KR20160041138A - Composition for Prevention or Treatment of Obesity Comprising Tenebrio molitor larva extract or Tenebrio molitor larva suspension - Google Patents

Abstract

The present invention relates to a composition for preventing or treating obesity comprising Tenebrio molitor larva extract or Tenebrio molitor larva suspension. The method for preparing Tenebrio molitor larva extract having an anti-obesity effect includes a first step of pulverizing freeze-dried Tenebrio molitor larva; a second step of mixing the powder of Tenebrio molitor larva with ethanol to provide a mixed liquid of Tenebrio molitor; a third step of refining the mixed liquid of Tenebrio molitor with an ultrasonic pulverizer; and a fourth step of subjecting the refined mixed liquid of Tenebrio molitor to centrifugal separation and recovering the supernatant, followed by filtering, to obtain Tenebrio molitor larva extract having an anti-obesity effect. The anti-obesity composition comprising Tenebrio molitor larva extract or Tenebrio molitor larva suspension as an active ingredient shows no side effect, has excellent safety and an anti-obesity effect, and thus can be used as an agent for preventing and treating obesity or related diseases.

Description

TECHNICAL FIELD The present invention relates to a composition for preventing or treating obesity, which comprises an extract of a brown goat larva or a suspension of a brown goat larva as an active ingredient.

The present invention relates to a composition for preventing or treating obesity comprising an extract of brown larch larva or a suspension of brown larch larva as an active ingredient. More particularly, the present invention relates to a composition for preventing or treating obesity, comprising an extract obtained by extracting brown larch larvae with ethanol or a brown larch larva The present invention relates to a composition for preventing or treating obesity.

Obesity is a phenomenon in which the calories consumed in the state of excessive accumulation of fat in the body due to increased fat intake are caused by exceeding the energy required for physical activity, thereby causing not only cardiovascular diseases such as stroke, arteriosclerosis and myocardial infarction Diabetes mellitus, and liver cirrhosis.

Obesity is a complex syndrome, but the exact mechanism is not known. However, in obesity, weight loss is also very important in reducing the risk of type 2 diabetes effectively in improving insulin resistance, glucose tolerance and lipoprotein disorder.

However, in the case of chronic diseases such as obesity and diabetes, it is difficult to treat because it is often caused by lifestyle along with genetic predisposition. Therefore, there are methods such as exercise, diet, drug administration, and surgery as methods for weight reduction, and dietary therapy is the most fundamental method for prevention and treatment of obesity.

Many studies have been conducted to find effective therapeutic agents for foods and natural products for prevention and treatment of obesity.

Related prior arts are Korean Patent Laid-Open No. 10-2003-0001659 (White Spotted Flower Blossom Extract and Its Use) and Korean Patent Laid-Open No. 10-2012-0069041 (composition for anti-obesity containing fermented asparagus bark as an active ingredient) It is public.

In recent years, competition for securing biological resources through exploration and conservation of insect resources has become fierce, and their valuation and utilization research are being actively carried out. Research on the development of food and medicine materials from insects has been underway in Korea and abroad. Among them, brown duck (Tenebrio molitor, mealworm, TM) is an insect of the beetle, and it is also called brown rice dung. It is distributed all over the world including Korea. The brown duck is a fully transformed insect that passes through eggs, larvae, pupae, and adults, and has now formed a large-scale breeding farmhouse.

Unlike other insects, brown ducks are relatively short in transformation period, adaptable, easy to learn breeding techniques, and are capable of breeding throughout the year.

It is also used as a food insect for birds and pets due to its high reproductive rate. It is also used as an edible insect in foreign countries because of its high protein content. Previous studies related to brown gill have only reported the antimicrobial effect and the range of action of antifungal protein isolated from morphological characteristics and Korean brown gill.

The object of the present invention is to provide a method for preventing or treating obesity which comprises an extract of ethanol extract of Brown goat larva among various insects or a suspension obtained by dissolving Brown goat larvae in water as an anti-obesity effect, Compositions.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not intended to limit the invention to the particular embodiments that are described. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not restrictive of the invention, There will be.

In order to achieve the above object, the pharmaceutical composition for preventing or treating obesity according to the present invention is characterized by containing an extract of Tenebrio molitor larvae or a suspension of Tenebrio molitor larvae as an active ingredient.

The brown goose (Tenebrio molitor) larvae extract is characterized by being extracted with 70% ethanol as a solvent. The brown gooseberry (Tenebrio molitor) larvae suspension is obtained by dissolving brown larvae (Tenebrio molitor) larvae in water.

