CN114921463A - Artificial non-coding RNA molecule CsiY for regulating and controlling terpenoid synthesis yield and application thereof - Google Patents

Artificial non-coding RNA molecule CsiY for regulating and controlling terpenoid synthesis yield and application thereof Download PDF

Info

Publication number
CN114921463A
CN114921463A CN202210375080.3A CN202210375080A CN114921463A CN 114921463 A CN114921463 A CN 114921463A CN 202210375080 A CN202210375080 A CN 202210375080A CN 114921463 A CN114921463 A CN 114921463A
Authority
CN
China
Prior art keywords
csiy
rna molecule
coding rna
transformant
artificial
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210375080.3A
Other languages
Chinese (zh)
Other versions
CN114921463B (en
Inventor
周正富
张维
林敏�
陈梦茹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biotechnology Research Institute of CAAS
Original Assignee
Biotechnology Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biotechnology Research Institute of CAAS filed Critical Biotechnology Research Institute of CAAS
Priority to CN202210375080.3A priority Critical patent/CN114921463B/en
Publication of CN114921463A publication Critical patent/CN114921463A/en
Application granted granted Critical
Publication of CN114921463B publication Critical patent/CN114921463B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The disclosure relates to an artificial non-coding RNA molecule, and the nucleotide sequence of the RNA molecule is shown as SEQ ID NO. 1. The expression of the RNA molecule CsiY in host cells is induced, and the rapid and high-flux gene expression regulation can be realized on the premise of not changing chromosome genes.

