CN114921463B - Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof - Google Patents

Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof Download PDF

Info

Publication number
CN114921463B
CN114921463B CN202210375080.3A CN202210375080A CN114921463B CN 114921463 B CN114921463 B CN 114921463B CN 202210375080 A CN202210375080 A CN 202210375080A CN 114921463 B CN114921463 B CN 114921463B
Authority
CN
China
Prior art keywords
csiy
coding rna
rna molecule
terpenoid
present disclosure
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210375080.3A
Other languages
Chinese (zh)
Other versions
CN114921463A (en
Inventor
周正富
张维
林敏�
陈梦茹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biotechnology Research Institute of CAAS
Original Assignee
Biotechnology Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biotechnology Research Institute of CAAS filed Critical Biotechnology Research Institute of CAAS
Priority to CN202210375080.3A priority Critical patent/CN114921463B/en
Publication of CN114921463A publication Critical patent/CN114921463A/en
Application granted granted Critical
Publication of CN114921463B publication Critical patent/CN114921463B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present disclosure relates to an artificial non-coding RNA molecule having a nucleotide sequence as shown in SEQ ID NO. 1. The expression of the RNA molecule CsiY in host cells is induced, and the rapid and high-flux gene expression regulation and control can be realized on the premise of not changing chromosome genes.

Description

Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof
Technical Field
The disclosure relates to the technical field of genetic engineering, and in particular relates to an artificial non-coding RNA molecule, a DNA molecule, a recombinant vector, a transformant and application of the artificial non-coding RNA molecule in synthesizing terpenoid.
Background
Terpenes are widely available in nature and are hydrocarbons of the formula multiples of the isoprene unit and oxygen-containing derivatives thereof. The terpenoid found at present exceeds 8 ten thousand, has important pharmacological functions and biological activities, and has great application prospect and commercial value. For example, artemisinin is an important antimalarial drug, taxol can treat cancers, lycopene and lutein have antioxidant effect, and oleanolic acid, ursolic acid and glycyrrhetinic acid play roles in resisting tumors, protecting liver and the like. In addition, nerolidol and patchouli alcohol can be used in the preparation of perfume fragrances and the like.
The natural terpenoid is widely applied to the fields of medicines, health products, foods, cosmetics and energy. The direct extraction or chemical total synthesis of the terpenoid from the natural raw materials has the series of problems of low production efficiency, high cost, serious environmental pollution and the like, and the development of metabolic engineering provides a new way for realizing the production of the terpenoid by microbial fermentation. By utilizing metabolic engineering and synthetic biology, the realization of efficient synthesis of terpenes has become an important research content by constructing synthetic pathways of plant source terpenes in microorganism chassis hosts. The non-coding RNA is used as a novel regulatory factor in a bacterial metabolism regulation network, and has the advantages of rapid response, flexible and accurate control, easy recovery, no metabolic burden and the like. The artificial non-coding RNA is designed, so that rapid and high-flux gene expression regulation and control can be realized on the premise of not changing chromosome genes, and the method has wider application potential in the field of terpenoid biosynthesis.
Disclosure of Invention
In order to further meet the requirements of practical applications, the present disclosure provides artificial non-coding RNA molecules, a DNA molecule, a recombinant vector, a transformant and the application of the artificial non-coding RNA molecules in synthesizing terpenoids, which can improve the synthesis yield of the terpenoids.
In one aspect, the present disclosure provides an artificial non-coding RNA molecule having a nucleotide sequence as set forth in SEQ ID NO. 1.
In another aspect, the present disclosure provides a DNA molecule that transcribes the RNA molecule described above.
According to the present disclosure, the nucleotide sequence of the DNA molecule is shown as SEQ ID NO. 2.
In another aspect, the present disclosure provides a recombinant vector having the above DNA molecule inserted therein.
According to the disclosure, wherein the recombinant vector is a recombinant expression vector; the recombinant expression vector is inserted with an expression frame, and the nucleotide sequence of the expression frame is shown as SEQ ID NO. 3.
In another aspect, the present disclosure provides a transformant, the host cell of which is a genetically engineered bacterium; the gene introduced into the transformant includes the DNA molecule described above, or the recombinant vector introduced into the transformant is the recombinant vector described above.
According to the disclosure, the genetically engineered bacterium is any one of escherichia coli and yeast.
In another aspect, the present disclosure provides the use of an RNA molecule according to the first aspect for the synthesis of terpenoids.
According to the present disclosure, wherein the terpenoid comprises a carotene vitamin K compound, a mint acid compound, a squalene compound.
Through the technical scheme, the invention provides the artificial non-coding RNA molecule, the DNA molecule, the recombinant vector, the transformant and the application of the artificial non-coding RNA molecule in synthesizing the terpenoid, which can improve the synthesis yield of the terpenoid, and can realize rapid and high-flux gene expression regulation and control on the premise of not changing the chromosome genes, thereby obviously improving the synthesis yield of the terpenoid of engineering strains and having wider application potential in the field of the biosynthesis of the terpenoid.