In another aspect of the present invention, the food composition for preventing or improving obesity is characterized by containing an extract of Tenebrio molitor larva or a suspension of Tenebrio molitor larva as an active ingredient.

The brown goose (Tenebrio molitor) larvae extract is characterized by being extracted with 70% ethanol as a solvent. The brown gooseberry (Tenebrio molitor) larvae suspension is obtained by dissolving brown larvae (Tenebrio molitor) larvae in water.

The method of the present invention for producing an anti-obesity effect of Brown Dusty Larvae comprises a first step of pulverizing a lyophilized brown dung larvae, a step of mixing brown gingival larval powder prepared in the first step and ethanol, A third step of micronization of the brown gyoer mixture prepared in the second step with an ultrasonic pulverizer, and a third step of centrifuging the micronized brown gyoer mixture to recover the supernatant, And then drying it to prepare a brownish larva larva extract having an anti-obesity effect.

Another aspect of the present invention is a method for preparing a brown gully suspension having an anti-obesity effect. A first step of pulverizing the lyophilized larvae of lyophilized brown larvae and a second step of preparing a brown lyre suspension having an anti-obesity effect by dissolving the larvae of brown larch larvae prepared in the first step with water.

The anti-obesity agent of the present invention is characterized by containing the brown gourd larvae extract prepared by the above-mentioned production method or the brown gourd larvae suspension prepared by the above-mentioned method as an active ingredient.

The anti-obesity composition comprising the extract of the larva or the suspension of the larval larva according to the present invention as an active ingredient has no side effects and is not only safe but also has an anti-obesity effect, thereby preventing and preventing diseases associated with obesity or obesity. It can be used as a therapeutic agent.

FIG. 1 is a graph showing the cell viability of a brown goat larva extract of Example 1 of the present invention. FIG.
TME: The brown goat larvae extract treatment of Example 1 of the present invention
MTE: Mate extract treatment group
FIG. 2A is a diagram showing the fat produced by performing Oil-Red O staining after inducing the differentiation of 3T3-L1 adipocytes into mature adipocytes in the brown goat larva extract of Example 1 of the present invention.
adipocyte: adipocyte
TME: The brown goat larvae extract treatment of Example 1 of the present invention
MTE: Mate extract treatment group
FIG. 2B is a graph showing adipocyte size after inducing differentiation of 3T3-L1 adipose precursor cells into mature adipocytes in the brown goat larva extract of Example 1 of the present invention. FIG.
TME: The brown goat larvae extract treatment of Example 1 of the present invention
MTE: Mate extract treatment group
FIG. 3 is a graph showing glycerol release measured when lipolysis in fat cells is degraded in the brown goat larva extract of Example 1 of the present invention. FIG.
TME: The brown goat larvae extract treatment of Example 1 of the present invention
MTE: Mate extract treatment group
FIG. 4A is a graph showing the expression of C / EBPα (CCAAT / enhancer-binding proteins α), which is a lipogenesis-related gene, in the brown goat larva extract of Example 1 of the present invention.
TME: The brown goat larvae extract treatment of Example 1 of the present invention
FIG. 4B is a graph showing the expression analysis of SREBP1c (Sterol regulatory element-binding protein 1), which is a gene related to lipogenesis, in the brown larvae extract of Example 1 of the present invention.
TME: The brown goat larvae extract treatment of Example 1 of the present invention
FIG. 4C is a graph showing the expression of SCD1 (Stearoyl-coenzyme desaturase-1), which is a gene related to lipogenesis, in the brown dung larva extract of Example 1 of the present invention.
TME: The brown goat larvae extract treatment of Example 1 of the present invention
4D is a graph showing the expression of FAS (Fatty acid synthase), a gene related to lipogenesis, in the brown larvae extract of Example 1 of the present invention.
TME: The brown goat larvae extract treatment of Example 1 of the present invention
FIG. 4E is a graph showing the expression analysis of LPL (lipoprotein lipase), a gene related to lipogenesis, in the brown larvae larva extract of Example 1 of the present invention. FIG.
TME: The brown goat larvae extract treatment of Example 1 of the present invention
FIG. 5A is a graph showing the change in epididymal adipose tissue of the epididymal adipose tissue after 4 weeks old male ICR male mice were orally administrated for 6 weeks with obesity induction via high fat diet FIG.
ND (Normal diet): Normal diet
NFD (High fay diet): High fat diet
TM: The brown gill larva suspension treated group of Example 2 of the present invention
FIG. 5B is a graph showing changes in the epididymal adipose tissue size of the epididymis of a brown duck larva suspension of Example 2 of the present invention in a 4-week-old ICR male mouse. FIG.
ND (Normal diet): Normal diet
NFD (High fay diet): High fat diet
TM: The brown gill larva suspension treated group of Example 2 of the present invention
FIG. 6 is a graph showing the degree of lipid deposition in the liver of an ICR-type male mouse at 4 weeks of age, according to the second embodiment of the present invention.
ND (Normal diet): Normal diet
NFD (High fay diet): High fat diet
TM: The brown gill larva suspension treated group of Example 2 of the present invention
FIG. 7A shows the results of oral administration of a 4-week-old ICR male mouse according to the second embodiment of the present invention, which induces obesity in a high fat diet (HIgh fat diet), and then SREBP1c regulatory element-binding protein 1).
N (Normal): Normal diet
NFD (High fay diet): High fat diet
TM: The brown gill larva suspension treated group of Example 2 of the present invention
MT: Matte suspension treated group
FIG. 7B is a graph showing the results of the oral administration of an ICR-type male mouse at 4 weeks of age for 6 weeks in the obesity induced induction of obesity induction (HIgh fat diet) (Lipoprotein lipase) expression analysis.
N (Normal): Normal diet
NFD (High fay diet): High fat diet
TM: The brown gill larva suspension treated group of Example 2 of the present invention
MT: Matte suspension treated group
FIG. 7C is a graph showing the results of a 4-week-old ICR male mouse treated with a higgh fat diet for inducing obesity. The brown goat larva suspension of Example 2 was orally administered for 6 weeks, (Stearoyl-coenzyme desaturase-1).
N (Normal): Normal diet
NFD (High fay diet): High fat diet
TM: The brown gill larva suspension treated group of Example 1 of the present invention
MT: Matte suspension treated group

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Hereinafter, the present invention will be described in detail, and a detailed description of known functions and configurations that may unnecessarily obscure the gist of the present invention will be omitted.

In modern society, obesity is on the rise due to improvement of living standards and westernized eating habits and high fat diet, and obesity is a serious social problem because it is accompanied by dyslipidemia, hypertension and diabetes.

Therefore, the present invention aims to evaluate the functionality of anti-obesity agents of brown goats which have been widely used in Korea and other countries, and which have recently been widely used for edible purposes in the world, and have reported recipe regarding source development and nuts production.

It was confirmed that the fat content of mature adipocytes was decreased by the ethanol extract of brown goats and that the amount of glycerol liberated by the decomposition of triglycerides was greatly increased. These results indicate that the brown ducks show lipidation effects in mature adipocytes.

Based on the above results, the anti-obesity effect of the suspension obtained by dissolving the brown goat larvae in water in vivo was confirmed. As a result, the obesity-induced rats were treated with high fat diet for 6 weeks, Compared with the positive control group.

It can be said that this is a sufficient confirmation of the effect of weight loss from the viewpoint of the treatment by the drug after induction of obesity. In addition, in the present invention, the high fat diet induces obesity and at the same time, As a result, it was found that the body weight gain rate of obesity-induced simultaneous brown goat larvae was decreased when compared to the control group fed only with high fat diet, and the size and relative weight of the reproductive fat were measured The results also showed a significant decrease.

These results suggest that brown goat larvae will have sufficient value for development as a health functional material with anti - obesity effect.

Thus, the method for producing the larva extract of the brown duck having the anti-obesity effect of the present invention will be described in detail as follows.

1. First step; Brown goat larvae crushing

First, in this step, a brown duck (Tenebrio molitor) larva is prepared.

The brown duck (Tenebrio molitor) is an insect of the beetle, and is also known as brown rice dung. It is distributed in Korea and other parts of the world. It is an insect that undergoes a complete transformation of eggs, larvae, pupae, and adults and is currently producing large-scale domestic breeding farms. The larval period is about 10 weeks, but about 2 weeks when artificial breeding.

Unlike other insects, brown ducks are relatively domesticated for a short period of transformation, and are largely kept for pets. Brown larvae are used as food worms for mealworms because they have high protein content, high growth rate and very high reproductive rate .

The brown duck (Tenebrio molitor) larva prepared as described above is dried and then pulverized into a powder form.

In other words, since the brown gill (Tenebrio molitor) contains a large amount of water, it needs to be dried to make it completely free from moisture. At this time, it is preferable to perform drying through freeze drying in order to minimize the change of the active ingredients contained in the brown gill.