Description

Artificial non-coding RNA molecule CsiY for regulating and controlling terpenoid synthesis yield and application thereof
Technical Field
The disclosure relates to the technical field of genetic engineering, in particular to an artificial non-coding RNA molecule, a DNA molecule, a recombinant vector, a transformant and application of the artificial non-coding RNA molecule in synthesizing terpenoid.
Background
Terpenoids widely occur in nature and are hydrocarbons and their oxygenated derivatives with molecular formulas that are multiples of isoprene units. More than 8 thousands of terpenoids discovered at present have important pharmacological functions and biological activities, and have huge application prospects and commercial values. For example, artemisinin is an important antimalarial drug, paclitaxel can treat cancer, lycopene and lutein have antioxidant effects, and oleanolic acid, ursolic acid and glycyrrhetinic acid play a role in resisting tumors, protecting liver and the like. In addition, nerolidol and patchouli alcohol can be used in the preparation of perfume perfumes and the like.
The natural terpenoid is widely applied to the fields of medicines, health products, foods, cosmetics and energy. Terpenoids are directly extracted from natural raw materials or chemically and fully synthesized, so that the series of problems of low production efficiency, high cost, serious environmental pollution and the like exist, and the development of metabolic engineering provides a new way for producing terpenoid components by microbial fermentation. The realization of efficient synthesis of terpenes by constructing a synthetic pathway of plant source terpenes in a microbial chassis host by utilizing metabolic engineering and synthetic biology has become an important research content. The non-coding RNA is used as a novel regulation factor in a bacterial metabolism regulation network, and has the advantages of rapid response, flexible and accurate control, easy recovery, no metabolic burden and the like. The design of artificial non-coding RNA can realize rapid and high-flux gene expression regulation and control on the premise of not changing chromosome genes, and has wider application potential in the field of terpenoid biosynthesis.
Disclosure of Invention
In order to further meet the requirements of practical application, the disclosure provides an artificial non-coding RNA molecule, a DNA molecule, a recombinant vector, a transformant and application of the artificial non-coding RNA molecule in synthesizing terpenoids, wherein the artificial non-coding RNA molecule can improve the synthetic yield of the terpenoids.
In one aspect, the present disclosure provides an artificial non-coding RNA molecule, the nucleotide sequence of which is shown in SEQ ID No. 1.
In another aspect, the present disclosure provides a DNA molecule that transcribes the RNA molecule described above.
According to the disclosure, the nucleotide sequence of the DNA molecule is shown in SEQ ID NO. 2.
In another aspect, the present disclosure provides a recombinant vector having the above-described DNA molecule inserted therein.
According to the present disclosure, wherein the recombinant vector is a recombinant expression vector; the recombinant expression vector is inserted with an expression frame, and the nucleotide sequence of the expression frame is shown as SEQ ID NO. 3.
In another aspect, the present disclosure provides a transformant, a host cell of which is a genetically engineered bacterium; the gene introduced into the transformant includes the above-described DNA molecule, or the recombinant vector introduced into the transformant is the above-described recombinant vector.
According to the disclosure, the genetically engineered bacterium is any one of escherichia coli and yeast.
In another aspect, the present disclosure provides the use of an RNA molecule according to the first aspect for the synthesis of a terpenoid.
According to the present disclosure, the terpenoids include carotene compounds, vitamin K compounds, menthoic acid compounds, and squalene compounds.
Through the technical scheme, the artificial non-coding RNA molecule, the DNA molecule, the recombinant vector, the transformant and the application of the artificial non-coding RNA molecule in terpenoid synthesis are capable of improving the terpenoid synthesis yield, and rapid and high-flux gene expression regulation and control are realized on the premise of not changing chromosome genes, so that the synthesis yield of terpenoids of engineering strains is remarkably improved, and the application potential in the field of terpenoid biosynthesis is wider.
Additional features and advantages of the present disclosure will be set forth in the detailed description which follows.
Drawings
The accompanying drawings, which are included to provide a further understanding of the disclosure and are incorporated in and constitute a part of this specification, illustrate embodiments of the disclosure and together with the description serve to explain the disclosure, but do not constitute a limitation of the disclosure. In the drawings:
FIG. 1 is a secondary structural diagram of an artificial noncoding RNA molecule CsiY.
FIG. 2 is a diagram of the construction of a recombinant expression vector for an artificial noncoding RNA molecule CsiY.
FIG. 3 shows the expression levels of CsiY before and after induction in transformant BW 8-CsiY.
FIG. 4 is a graph showing the test of the yield of target xanthophyll synthesized in the transformant BW8-CsiY constructed according to the present disclosure and a control strain.