Additional features and advantages of the present disclosure will be set forth in the detailed description which follows.
Drawings
The accompanying drawings are included to provide a further understanding of the disclosure, and are incorporated in and constitute a part of this specification, illustrate the disclosure and together with the description serve to explain, but do not limit the disclosure. In the drawings:
FIG. 1 is a secondary structure diagram of an artificial non-coding RNA molecule CsiY.
FIG. 2 is a diagram of the construction of a recombinant expression vector for an artificial non-coding RNA molecule CsiY.
FIG. 3 shows the expression level of CsiY in BW8-CsiY of the transformant before and after induction.
FIG. 4 is a graph showing the yield test of lutein of interest synthesized in BW8-CsiY transformant constructed in the present disclosure and control strain.
Detailed Description
Specific embodiments of the present disclosure are described in detail below with reference to the accompanying drawings. It should be understood that the detailed description and specific examples, while indicating and illustrating the disclosure, are not intended to limit the disclosure.
The first aspect of the present disclosure provides an artificial non-coding RNA molecule, the nucleotide sequence of which is shown as SEQ ID NO. 1.
In another aspect, the present disclosure provides a DNA molecule that transcribes the RNA molecule described above.
According to the present disclosure, the nucleotide sequence of the DNA molecule is shown as SEQ ID NO. 2.
In another aspect, the present disclosure provides a recombinant vector having the above DNA molecule inserted therein.
According to the disclosure, wherein the recombinant vector is a recombinant expression vector; the recombinant expression vector is inserted with an expression frame, and the nucleotide sequence of the expression frame is shown as SEQ ID NO. 3.
In another aspect, the present disclosure provides a transformant, the host cell of which is a genetically engineered bacterium; the gene introduced into the transformant includes the DNA molecule described above, or the recombinant vector introduced into the transformant is the recombinant vector described above.
According to the disclosure, the genetically engineered bacterium is any one of escherichia coli and saccharomycetes.
In another aspect, the present disclosure provides the use of an RNA molecule according to the first aspect for the synthesis of terpenoids.
According to the present disclosure, wherein the terpenoid comprises a carotene, a vitamin K, a mint, and a squalene.
The present disclosure is further illustrated by the following examples, but the present disclosure is not limited thereby.
Example 1
This example constructs an artificial non-coding RNA element CsiY.
Artificial non-coding RNA regulatory elements are designed using synthetic biology methods. The target regulatory sequences, the pseudomonas hfq stabilizing factor binding sequence and the e.coli rho factor independent transcription terminator sequence were combined. And calculating The free energy of The artificial non-coding RNA molecule by using The Mfold software, and evaluating The stability of The molecule. Predicting the secondary structure of RNA molecule and analyzing the position of target regulating region on artificial non-coding RNA molecule (Web Server: http:// www.unafold.org/mfold/applications/rn a-shaping-form. Php). The regulatory RNA element sequence is shown in SEQ ID NO.1 and designated CsiY.
The total length of the artificial non-coding RNA element CsiY is 89bp, as shown in FIG. 1, and the molecule contains 2 neck ring structures (FIG. 1). The arabinose-inducible promoter was selected to be assembled with the non-coding RNA element CsiY to construct the regulatory module Para-CsiY. The total length of the regulation and control module is 240bp. The designed artificial non-coding RNA element CsiY and the regulation module Para-CsiY are synthesized by a chemical synthesis method.
Example 2
This example constructs transformants expressing artificial non-coding RNA molecules.
Coli expression vector pBAD: purchased from vast organism under the trade designation P0079;
cloning of E.coli DH 5. Alpha: commercial number CW0808 from kang century;
engineering strain bw_8: for this laboratory preservation, it was prepared according to the method described in document CN113943745 a.
And designing a primer amplification target non-coding RNA regulation module Para-CsiY by taking the chemically synthesized module sequence as a template. The arabinose-inducible promoter was assembled with the non-coding RNA element CsiY to construct the regulatory module Para-CsiY.
Amplification primers:
CsiY-F：AAGCTTTTTGTTACCGCCGGCGCA SEQ ID NO.4，
CsiY-R：AAGCTTAAAAAAGCTGCGCGTGTA SEQ ID NO.5；
the vector was digested with HindIII site of pBAD vector, and the vector fragment was recovered. And simultaneously, enzyme cutting the Para-CsiY fragment of the obtained regulation module by PCR amplification, and cutting glue to recover the target fragment. The target fragment was ligated with the vector fragment at room temperature to construct the fusion expression vector pBAD-CsiY (FIG. 2), and competent cells DH 5. Alpha. Were transformed. And the correct sequence was verified by PCR sequencing.
Recombinant cells sequenced correctly were inoculated in LB medium and cultured for 12 hours. The recombinant plasmid pBAD-CsiY was extracted using the kit for subsequent studies.
Preparing competent cells of the engineering strain BW_8 for lutein biosynthesis of escherichia coli, and converting the constructed recombinant plasmid pBAD-CsiY of the regulation module into the engineering strain BW_8 for lutein biosynthesis of terpenoid by a heat shock method. And (5) selecting recombinant strains, and carrying out PCR screening verification. The correct recombinant strain was named BW8-CsiY.