The dried brown gruel is then prepared in the form of a powder using a pulverizer for ease of subsequent extraction.

2. The second step; Preparation of mixed brown liquid (Tenebrio molitor)

In this step, the brown guppy (Tenebrio molitor) larvae powder prepared above is mixed with ethanol to prepare a brown goat mixture.

At this time, the mixing ratio of ethanol and pulverized brown mallow larvae powder is not particularly limited, but it is preferable to mix the pulverized brown mallow larva powder 1 to 3 g per 1 liter of ethanol. If the concentration is out of the above range, it may be troublesome to carry out an additional process of adjusting the concentration to a proper concentration through troublesome concentration or dilution.

Also, any ethanol may be used as the above-mentioned ethanol, but it is preferable to use 70 ~ 80% of ethanol so as to extract the most effective ingredient contained in the brown gruel.

3. The third step; The step of micronizing the brown goat (Tenebrio molitor) mixture

In this step, the active ingredient having the anti-obesity effect is extracted from the brown goat's mixed liquor, which can be micronized without any specific limitation using a conventional ultrasonic pulverizer. However, when the ultrasonic pulverizer is added to the brown goat liquor to an energy of 200 to 300 joules For 10 to 30 seconds.

If the application conditions of the ultrasonic mill are out of the above range, the desired active ingredient may not be extracted, or the active ingredient may be destroyed or denatured.

4. Step 4; Preparation stage of brown goat (Tenebrio molitor) larvae extract

In this step, after centrifuging the micronized brown gorup liquor, the supernatant is collected, filtered, and dried to finally produce a brown gurd larva extract having an anti-obesity effect.

At this time, the centrifugation is performed at 4000 to 5000 rpm for 5 to 20 minutes. If the centrifugation application condition is out of the range, the desired active ingredient may be destroyed or denatured.

Hereinafter, a method for producing a larva suspension of a brown gourd having the anti-obesity effect of the present invention will be described in detail.

.One. A first step; Brown goat larvae crushing

The same method as in the first step in the preparation of the brown goat larvae extract is used to produce the larvae of the larvae of Galgagger larvae.

2. The second step; Preparation of Brown Duck (Tenebrio molitor) larvae suspension

In this step, the brown guppy (Tenebrio molitor) larvae powder prepared above is dissolved in water to prepare a brown duck larva suspension.

At this time, the mixing ratio of water and pulverized brown mallow larva powder is not particularly limited, but it is preferable to mix 1 to 3 g of the pulverized brown mallow larva powder per liter of the water. If the concentration is out of the above range, it may be troublesome to carry out an additional process of adjusting the concentration to a proper concentration through troublesome concentration or dilution.

In another aspect, the present invention provides a pharmaceutical composition for preventing or treating obesity or a composition for preventing or improving obesity, which comprises the brown gill larva extract or the brown gill larva suspension prepared by the above method as an active ingredient.

Specifically, the brown larvae larvae extract or the brown larva larva larvae have an anti-obesity effect and can be used as an active ingredient of a pharmaceutical composition for preventing or treating obesity or a food composition for preventing or improving obesity.

Herein, the content of the extract of Tenebrio molitor larvae in the active ingredient is in the range of 100 to 2000 μg based on 1 ml of the composition, more preferably, 2000 μg It is good.

In addition, the content of the brown gill (Tenebrio molitor) larvae suspension is 100 to 3000 mg per kg of the active ingredient, more preferably 3000 mg per kg of the mouse.

The pharmaceutical composition comprising the brown goat larva extract or the brown goat larva suspension of the present invention has an effect of inhibiting adipocyte differentiation and lipogenesis, and is useful as a preventive and therapeutic agent against partial or complete obesity (i.e., general obesity) such as hyperlipidemia, fatty liver, visceral obesity, Can be prevented and treated.

Such a pharmaceutical composition comprising the above-described brown dung larvae extract or brown dung larvae suspension can be administered orally or parenterally and can be used in the form of a general pharmaceutical preparation. The preferred pharmaceutical preparations are those for oral administration such as tablets, hard or soft capsules, liquids, suspensions, etc. These pharmaceutical preparations can be prepared into conventional pharmaceutically acceptable carriers, for example, excipients such as excipients, Binders, disintegrators, lubricants, solubilizers, suspending agents, preservatives or extenders.

In addition, the dosage of the pharmaceutical composition comprising the brown mallow larvae extract or the brown mallow larva suspension of the present invention may be determined by an expert according to various factors such as the condition, age, sex and complications of the patient, May be administered at a dose of from 0.1 mg to 10 g, preferably from 10 mg to 1 g, per kg. Also, the daily dosage of the pharmaceutical composition per unit dosage form, or a half, 1/3 or 1/4 dose thereof, may be contained, and may be administered 1 to 6 times per day. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of controlling health, the amount may be less than the above range, and the active ingredient may be used in an amount in the above-mentioned range because there is no problem in terms of safety.

In addition, the food composition containing the brown goat larva extract or brown goat larva suspension of the present invention has an effect of inhibiting adipocyte differentiation and lipogenesis, thereby preventing and improving obesity.

The food is not limited to health supplements, health functional foods, functional foods and the like, and includes natural foods, processed foods, general food ingredients, etc. to which the composition of the present invention is added.

The food composition comprising the brown duck larva extract or the brown duck larva suspension of the present invention can be used as it is or can be used in combination with other food or food compositions and can be suitably used according to conventional methods.

Such a food composition may be contained in a health food for the purpose of prevention and improvement of obesity, and there is no particular limitation on its kind. Examples of the food to which the above substances can be added include dairy products including meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, Alcoholic beverages, and vitamin complexes, all of which include healthy foods in a conventional sense.

In addition to the above, the food composition of the present invention may further contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, Alcohols, carbonating agents used in carbonated drinks, and the like. In addition, the food composition of the present invention may be contained as pulp for the production of natural fruit juice, fruit juice drink and vegetable drink. These components may be used independently or in combination. The proportion of such additives is not critical, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

<Example 1> Preparation of brown dung larvae extract (TME) having an anti-obesity effect

Brown goose (Tenebrio molitor) larvae were purchased from an insect ecotype garden (Goseong, Gyeongnam) and then washed twice with running water.

Then, brown goat larvae were poured with liquid nitrogen and rapidly frozen and frozen in a -70 ° C cryogenic freezer (NIHON freezer, Tokyo, Japan) for 24 hours.

 After sterilization at 115 ° C for 5 minutes, water was removed by drying using a freeze dryer (Eyela, Tokyo, Japan).

3 g of the powder was dissolved in 1 liter of 70% ethanol and dissolved in 230 μl of an ultrasonic shredder (LabaX, MA, USA) after ultrasonic disruption for 20 seconds, followed by 4500 The resulting supernatant was filtered with a 0.25 μm syring filter (Whatman, ND, USA) and then dried to prepare a brown dung larva extract (hereinafter referred to as TME) of the present invention.

<Example 2> Preparation of brown dung larva suspension (TM) having an anti-obesity effect

Brown goose (Tenebrio molitor) larvae were purchased from an insect ecotype garden (Goseong, Gyeongnam) and then washed twice with running water.

Then, brown goat larvae were poured with liquid nitrogen and rapidly frozen and frozen in a -70 ° C cryogenic freezer (NIHON freezer, Tokyo, Japan) for 24 hours.

Then, it was sterilized at 115 ° C for 5 minutes and then dried using a freeze dryer (Eyela, Tokyo, Japan) to remove moisture.

The brown goat whose moisture was removed was pulverized with a pulverizer (Multifunction Grinder, KSP-35, Korea) to prepare a powder. Then, 1 L of distilled water was added to 3 g of the powder and dissolved to prepare a suspension of the larvae of the present invention (hereinafter referred to as TM) Respectively.

Example 3 Preparation of Tablets Containing Larval Extract of Brown Goose with Anti-obesity Effect of the Present Invention

The brown goat larva extract of Example 1 ... 2000 占 퐂

Lactose ........................................ 100 mg

Starch ........................................ 100 mg

Magnesium stearate qs

The above components are mixed and tablets are prepared by tableting according to a conventional method for producing tablets

<Example 4> Preparation of health food containing brown gill larva suspension having anti-obesity effect of the present invention

The brown goose larva suspension of Example 2 ......... 3000 mg

Vitamin mixture ..............................

Vitamin A Acetate .................... 70 ㎍

Vitamin E .................................. 1.0 mg

Vitamin B1 ................................. 0.13 mg

Vitamin B2 ................................. 0.15 mg

Vitamin B6 .................................. 0.5 mg

Vitamin B12 ........................ 0.2 ㎍

Vitamin C .................................. 10 mg

Biotin .................................... 10 ㎍

Nicotinic amide ........................... 1.7 mg

Folic acid ...................................... 50 ㎍

Calcium pantothenate ............................ 0.5 mg

Mineral mixture ............................

Ferrous sulfate ............................... 1.75 mg

Zinc oxide ................................ 0.82 mg

Magnesium carbonate ............................ 25.3 mg

Potassium Phosphate .............................. 15 mg

Secondary calcium phosphate .............................. 55 mg

Potassium citrate ............................... 90 mg

Calcium carbonate ................................ 100 mg

Magnesium chloride ............................ 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

<Experimental Example 1> Cytotoxicity test for mature adipocytes

1. Experimental Method

The cytotoxicity of the brown goat larvae extract (TME) of Example 1 after differentiation into adipocytes using 3T3-L1 adipose precursor cells (Korean Cell Line Bank) was measured by the MTS method.

The MTS assay was performed after culturing for 72 hours at a concentration (100, 2000 / / ml) of the brown larvae larvae extract (TME) of Example 1. Mate extract (MTE) was used as a control.

MTS reagent (3-4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide) at a final concentration of 0.5 mg / ml and incubated at 37 ° C for additional 4 hours. The amount was measured at 515 nm using a microplate reader (Beckman, USA). Cell viability was expressed as a percentage of the average absorbance value of the control group.

2. Experimental results

As shown in FIG. 1, the cell survival rate of the brown goat larvae extract (TME) of Example 1 treated for 72 hours at a concentration of 100 μg / ml (TME100) and 2000 μg / ml (TME2000) It was confirmed that there was no toxicity.

&Lt; Experimental Example 2 > Measurement of fat cell size and measurement of glycerol amount

1. Experimental Method

To measure adipocyte killing effect and adipocyte size on mature adipocytes, 3T3-L1 adipocytes were plated at a concentration of 5 × 10 ⁴ cells / well in a 24-well plate, After 4 days of incubation, the cells were inoculated with DMEM medium containing insulin (5 μg / ml), 1 μM dexamethasone, 0.5 mM isobutylmethylxanthine and 10% FBS The medium was exchanged, and the medium was replaced twice with the same medium (differentiation induction medium) once every two days, and the differentiation into adipocytes was completed.

After the differentiated cells were treated with the brown goat larvae extract (TME) of Example 1 for 72 hours, oil red O staining was performed to measure the fat cell size, and the size of the fat cells was measured using Multilmage II, Free glycerol assay kit (Biovision) was used to measure the amount of glycerol liberated during degradation.

Mate extract (MTE) was used as a control.

2. Experimental results

3T3-L1 adipose precursor cells were induced to differentiate into mature adipocytes and oil-red O staining was performed to identify the fat produced. As shown in FIG. 2A and FIG. 2B, after the induction of differentiation from 3T3-L1 adipose precursor cells into adipocytes, the brown dung larvae extract (TME) of Example 1 was treated to measure the fat size. TME2000), the size of adipocytes decreased by about 60%.

In addition, as shown in FIG. 3, glycerol released from decomposition of triglyceride in adipocytes was measured. As a result, about 71% of the glycerol release was increased in the 2000 g / ml treatment group of the brown dung larvae extract (TME) .

&Lt; Experimental Example 3 > Measurement of inhibitory effect of adipocyte differentiation and lipogenesis-related gene expression

1. Experimental Method

In order to analyze the expression potential of lipid-synthesizing genes in brown duck, expression patterns of genes involved in expression of adipocyte differentiation and lipogenesis-related transcription factors were examined at the transcript level by real-time PCR .

After completion of the adipocyte differentiation, the test group treated with the brown goat larvae extract (TME) of Example 1 for 72 hours, the positive control group treated with only the differentiation factor, and the lipogenic precursor cells not inducing differentiation were used as the negative control group.

After removing the media from these experimental groups and control cells, the cells were washed with PBS, treated with Trizol reagent, and chloroform was added to the recovered cells. After centrifugation at 12,000 g for 15 minutes, Was added to isopropanol to separate RNA, and cDNA was synthesized at a concentration of 2 μg / ml.

SBRP1c, SCD1, FAS, and SREBP1c, which are transcription factors related to adipocyte differentiation and lipogenesis, were synthesized through real-time PCR device (AB, UK) after mixing Power SYBR Green Mixture and primer using the synthesized cDNA. The expression pattern of LPL gene transcript was examined.

At this time, the primers used are shown in Table 1 below. Expression of genes related to lipid synthesis from epididymal fat was also examined by the same method.

Name Sequence C / EBP alpha CCAAT / enhancer-binding proteins alpha Forward:: AGACATCAGCGCCTACATCG Reverse:: CACCGACTTCTTGGCTTTGC SREBP1c
Sterol regulatory element-binding protein 1 Forward:: GGACACAGCGGTTTTGAACG Reverse:: CTCAGGAGAGTTGGCACCTG SCD1 Stearoyl-coenzyme desaturase-1 Forward:: CACCTGCCTCTTCGGGATTT Reverse:: CTTTGACAGCCGGGTGTTTG FAS Fatty acid synthase Forward:: CTGACTCGGCTACTGACACG Reverse:: GTAGGTGTGTGAGCCGTCAA LPL Lipoprotein lipase Forward:: TCCAGAGTTTGACCGCCTTC Reverse:: ATAATGTTGCTGGGCCCGAT GAPDH Glyceraldehyde-3-phosphate dehydrogenase Forward:: CTACCCCCAATGTGTCCGTC Reverse:: TGAAGTCGCAGGAGACAACC

* GAPDH is a control gene used to compare the expression level of each gene,

2. Experimental results

As shown in FIGS. 4A to 4E, after the adipocyte differentiation, 72 h of the brown goat larva extract (TME) of Example 1 was treated with C / EBPα (CCAAT / enhancer-binding proteins α) It was confirmed that the expression rate of SREBP1c, Stearoyl-coenzyme desaturase-1, FAS (Fatty acid synthase) and LPL (Lipoprotein lipase)

<Experimental Example 4> Weight loss effect by the high-fat diet method and the brown goat larva suspension treatment of Example 2

1. Experimental Method

1) High fat diet (HFD 60% fat contain; Rodent diet D12492, Research diet, New Brunswick, NJ, USA) After induction of obesity through 6 weeks of feeding, the brown goose larvae (TM) The body weight gain was measured by oral administration at 3000 mg / kg / day, and as a control, a matte suspension (MT-Matte was prepared in the same manner as in Example 2) was used.

2) High fat diet (HFD 45% fat contain; Rodent diet D12492, Research diet, New Brunswick, NJ, USA) Induction of obesity The brown goose larva (TM) suspension of Example 2 was administered at 100, 3000 mg / kg / day, and a maturation suspension (MT) was used as a control.

3) The relative weight of the genital weight indicating visceral fat mass was measured, and the size of the epididymal fat and the level of fat deposition in the liver were measured.

4) The level of gene expression was also measured from epididymal adipose tissue for SREBP1c, LPL (lipoprotein lipase) and SCD1 (Stearoyl-coenzyme desaturase-1).

2. Experimental results

1) Measurement of weight loss effect by the treatment of brown goat larva suspension (TM) of Example 2 after induction of obesity by high fat diet

Group Body weight (g) Weight gain (g) Initial Final ND
(Normal diet) 30.04 1.58 50.06 + - 4.26 0.67 ± 0.19 HFD
(High fat diet) 30.4 ± 0.75 72.13 + - 2.43 1.37 + 0.11 HFD + TM100 29.31 + - 0.87 66.06 + - 3.68 1.25 + 0.16 HFD + TM3000 29.6 ± 1.10 60.8 ± 4.56 1.05 + 0.19 HFD + MT3000 30.4 ± 1.62 66.68 ± 1.77 1.20 ± 0.16

After induction of obesity through a high fat diet (HFD 60% fat contain; Rodent diet D12492, Research diet, New Brunswick, NJ, USA), as shown in Table 2, the brown goose larva (TM) suspension of Example 2 , And 3000 mg / kg / day, respectively, the weight gain was decreased by 8% and 23%, respectively, compared with the group fed only with the high fat diet. kg / day, the body weight gain was reduced by about 12%.

2) Measurement of weight loss effect by the treatment of brown goat larva suspension (TM) of Example 2 at the same time inducing obesity by high fat diet method

Group Body weight (g) Weight gain (g) Initial Final ND
(Normal diet) 32.95 ± 1.33 46.07 ± 3.28 0.40 + 0.13 HFD
(High fat diet) 32.01 + - 1.37 56.53 + - 7.64 0.76 + 0.29 HFD + TM100 31.27 ± 1.97 52.23 + - 7.62 0.67 + 0.30 HFD + TM3000 32.75 ± 1.01 52.98 ± 7.99 0.61 0.28 HFD + MT3000 32.10 ± 1.33 45.72 + - 4.74 0.42 ± 0.18

As shown in Table 3, obesity induction via a high fat diet (HFD 45% fat contain; Rodent diet D12492, Research diet, New Brunswick, NJ, USA) , And 3000 mg / kg / day, the oral administration of 3000 mg / kg / day showed a decrease of about 19% in body weight gain compared with the group fed only with high fat diet. It was confirmed that the body weight gain was reduced by about 44% in the group treated with the matte suspension (MT) at a concentration of 3000 mg / kg / day.

Group Relative organ weight (Epididymal fat;%) ND
(Normal diet) 0.177 ± 0.01 HFD
(High fat diet) 0.178 + 0.03 HFD + TM100 0.161 + 0.03 HFD + TM3000 0.146 + 0.02 HFD + MT3000 0.185 + 0.02

As shown in Table 4, when the relative weight of epididymal fat was measured after oral administration of the brown goose larvae (TM) of Example 2 at 100 and 3000 mg / kg / day for 6 weeks, It was confirmed that the weight of fat decreased by 10% and 17% at each concentration when oral administration of 100 mg / kg / day of the larvae larvae suspension.

As shown in FIGS. 5A and 5B, the measurement of the testicular fat size also showed a decrease in the size of fat by about 16% in the group administered orally at 3000 mg / kg / day of the brown goose larvae (TM) suspension of Example 2 .

In addition, as shown in FIG. 6, the degree of liver fat deposition after 6 weeks of treatment with the brown goose larva (TM) 100, 3000 mg / kg / day of Example 2 inducing obesity through a fatty diet was measured, In comparison with the liver of the obesity group induced by this, it was confirmed that the degree of fat deposition was decreased in a concentration-dependent manner in the group administered orally administered with the brown goose larva (TM) of Example 2.

3) Inhibition of adipocyte differentiation-related transcription factors and gene expression from epididymal fat by the treatment of brown goat larva suspension (TM)

7 (A), 7 (C) and 7 (C), high-fat diets (HFD 45% fat contain; Rodent diet D12492, Research diet, New Brunswick, NJ, USA) (LPL) and SCD1 (Stearoyl-coenzyme desaturase-1) from epididymal adipose tissue after oral administration at a dose of 3,000 mg / kg / day. As a result, it was confirmed that the expression level of each gene was significantly lower than that of obesity - induced group.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Claims (9)

(Tenebrio molitor) larvae extract or a brown duck (Tenebrio molitor) larvae suspension as an active ingredient.
A pharmaceutical composition for preventing or treating obesity.
The method according to claim 1,
The brown goose (Tenebrio molitor) larvae extract was characterized by extracting with 70% ethanol as a solvent,
A pharmaceutical composition for preventing or treating obesity.
The method according to claim 1,
The brown duck (Tenebrio molitor) larvae suspension is obtained by dissolving brown larvae (Tenebrio molitor) larvae in water,
A pharmaceutical composition for preventing or treating obesity.
(Tenebrio molitor) larvae extract or a brown duck (Tenebrio molitor) larvae suspension as an active ingredient.
Food composition for preventing or improving obesity.
5. The method of claim 4,
The brown goose (Tenebrio molitor) larvae extract was characterized by extracting with 70% ethanol as a solvent,
Food composition for preventing or improving obesity.
5. The method of claim 4,
The brown duck (Tenebrio molitor) larvae suspension is obtained by dissolving brown larvae (Tenebrio molitor) larvae in water,
Food composition for preventing or improving obesity.
A first step of pulverizing the lyophilized brownish larvae;
A second step of mixing the brown larch larvae powder prepared in the first step with ethanol to prepare a brown goat's mixture liquid;
A third step of micronizing the brown gyoer mixture prepared in the second step with an ultrasonic pulverizer,
And a fourth step of centrifuging the micronized brown gourd mixture liquid in the third step, recovering the supernatant, filtering and then drying the brown gurdic larvae extract to produce an anti-
A method for preparing an extract of brown goat larva having an anti-obesity effect.
A first step of pulverizing the lyophilized brown larvae,
And a second step of dissolving the brown gill larva powder prepared in the first step with water to prepare a brown gill larva suspension having an anti-obesity effect.
A method for preparing a suspension of a larva having an anti-obesity effect.
A method for producing an anti-obesity agent, which comprises an effective amount of a brown goat larva extract prepared by the method of claim 7 or a brown goat larva suspension prepared by the method of claim 8,
Anti-obesity agent.

Images