Detailed Description
The following detailed description of specific embodiments of the present disclosure is provided in connection with the accompanying drawings. It should be understood that the detailed description and specific examples, while indicating the present disclosure, are given by way of illustration and explanation only, not limitation.
The first aspect of the present disclosure provides an artificial non-coding RNA molecule, the nucleotide sequence of which is shown in SEQ ID No. 1.
In another aspect, the present disclosure provides a DNA molecule that transcribes the RNA molecule described above.
According to the disclosure, the nucleotide sequence of the DNA molecule is shown in SEQ ID NO. 2.
In another aspect, the present disclosure provides a recombinant vector having the above-described DNA molecule inserted therein.
According to the present disclosure, wherein the recombinant vector is a recombinant expression vector; the recombinant expression vector is inserted with an expression frame, and the nucleotide sequence of the expression frame is shown as SEQ ID NO. 3.
In another aspect, the present disclosure provides a transformant, a host cell of which is a genetically engineered bacterium; the gene introduced into the transformant includes the above-described DNA molecule, or the recombinant vector introduced into the transformant is the above-described recombinant vector.
According to the present disclosure, the genetically engineered bacterium is any one of escherichia coli and yeast.
In another aspect, the present disclosure provides the use of the RNA molecule of the first aspect in the synthesis of a terpenoid.
According to the present disclosure, wherein the terpenoids include carotenes, vitamin K, menthanoids and squalene.
The present disclosure is further illustrated by the following examples, but is not to be construed as being limited thereby.
Example 1
This example constructs an artificial non-coding RNA element CsiY.
An artificial non-coding RNA regulatory element is designed by utilizing a synthetic biology method. The target regulatory sequence, the Pseudomonas hfq stabilizing factor binding sequence and the E.coli rho factor-independent transcription terminator sequence were combined. And (3) calculating The free energy of The artificial non-coding RNA molecule by using The MFold software, and evaluating The stability of The molecule. Predicting the secondary structure of the RNA molecule, and analyzing the position of a target regulatory region on the artificial non-coding RNA molecule (Web Server: http:// www.unafold.org/mfold/applications/rn a-folding-form. The sequence of the component for constructing the regulatory RNA is shown in SEQ ID NO.1 and is named CsiY.
The artificial noncoding RNA element CsiY has a total length of 89bp, and as shown in FIG. 1, the molecule contains 2 neck-ring structures (FIG. 1). And (3) selectively assembling the arabinose-induced promoter and the non-coding RNA element CsiY to construct a regulation module Para-CsiY. The total length of the regulatory module is 240 bp. The designed artificial non-coding RNA element CsiY and the regulation module Para-CsiY are synthesized by a chemical synthesis method.
Example 2
This example constructs transformants expressing the artificial non-coding RNA molecule.
Coli expression vector pBAD: purchased from vast Ling Bio, and having a commercial product number of P0079;
cloning of E.coli DH5 α: purchased from Shuiyukang as a century, and the commercial product number is CW 0808;
engineering strain BW _ 8: for the laboratory preservation, it was prepared according to the method of document CN 113943745A.
And (3) designing a primer to amplify a target non-coding RNA regulation and control module Para-CsiY by taking a chemically synthesized module sequence as a template. And (3) assembling the arabinose-induced promoter and the non-coding RNA element CsiY to construct a regulation module Para-CsiY.
An amplification primer:
CsiY-F：AAGCTTTTTGTTACCGCCGGCGCA SEQ ID NO.4，
CsiY-R：AAGCTTAAAAAAGCTGCGCGTGTA SEQ ID NO.5；
the HindIII site of the pBAD vector is used for carrying out enzyme digestion on the vector, and the vector fragment is recovered. Meanwhile, the regulation and control module Para-CsiY fragment obtained by enzyme digestion PCR amplification is cut, and the target fragment is recovered by cutting glue. The target fragment was ligated with the vector fragment at room temperature to construct a fusion expression vector pBAD-CsiY (FIG. 2), and competent cell DH 5. alpha. was transformed. And the correct sequence was verified by PCR sequencing.
The recombinant daughter cells with correct sequencing are inoculated in an LB culture medium and cultured for 12 hours. The recombinant plasmid pBAD-CsiY is extracted by using the kit and used for subsequent research.
Preparing competent cells of the escherichia coli lutein biosynthesis engineering strain BW _8, and converting the constructed regulatory module recombinant plasmid pBAD-CsiY into the terpenoid lutein biosynthesis engineering strain BW _8 by a heat shock method. And (4) picking the recombinant strains, and performing PCR screening verification. The correct recombinant strain was named BW 8-CsiY.
Arabinose is used as a signal molecule to induce the expression of the non-coding RNA element CsiY in the host bacteria. The expression of CsiY was detected by real-time quantitative PCR.
Real-time quantitative PCR primers:
RT-csiY-F：GTATGGATTTCTGGCTGGCG SEQ ID NO.6，
RT-csiY-R：TCGTGGTTCCTGGACTTTGT SEQ ID NO.7；