The expression of the non-coding RNA element CsiY in the host bacteria is induced by using arabinose as a signaling molecule. The expression of CsiY was detected by real-time quantitative PCR.
Real-time quantitative PCR primers:
RT-csiY-F：GTATGGATTTCTGGCTGGCG SEQ ID NO.6，
RT-csiY-R：TCGTGGTTCCTGGACTTTGT SEQ ID NO.7；
the expression frame Para-CsiY is transformed into lutein biosynthesis engineering strain BW_8, and the recombinant strain BW8-CsiY is constructed. The real-time quantitative PCR results showed that the non-coding RNA element CsiY was able to induce expression in the recombinant strain BW8-CsiY, up-regulated by more than 15-fold (FIG. 3).
Example 3
This example was used for functional identification of the artificial non-coding RNA regulatory element CsiY.
Engineering strain bw_8: for this laboratory preservation, prepared according to the method in document CN113943745 a; engineering strain BW8-CsiY: inventive example 2 was constructed.
The experimental method comprises the following steps: and (3) selecting the correct engineering bacteria BW8-CsiY and the control strain BW_8, inoculating the engineering bacteria BW8-CsiY and the control strain BW_8 into an LB liquid culture medium, and performing shake culture for 18 hours to activate the strain. Transferring the seed solution into new 300mL LB liquid medium at 1% concentration, shake culturing at 37deg.C and 220rpm under dark condition until the OD of the bacterial solution is reached 600 When the light absorption value reaches 0.6-0.8, L-arabinose with the final concentration of 2 per mill is added for induction, and the culture is carried out for 24 hours at 37 ℃ in a dark shaking way.
And (5) centrifuging for 10min to collect the thalli. The thalli are resuspended in acetone solution and extracted by shaking for 10min. Centrifuge for 10min and transfer the supernatant extract to a new centrifuge tube. Adding ethyl acetate solution into the thalli, vibrating and extracting for 10min, and centrifuging for 10min. Mixing the supernatant with acetone extract, adding sterile water, and shaking. Centrifuging for 10min, layering the liquid, and sucking the upper liquid into a new centrifuge tube.
Evaporating the extract to dryness to obtain carotenoid compound sample, and dissolving the sample with chromatographic pure methanol for HPLC analysis and detection. HPLC analysis conditions: kromasil-C18 column (4.6 ﹡ nm,5 μm), mobile phase methanol-acetonitrile-water (80:15:5, V/V/V), scanning wavelength: 200nm-600nm, detection wavelengths 440nm,450nm,470 nm. The flow rate is 1mL/min, the column temperature is 25 ℃, and the sample injection amount is 10 mu L.
The original engineering strain BW_8 is used as a control, and the recombinant engineering strain BW8-CsiY of the expression frame Para-CsiY is used as a control. And using arabinose as a signal molecule to induce the engineering strain BW8-CsiY to express CsiY and synthesize lutein. The product compounds were collected and analyzed by High Performance Liquid Chromatography (HPLC) for quantitative comparison of the lutein yield synthesized by the engineering strain BW8-CsiY and the control strain BW_8. The research result shows (figure 4) that the peak area of the lutein of the target terpenoid synthesized by the control strain BW_8 is 52.90273, and the peak area of the lutein of the target synthesized by the engineering strain BW8-CsiY constructed by the patent is 363.0685. The result shows that the expression of the artificial non-coding RNA element CsiY can improve the yield of the carotenoid compound synthesized by the engineering strain by 6.8 times.
Therefore, the artificial non-coding RNA regulatory element CsiY designed by the invention can obviously improve the synthesis yield of the terpenoid of the engineering strain.
The preferred embodiments of the present disclosure have been described in detail above with reference to the accompanying drawings, but the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solutions of the present disclosure within the scope of the technical concept of the present disclosure, and all the simple modifications belong to the protection scope of the present disclosure.
In addition, the specific features described in the foregoing embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, the present disclosure does not further describe various possible combinations.
Moreover, any combination between the various embodiments of the present disclosure is possible as long as it does not depart from the spirit of the present disclosure, which should also be construed as the disclosure of the present disclosure.
Sequence listing
<110> institute of biotechnology of national academy of agricultural sciences
<120> an artificial non-coding RNA molecule CsiY for regulating the synthesis yield of terpenoids and its use
<130> 24949CAAS-B-ZW
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 89
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cauggccucu ccuuuuugau aagucccaca aucgcacaac aacaauaaca aaagaaacgg 60
cuccagcaag cuacacgcgc agcuuuuuu 89
<210> 2
<211> 89
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
catggcctct cctttttgat aagtcccaca atcgcacaac aacaataaca aaagaaacgg 60
ctccagcaag ctacacgcgc agctttttt 89
<210> 3
<211> 240
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
tttgttaccg ccggcgcatc gttcgtaaca aaaaccggga gcatcggtaa cgacgccccg 60
gttttttctt gccttccgcc aagcctggaa atcacaactc attgaaatat aacgatttcc 120
taaaactggc acggcaactg cttacctaat gcatggcctc tcctttttga taagtcccac 180
aatcgcacaa caacaataac aaaagaaacg gctccagcaa gctacacgcg cagctttttt 240
<210> 4
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
aagctttttg ttaccgccgg cgca 24
<210> 5
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
aagcttaaaa aagctgcgcg tgta 24
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
gtatggattt ctggctggcg 20
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
tcgtggttcc tggactttgt 20

Claims (9)

1. An artificial non-coding RNA molecule, which is characterized in that the nucleotide sequence of the RNA molecule is shown as SEQ ID NO. 1.
2. A DNA molecule which transcribes the RNA molecule of claim 1.
3. The DNA molecule of claim 2, wherein the nucleotide sequence of the DNA molecule is set forth in SEQ ID No. 2.
4. A recombinant vector into which the DNA molecule of claim 2 or 3 has been inserted.
5. The recombinant vector according to claim 4, wherein the recombinant vector is a recombinant expression vector; the recombinant expression vector is inserted with an expression frame, and the nucleotide sequence of the expression frame is shown as SEQ ID NO. 3.
6. A transformant, characterized in that the host cell of the transformant is a genetically engineered bacterium; the gene introduced into the transformant comprises the DNA molecule of claim 2 or 3, or the recombinant vector introduced into the transformant is the recombinant vector of claim 4 or 5.
7. The transformant according to claim 6, wherein the genetically engineered bacterium is any one of E.coli and yeast.
8. Use of the RNA molecule of claim 1 for the synthesis of terpenoids.
9. The use according to claim 8, wherein the terpenoid comprises carotenes, vitamin K, menthol, squalene.
CN202210375080.3A 2022-04-11 2022-04-11 Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof Active CN114921463B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210375080.3A CN114921463B (en) 2022-04-11 2022-04-11 Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210375080.3A CN114921463B (en) 2022-04-11 2022-04-11 Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof

Publications (2)

Publication Number Publication Date
CN114921463A CN114921463A (en) 2022-08-19
CN114921463B true CN114921463B (en) 2023-12-01

Family

ID=82804611

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210375080.3A Active CN114921463B (en) 2022-04-11 2022-04-11 Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof

Country Status (1)

Country Link
CN (1) CN114921463B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019067621A1 (en) * 2017-09-26 2019-04-04 Nextbiotics, Inc. Compositions and methods of a crispr genetic system to sensitize and/or eliminate target bacteria
CN110869500A (en) * 2017-01-26 2020-03-06 马努斯生物合成股份有限公司 Metabolic engineering for microbial production of terpenoid products
CN110945125A (en) * 2017-06-06 2020-03-31 齐默尔根公司 HTP genetic engineering modification platform for improving escherichia coli
CN113604374A (en) * 2021-08-20 2021-11-05 浙江大学 Genetically engineered bacterium for efficiently producing carotenoid and construction method and application thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5362350B2 (en) * 2005-04-15 2013-12-11 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア Small molecule activated RNA molecules and methods of use
EP2571991A1 (en) * 2010-05-20 2013-03-27 Evolva SA Method of producing isoprenoid compounds in yeast
WO2020171227A1 (en) * 2019-02-22 2020-08-27 Ajinomoto Co., Inc. METHOD FOR PRODUCING L-AMINO ACIDS USING A BACTERIUM BELONGING TO THE FAMILY Enterobacteriaceae HAVING OVEREXPRESSED ydiJ GENE
CN110894533B (en) * 2019-11-21 2022-03-29 中日友好医院 Nucleic acid reagent, kit and system for detecting lower respiratory tract infectious bacteria
CN113943745A (en) * 2021-10-15 2022-01-18 中国农业科学院生物技术研究所 Synthesis method and application of deinococcus xanthophyll

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110869500A (en) * 2017-01-26 2020-03-06 马努斯生物合成股份有限公司 Metabolic engineering for microbial production of terpenoid products
CN110945125A (en) * 2017-06-06 2020-03-31 齐默尔根公司 HTP genetic engineering modification platform for improving escherichia coli
WO2019067621A1 (en) * 2017-09-26 2019-04-04 Nextbiotics, Inc. Compositions and methods of a crispr genetic system to sensitize and/or eliminate target bacteria
CN113604374A (en) * 2021-08-20 2021-11-05 浙江大学 Genetically engineered bacterium for efficiently producing carotenoid and construction method and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
"Genome-wide screening identifies promiscuous phosphatases impairing terpenoid biosynthesis in Escherichia coli;Tianmin Wang等;Applied Microbiology and Biotechnology;第1-10页 *
Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs;Dokyun Na等;nature biotechnology;第1-7页 *

Also Published As

Publication number Publication date
CN114921463A (en) 2022-08-19

Similar Documents

Publication Publication Date Title
CN109988722B (en) Recombinant saccharomyces cerevisiae strain, application thereof and method for producing tyrosol and/or salidroside
CN107287272A (en) A kind of preparation method of Tauro ursodesoxy cholic acid
CN111205993B (en) Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof
CN109777815A (en) HMG-CoA synthase gene RKHMGCS and its application
CN111454854A (en) Rhodosporidium toruloides gene engineering strain for producing astaxanthin
CN114058525A (en) High-yield squalene genetic engineering bacterium and construction method and application thereof
CN116987603A (en) Recombinant saccharomyces cerevisiae strain for high yield of cannabigerolic acid as well as construction method and application thereof
CN108315343A (en) A kind of method for synthesizing gene of production cyanidenon yeast strain and bacterial strain and application
CN114107078A (en) High-yield valencene genetic engineering bacterium and construction method and application thereof
CN104830888B (en) A kind of new new gold mycobacteria expression system and its application in transformation phytosterin synthesizes ADD
CN114921463B (en) Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof
CN103773704B (en) A kind of method utilizing O-methyltransgerase biosynthesizing red sandalwood celery
CN114921465B (en) Regulatory element CsiZ and application thereof in improvement of synthetic yield of terpenoid
CN114921464B (en) Artificial non-coding RNA molecule CsiX for regulating and controlling synthesis yield of carotene compounds and application thereof
CN110305855A (en) Rhizoma Gastrodiae GeCPR gene and its application
CN110317765B (en) Escherichia coli expression strain for high-yield geraniol glucoside and application thereof
CN116731886A (en) Engineering bacterium for producing glycosylated astaxanthin as well as construction method and application thereof
CN116042425A (en) Yeast engineering bacteria for producing patchouli alcohol and application thereof
CN113249240B (en) Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof
CN113969288A (en) High-yield farnesol gene engineering bacterium and construction method and application thereof
CN114891707A (en) Recombinant strain and method for producing bilirubin through whole-cell catalysis of recombinant strain
CN110951760B (en) Protein time-delay expression switch and application thereof in production of glucaric acid
CN107880134A (en) A kind of method of enzyme&#39; s catalysis Kaempferol
CN113817757A (en) Recombinant yeast engineering strain for producing cherry glycoside and application
CN114107354A (en) Method for constructing genetic engineering strain for stably-inherited efficient biosynthesis of beta-arbutin and application of genetic engineering strain

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant