primer：ATCTTTTGGGGTCCGTCAACT

IL-6

Forward primer：TAGTCCTTCCTACCCCAATTTCC

Reverse primer：TTGGTCCTTAGCCACTCCTTC

IL-18

Forward primer：GACTCTTGCGTCAACTTCAAGG

Reverse primer：CAGGCTGTCTTTTGTCAACGA

TNF-α

Forward primer：CCCTCACACTCAGATCATCTTCT

Reverse primer：GCTACGACGTGGGCTACAG

β-actin

Forward primer：AGAGGGAAATCGTGCGTGAC

Reverse primer：CAATAGTGATGACCTGGCCGT

5. protein immunoblotting (Western blotting)

The cells were lysed using RIPA lysate, protein extracted, separated by SDS-PAGE, and transferred to a PVDF membrane for western blot analysis. Specific information on the antibodies used is as follows: NLRP3 (# AG-20B-0014-C100, AdipoGen), IL-1 β (# ab254360, Abcam), caspase-1 (# sc-56036, Santa Cruz), ASC (# sc-514414, Santa Cruz), CD36 (# 18836-1-AP, Proteintetech), PCSK9 (# ab185194, Abcam), GAPDH (# 60004-1-Ig, Proteintetech) and β -actin (# 66009-1-Ig, Proteintetech). All primary antibodies were incubated at 4 ℃ overnight at a 1:1000 dilution.

6. Culture solution soluble protein extraction

Extracting soluble protein in the culture solution by using a sodium deoxycholate/trifluoroacetic acid method. The specific method comprises the following steps: the supernatant of the culture solution with the same volume is collected, centrifuged at 1000rpm for 5 minutes, transferred, added with 10wt% sodium deoxycholate and 100wt% trifluoroacetic acid, mixed well and kept overnight at 4 ℃. The mixture was centrifuged at 14000rpm at 4 ℃ for 15 minutes, washed twice with ice acetone, and then added with a protein loading buffer to carry out Western blotting.

7. Determination of cellular scorching

The NLRP3 inflammasome is activated by adopting a two-step method, a macrophage apoptosis model is established, and the cell apoptosis is detected by a Hoechst/PI method. The specific method comprises the following steps: firstly, adding 1 mu g/mL LPS into BMDMs to stimulate cells for 3 hours; the second step was stimulated with 10. mu.M nigericin for 1 hour. PBS washing twice, adding Hoechst/PI stain, incubating for 10 minutes at room temperature in dark, observing by using a fluorescence inverted microscope and analyzing the result.

8. Foam cell induction and assay

BMDMs were then treated with cardiotonic pretreatment for 12 hours, with the addition of 25. mu.g/mL ox-LDL for 24 hours, and the degree of intracellular lipid deposition was determined by oil-red O staining.

9. Statistical analysis

The data were statistically analyzed using GraphPad Prism 7.0 software, with mean. + -. standard deviation data, student t test for comparisons between groups, and One-way ANOVA for comparisons between groups.

Results

1. FIG. 1 shows the effect of Pericarppium on the activity of BMDMs cells

FIG. 1 shows that BMDMs after complete differentiation were pretreated with different concentrations of suboptimal cardiac rate, and the influence of suboptimal cardiac rate on the survival rate of BMDMs cells was examined and analyzed by the CCK-8 method.

The result shows that when the optimal concentration of the heart pulse is more than 5 percent, the cell activity is inhibited, and the heart pulse has certain cytotoxicity; when the optimal concentration of the heart pulse is less than 5%, the cells have better activity and no obvious cytotoxicity, and the optimal drug concentration is shown in figure 1. Therefore, the experiment adopts 1wt% (low concentration), 2.5wt% (medium concentration) and 5wt% (high concentration) as the using concentration of the good heart pulse to carry out the subsequent experiments.

2. FIG. 2 shows the anti-inflammatory effects of cardiale in BMDMs

BMDMs are pretreated for 12 hours by cardiotrophin, LPS is added for stimulation for 3 hours, cells are collected, total RNA is extracted, and qRT-PCR experiment is carried out.

FIG. 2 (A) is a graph showing the effect of suboptimal cardiovascularity on the level of IL-1 β transcription in LPS-stimulated BMDMs.

FIG. 2 (B) is a graph showing the effect of suboptimal cardiovascularity on the level of IL-6 transcription in LPS-stimulated BMDMs.

FIG. 2 (C) is a graph showing the effect of suboptimal cardiovascularity on the level of IL-18 transcription in LPS-stimulated BMDMs.

FIG. 2 (D) is a graph showing the effect of suboptimal cardiovascularity on LPS stimulation of TNF- α transcription levels in BMDMs.

In BMDMs, the cardiovasculars had significant inhibitory effects on IL-1 β, IL-6, IL-18, and TNF- α, inflammatory factors that were upregulated in large amounts after LPS stimulation (FIGS. 2A-D).

3. FIG. 3 shows the effect of Pericarpus on activation of NLRP3 inflammasome in BMDMs

BMDMs are pretreated for 12 hours by cardiovascula, are stimulated by LPS and niger in combination for 4 hours respectively, cell culture solution is collected, dissolved protein in the culture solution is extracted, and the contents of caspase-1 and IL-1 beta in the culture solution are detected by Western blotting.

FIG. 3 (A) is a graph showing the effect of suboptimal cardiovascularity on IL-1. beta. and caspase-1 levels in cell culture following co-stimulation of BMDMs with LPS and nigericin.

FIG. 3 (B) is a statistical result of caspase-1 content in cell culture after co-stimulation of BCDMs pretreated with Pimpinella cardioides.

FIG. 3 (C) is a statistical result of IL-1. beta. content in cell culture fluid after co-stimulation of the BMDMs pretreated for cardiovascula.

The results show that the combined stimulation of BMDMs by LPS and nigericin leads to activation of intracellular NLRP3 inflammasome and increased caspase-1 and IL-1. beta. content in the culture (FIGS. 3A-C). After pretreatment of suboptimal cardiovascula, which significantly reduced caspase-1 and IL-1. beta. levels in the culture, BMDMs were stimulated with LPS and niger in combination (FIGS. 3A-C).

4. FIG. 4 shows the effect of Pericarpotal on LPS and nigericin in combination to stimulate apoptosis of BMDMs cells

BMDMs were pretreated with cardiotropics for 12 hours, stimulated with LPS and nigericin for 4 hours, fixed with 4wt% paraformaldehyde, stained with Hoechst/PI, observed with a fluorescence inverted microscope and analyzed for results.

FIG. 4 (A) is a fluorescence representation of the combined stimulation of apoptosis of BMDMs by PMs and nigericin.

FIG. 4 (B) is a statistical result of the cell apoptosis in the graph of FIG. 4 (A).

In BMDMs, suboptimal cardiac reduces cell apoptosis induced by combined stimulation with LPS and niger (fig. 4A-B) in a concentration-dependent manner, further demonstrating that suboptimal cardiac inhibits NLRP3 inflammasome activation.

5. FIG. 5 shows the effect of Pericarpus cordis on the sensitization phase of NLRP3 inflammasome

BMDMs are pretreated for 12 hours by optimizing heart vessels, LPS is added for stimulation for 3 hours, cells are collected, protein is extracted, and Western blotting is carried out.

FIG. 5 (A) is a graph of the effect of suboptimal cardiovascularity on LPS stimulation of expression of NLRP3, pro-caspase-1 and pro-IL-1. beta. proteins in BMDMs.

FIG. 5 (B) is a statistical result of NLRP3 in the graph of FIG. 5 (A).

FIG. 5 (C) is a statistical result of pro-caspase-1 in FIG. 5 (A).

FIG. 5 (D) is a statistical result of pro-IL-1. beta. in the graph of FIG. 5 (A).

To explore the mechanism by which the cardia inhibits the activation of NLRP3 inflammasome in macrophages, we first examined the effect of the cardia on the expression of NLRP3 and its related component proteins during the sensitization phase of NLRP 3. The results showed that suboptimal cardiovascularity decreased the LPS-induced upregulation of NLRP3, pro-caspase-1 and pro-IL-1. beta. expression, with some concentration dependence (FIGS. 5A-D).

6. FIG. 6 shows the effect of Pericarpus cordis on the activation phase of NLRP3 inflammasome

BMDMs are stimulated by LPS for 3 hours, then added with cardiotonic for 2 hours, then added with nigericin for stimulation for 1 hour, and cells and culture solution are collected, protein is extracted, and Western blotting is carried out.

FIG. 6 (A) is a graph of the effect of Xylocarpus on caspase-1, IL-1 β levels in cell culture during the activation phase of NLRP3 inflammasome.

FIG. 6 (B) is a statistical result of caspase-1 in the graph of FIG. 6 (A).

FIG. 6 (C) is a statistical result of IL-1. beta. in the graph of FIG. 6 (A).

To further explore the mechanism by which the cardia inhibits activation of NLRP3 inflammasome, we examined the effect of the cardia on the activation phase of NLRP3 inflammasome. The results showed that Siberian cardiovasculars decreased caspase-1 and IL-1 β levels in the culture broth in a concentration-dependent manner (FIGS. 6A-C).

7. FIG. 7 shows the effect of cardialgia on foam cell formation

BMDMs were pretreated with cardiotrophism for 12 hours, treated with ox-LDL for 24 hours, and separately harvested and stained with oil red O.

FIG. 7 (A) is a representation of the oil red O staining of cardial to ox-LDL induced foam cell formation.

FIG. 7 (B) is a statistical chart of the lipid deposition in the graph of FIG. 7 (A).

The results show that the optimal cardiac pulse can obviously reduce ox-LDL induced lipid deposition in BMDMs cells and inhibit macrophage to foam cell conversion (FIGS. 7A-B).

8. FIG. 8 is a mechanism exploration of inhibition of ox-LDL induced foam cell formation by cardialgia

FIG. 8 (A) is the effect of suboptimal cardiovascula on the expression of NLRP3 inflammatory-corpuscle protein in foam cells.

FIG. 8 (B) is the effect of suboptimal cardiovascula on CD36 and PCSK9 protein expression in foam cells.

Fig. 8 (C) shows the statistical results of NLRP3 in fig. 8 (a).

FIG. 8 (D) is a statistical result of pro-caspase-1 in FIG. 8 (A).

FIG. 8 (E) is a statistical result of pro-IL-1. beta. in the graph of FIG. 8 (A).

FIG. 8 (F) is a statistical result of the ASC in FIG. 8 (A).

FIG. 8 (G) is a statistical result of CD36 in the graph of FIG. 8 (B).

FIG. 8 (H) is a statistical result of PCSK9 in the graph of FIG. 8 (B).

The results show that the suboptimal cardiovascula can reduce the protein expression of NLRP3, pro-caspase-1, pro-IL-1 beta and ASC in the foam cells and reduce the protein expression of lipid metabolism-related proteins CD36 and PCSK9 (FIGS. 8A-H), and indicate that the suboptimal cardiovascula can reduce lipid intake by inhibiting NLRP3 inflammatory corpuscle pathway, thereby inhibiting foam cell formation.

The foregoing embodiments illustrate the principles, principal features and advantages of the invention, and it will be understood by those skilled in the art that the invention is not limited to the foregoing embodiments, which are merely illustrative of the principles of the invention, and that various changes and modifications may be made therein without departing from the scope of the principles of the invention.

SEQUENCE LISTING

<110> New countryside medical college

<120> application of compound traditional Chinese medicine Xinmaijia in preparation of medicines for treating or preventing atherosclerosis diseases

<130> 2022

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

gcaactgttc ctgaactcaa ct 22

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

atcttttggg gtccgtcaac t 21

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

tagtccttcc taccccaatt tcc 23

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

ttggtcctta gccactcctt c 21

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

gactcttgcg tcaacttcaa gg 22

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

caggctgtct tttgtcaacg a 21

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

ccctcacact cagatcatct tct 23

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

gctacgacgt gggctacag 19

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

agagggaaat cgtgcgtgac 20

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

caatagtgat gacctggccg t 21

Sequence listing

<110> New countryside medical college

<120> application of compound traditional Chinese medicine Xinmaijia in preparation of medicines for treating or preventing atherosclerosis diseases

<130> 2022

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

gcaactgttc ctgaactcaa ct 22

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

atcttttggg gtccgtcaac t 21

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

tagtccttcc taccccaatt tcc 23

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

ttggtcctta gccactcctt c 21

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

gactcttgcg tcaacttcaa gg 22

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

caggctgtct tttgtcaacg a 21

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

ccctcacact cagatcatct tct 23

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

gctacgacgt gggctacag 19

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

agagggaaat cgtgcgtgac 20

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

caatagtgat gacctggccg t 21

Claims (4)

1. The application of the traditional Chinese medicine compound Xinmaijia in preparing the medicine for treating or preventing atherosclerosis diseases is characterized in that: the traditional Chinese medicine compound Xinmaijia is prepared from the following raw materials in parts by weight: 1-5 parts of ginseng, 10-30 parts of salvia miltiorrhiza, 10-30 parts of earthworm, 10-30 parts of kudzuvine root, 10-30 parts of giant knotweed and 10-20 parts of coptis chinensis, and the traditional Chinese medicine compound heart vessel can be used for inhibiting the formation of foam cells mediated by NLRP3 inflammatory corpuscles.

2. The application of claim 1, wherein the traditional Chinese medicine compound Xinmaijia is prepared from the following raw materials in parts by weight: 3 parts of ginseng, 20 parts of salvia miltiorrhiza, 10 parts of earthworm, 15 parts of kudzu root, 15 parts of giant knotweed and 10 parts of coptis chinensis.

3. The use according to claim 1 or 2, characterized in that the specific preparation process of the compound traditional Chinese medicine Xinmaijia is as follows:

step S1: respectively pulverizing Ginseng radix, Saviae Miltiorrhizae radix, Lumbricus, radix Puerariae, rhizoma Polygoni Cuspidati and Coptidis rhizoma in a refrigerating micronizer to obtain 6 kinds of Chinese medicinal coarse powder;

step S2: respectively sieving the 6 kinds of traditional Chinese medicine coarse powder obtained in the step S1 through a 300-mesh sieve to obtain 6 kinds of traditional Chinese medicine superfine powder;

step S3: mixing the 6 kinds of traditional Chinese medicine superfine powder obtained in the step S2 according to the weight part ratio, uniformly stirring by a stirrer to obtain traditional Chinese medicine compound Xinmaijia superfine mixed powder, and placing the mixed powder in an environment at 5-15 ℃ for later use;

step S4: weighing 1g of the ultramicro mixed powder of the Xinmaijia obtained in the step S3, adding 500mL of water, boiling for sterilization, and concentrating with slow fire to obtain the traditional Chinese medicine compound Xinmaijia.

4. Use according to claim 1 or 2, characterized in that: the Chinese herbal compound medicine compound Xinmaijia inhibits activation of NLRP3 inflammatory corpuscle, specifically reduces protein expression of NLRP3, pro-caspase-1 and pro-IL-1 beta in macrophage BMDMs, and reduces activation and release of caspase-1 and IL-1 beta; inhibiting foam cell formation is specifically the reduction of ox-LDL induced lipid deposition in BMDMs.

Images