and (3) transforming the expression frame Para-CsiY into a lutein biosynthesis engineering strain BW _8 to construct a recombinant strain BW 8-CsiY. The real-time quantitative PCR result shows that the non-coding RNA element CsiY can induce the expression in the recombinant strain BW8-CsiY, and the expression is up-regulated by more than 15 times (figure 3).
Example 3
This example was used for functional characterization of the artificial noncoding RNA regulatory element CsiY.
Engineering strain BW _ 8: for the laboratory preservation, the preparation was carried out according to the method described in document CN 113943745A; engineering strain BW 8-CsiY: inventive example 2 was constructed.
The experimental method comprises the following steps: selecting correct engineering bacteria BW8-CsiY and a reference strain BW _8 for inoculationThe strain is planted into LB liquid culture medium, and the activated strain is cultured for 18h by shaking. Transferring the seed solution to a new 300mL LB liquid culture medium according to the concentration of 1%, shaking and culturing at 37 ℃ and 220rpm in a dark place until the OD of the bacterial solution 600 When the light absorption value reaches 0.6-0.8, adding L-arabinose with final concentration of 2 per mill for induction, and performing shaking culture at 37 ℃ in the dark for 24 h.
And (4) centrifuging for 10min to collect thalli. The acetone solution re-suspended the cells, and shake extracted for 10 min. Centrifuge for 10min and transfer the supernatant extract to a fresh centrifuge tube. Adding ethyl acetate solution into the thallus, shaking and extracting for 10min, and centrifuging for 10 min. Mixing the supernatant with acetone extract, adding sterile water, shaking and mixing. Centrifuging for 10min to separate the liquid layers, and sucking the upper liquid layer into a new centrifuge tube.
Evaporating the extract to dryness to obtain carotenoid compound sample, and dissolving the sample with chromatographically pure methanol for HPLC analysis and detection. Conditions for HPLC analysis: Kromasil-C18 column (4.6 ﹡ 250nm, 5 μm), mobile phase methanol-acetonitrile-water (80:15:5, V/V/V), scanning wavelength: 200nm-600nm, and detection wavelengths of 440nm, 450nm, 470nm and 478 nm. The flow rate is 1mL/min, the column temperature is 25 ℃, and the sample injection amount is 10 mu L.
And (3) expressing the recombinant engineering bacteria BW8-CsiY of the frame Para-CsiY by taking the original engineering strain BW _8 as a reference. Arabinose is used as a signal molecule to induce the engineering strain BW8-CsiY to express CsiY and simultaneously synthesize lutein. The product compounds were collected and analyzed by High Performance Liquid Chromatography (HPLC) for quantitative comparative analysis of the yield of lutein synthesized by the engineered strain BW8-CsiY and the control strain BW _ 8. The research result shows (fig. 4) that the peak area of the target terpenoid lutein synthesized by the control strain BW _8 is 52.90273, while the peak area of the target lutein synthesized by the engineering strain BW8-CsiY constructed in the patent is 363.0685. The result shows that the expression of the artificial non-coding RNA element CsiY can improve the yield of the carotenoid compound synthesized by the engineering strain by 6.8 times.
Therefore, the artificial non-coding RNA regulatory element CsiY designed by the invention can obviously improve the synthetic yield of the terpenoid of the engineering strain.
The preferred embodiments of the present disclosure are described in detail with reference to the accompanying drawings, however, the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present disclosure within the technical idea of the present disclosure, and these simple modifications all belong to the protection scope of the present disclosure.
It should be noted that, in the foregoing embodiments, various features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various combinations that are possible in the present disclosure are not described again.
In addition, any combination of various embodiments of the present disclosure may be made, and the same should be considered as the disclosure of the present disclosure as long as it does not depart from the gist of the present disclosure.
Sequence listing
<110> institute of biotechnology of Chinese academy of agricultural sciences
<120> artificial non-coding RNA molecule CsiY for regulating and controlling terpenoid synthesis yield and application thereof
<130> 24949CAAS-B-ZW
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 89
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cauggccucu ccuuuuugau aagucccaca aucgcacaac aacaauaaca aaagaaacgg 60
cuccagcaag cuacacgcgc agcuuuuuu 89
<210> 2
<211> 89
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
catggcctct cctttttgat aagtcccaca atcgcacaac aacaataaca aaagaaacgg 60
ctccagcaag ctacacgcgc agctttttt 89
<210> 3
<211> 240
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tttgttaccg ccggcgcatc gttcgtaaca aaaaccggga gcatcggtaa cgacgccccg 60
gttttttctt gccttccgcc aagcctggaa atcacaactc attgaaatat aacgatttcc 120
taaaactggc acggcaactg cttacctaat gcatggcctc tcctttttga taagtcccac 180
aatcgcacaa caacaataac aaaagaaacg gctccagcaa gctacacgcg cagctttttt 240
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aagctttttg ttaccgccgg cgca 24
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aagcttaaaa aagctgcgcg tgta 24
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtatggattt ctggctggcg 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tcgtggttcc tggactttgt 20

Claims (9)

1. An artificial non-coding RNA molecule, which is characterized in that the nucleotide sequence of the RNA molecule is shown as SEQ ID NO. 1.
2. A DNA molecule that transcribes the RNA molecule of claim 1.
3. The DNA molecule of claim 2, wherein the nucleotide sequence of the DNA molecule is shown in SEQ ID No. 2.
4. A recombinant vector having the DNA molecule of claim 2 or 3 inserted therein.
5. The recombinant vector according to claim 4, wherein the recombinant vector is a recombinant expression vector; the recombinant expression vector is inserted with an expression frame, and the nucleotide sequence of the expression frame is shown as SEQ ID NO. 3.
6. A transformant, characterized in that a host cell of the transformant is a genetically engineered bacterium; the gene introduced into the transformant includes the DNA molecule of claim 2 or 3, or the recombinant vector introduced into the transformant is the recombinant vector of claim 4 or 5.
7. The transformant according to claim 6, wherein the genetically engineered bacterium is any one of Escherichia coli and yeast.
8. Use of the RNA molecule of claim 1 for the synthesis of terpenoids.
9. Use according to claim 8, wherein the terpenoids comprise carotenes, vitamin K compounds, mentholates, squalene-like compounds.
CN202210375080.3A 2022-04-11 2022-04-11 Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof Active CN114921463B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210375080.3A CN114921463B (en) 2022-04-11 2022-04-11 Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210375080.3A CN114921463B (en) 2022-04-11 2022-04-11 Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof

Publications (2)

Publication Number Publication Date
CN114921463A true CN114921463A (en) 2022-08-19
CN114921463B CN114921463B (en) 2023-12-01

Family

ID=82804611

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210375080.3A Active CN114921463B (en) 2022-04-11 2022-04-11 Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof

Country Status (1)

Country Link
CN (1) CN114921463B (en)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100210707A1 (en) * 2005-04-15 2010-08-19 Longcheng Li Small Activating RNA Molecules and Methods of Use
US20130137138A1 (en) * 2010-05-20 2013-05-30 Jorgen Hansen Method of producing isoprenoid compounds in yeast
US20180216137A1 (en) * 2017-01-26 2018-08-02 Manus Bio, Inc. Metabolic engineering for microbial production of terpenoid products
WO2019067621A1 (en) * 2017-09-26 2019-04-04 Nextbiotics, Inc. Compositions and methods of a crispr genetic system to sensitize and/or eliminate target bacteria
CN110894533A (en) * 2019-11-21 2020-03-20 北京卓诚惠生生物科技股份有限公司 Nucleic acid reagent, kit and system for detecting lower respiratory tract infectious bacteria
CN110945125A (en) * 2017-06-06 2020-03-31 齐默尔根公司 HTP genetic engineering modification platform for improving escherichia coli
WO2020171227A1 (en) * 2019-02-22 2020-08-27 Ajinomoto Co., Inc. METHOD FOR PRODUCING L-AMINO ACIDS USING A BACTERIUM BELONGING TO THE FAMILY Enterobacteriaceae HAVING OVEREXPRESSED ydiJ GENE
CN113604374A (en) * 2021-08-20 2021-11-05 浙江大学 Genetically engineered bacterium for efficiently producing carotenoid and construction method and application thereof
CN113943745A (en) * 2021-10-15 2022-01-18 中国农业科学院生物技术研究所 Synthesis method and application of deinococcus xanthophyll

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100210707A1 (en) * 2005-04-15 2010-08-19 Longcheng Li Small Activating RNA Molecules and Methods of Use
US20130137138A1 (en) * 2010-05-20 2013-05-30 Jorgen Hansen Method of producing isoprenoid compounds in yeast
US20180216137A1 (en) * 2017-01-26 2018-08-02 Manus Bio, Inc. Metabolic engineering for microbial production of terpenoid products
CN110869500A (en) * 2017-01-26 2020-03-06 马努斯生物合成股份有限公司 Metabolic engineering for microbial production of terpenoid products
CN110945125A (en) * 2017-06-06 2020-03-31 齐默尔根公司 HTP genetic engineering modification platform for improving escherichia coli
WO2019067621A1 (en) * 2017-09-26 2019-04-04 Nextbiotics, Inc. Compositions and methods of a crispr genetic system to sensitize and/or eliminate target bacteria
WO2020171227A1 (en) * 2019-02-22 2020-08-27 Ajinomoto Co., Inc. METHOD FOR PRODUCING L-AMINO ACIDS USING A BACTERIUM BELONGING TO THE FAMILY Enterobacteriaceae HAVING OVEREXPRESSED ydiJ GENE
CN110894533A (en) * 2019-11-21 2020-03-20 北京卓诚惠生生物科技股份有限公司 Nucleic acid reagent, kit and system for detecting lower respiratory tract infectious bacteria
CN113604374A (en) * 2021-08-20 2021-11-05 浙江大学 Genetically engineered bacterium for efficiently producing carotenoid and construction method and application thereof
CN113943745A (en) * 2021-10-15 2022-01-18 中国农业科学院生物技术研究所 Synthesis method and application of deinococcus xanthophyll

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DOKYUN NA等: "Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs", NATURE BIOTECHNOLOGY, pages 1 - 7 *
NIU FU-XING等: "Genomic and transcriptional changes in response to pinene tolerance and overproduction in evolved Escherichia coli", SYNTHETIC AND SYSTEMS BIOTECHNOLOGY, vol. 4, pages 113 *
TIANMIN WANG等: ""Genome-wide screening identifies promiscuous phosphatases impairing terpenoid biosynthesis in Escherichia coli", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, pages 1 - 10 *

Also Published As

Publication number Publication date
CN114921463B (en) 2023-12-01

Similar Documents

Publication Publication Date Title
Georgiev et al. Bioprocessing of plant cell cultures for mass production of targeted compounds
CN109988722B (en) Recombinant saccharomyces cerevisiae strain, application thereof and method for producing tyrosol and/or salidroside
CN107287272A (en) A kind of preparation method of Tauro ursodesoxy cholic acid
Xue et al. Functional expression of an Arabidopsis p450 enzyme, p-coumarate-3-hydroxylase, in the cyanobacterium Synechocystis PCC 6803 for the biosynthesis of caffeic acid
CN111575310B (en) Recombinant saccharomyces cerevisiae expressing caveolin and application thereof
CN109777815A (en) HMG-CoA synthase gene RKHMGCS and its application
CN113430215A (en) Acetyl CoA synthetase gene RKACS1 and application thereof
CN114058525A (en) High-yield squalene genetic engineering bacterium and construction method and application thereof
CN114107078A (en) High-yield valencene genetic engineering bacterium and construction method and application thereof
CN104830888A (en) New mycobacterium neoaurum expression system and application thereof in conversion of phytosterol for synthesis of ADD
Kang et al. Biosynthesis of resveratrol in blastospore of the macrofungus Tremella fuciformis
CN114921463B (en) Artificial non-coding RNA molecule CsiY for regulating and controlling synthesis yield of terpenoid and application thereof
CN117229934A (en) Genetically engineered bacterium for synthesizing carotenoid, construction method and application thereof
CN114921464B (en) Artificial non-coding RNA molecule CsiX for regulating and controlling synthesis yield of carotene compounds and application thereof
CN114921465B (en) Regulatory element CsiZ and application thereof in improvement of synthetic yield of terpenoid
CN110317765B (en) Escherichia coli expression strain for high-yield geraniol glucoside and application thereof
CN110305855A (en) Rhizoma Gastrodiae GeCPR gene and its application
CN116987603A (en) Recombinant saccharomyces cerevisiae strain for high yield of cannabigerolic acid as well as construction method and application thereof
CN107345232B (en) Glucosyltransferase genes capable of participating in post-biosynthetic conversion modification
CN114774297B (en) Recombinant saccharomyces cerevisiae for producing T-juniper alcohol and application thereof
CN113969288A (en) High-yield farnesol gene engineering bacterium and construction method and application thereof
CN114591929A (en) Curcuma wenyujin-derived curcumin synthetase, gene, vector, engineering bacterium and application
CN113817757A (en) Recombinant yeast engineering strain for producing cherry glycoside and application
Ma et al. Accumulation of Astaxanthin by Co-fermentation of Spirulina platensis and Recombinant Saccharomyces cerevisiae
CN114540403B (en) Method for producing esterified astaxanthin and use of esterified gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant