CN114885724A - Citrus psylla partition prevention and control treatment method - Google Patents
Citrus psylla partition prevention and control treatment method Download PDFInfo
- Publication number
- CN114885724A CN114885724A CN202210653269.4A CN202210653269A CN114885724A CN 114885724 A CN114885724 A CN 114885724A CN 202210653269 A CN202210653269 A CN 202210653269A CN 114885724 A CN114885724 A CN 114885724A
- Authority
- CN
- China
- Prior art keywords
- diaphorina citri
- area
- citrus
- prevention
- control
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G13/00—Protecting plants
Landscapes
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Toxicology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Environmental Sciences (AREA)
- Cultivation Of Plants (AREA)
Abstract
The invention provides a diaphorina citri partitioned prevention and control treatment method, and relates to the technical field of plant protection. According to the invention, the knowledge about diaphorina citri and citrus greening disease is actively taught to the fruit grower, so that the deep cognition of the fruit grower on the diaphorina citri spreading citrus greening disease as a pest and the optimal pesticide using dosage and period are realized, the man killing the diaphorina citri participates, the consensus is achieved, and the joint defense joint control is realized; through gridding and partitioning treatment on the citrus planting area, a proper growth area of the diaphorina citri is determined, pesticides are used in a targeted manner, environmental pollution is reduced, and manpower and material resources are saved; meanwhile, the quarantine work of reseeding seedlings is strengthened, the propagation path is reduced, the prevention and control effect is further improved, the problems of environmental pollution and poor prevention and control effect caused by the fact that a large amount of pesticides are used for the diaphorina citri at present are effectively solved, the method is particularly suitable for severe emergence areas of the diaphorina citri, and the method has good practical value for prevention and control of the citrus greening disease.
Description
Technical Field
The invention belongs to the technical field of plant protection, and particularly relates to a partitioned control method for diaphorina citri.
Background
Diaphorina citri (diaphorinacri Kuwayama) belongs to Hemiptera (Hemiptera) and phylloxera family (liviii dae), is a main pest in the young shoot stage of Citrus, and is one of natural vectors of Citrus Huanglongbing (HLB). The diaphorina citri nymphs can secrete a large amount of white honeydew to be adhered to branches and leaves of host plants to cause sooty mould; most adults lay eggs on young shoots of hosts, and hatched nymphs suck young shoot juice until the adults eclosion. Withering, young shoot distortion and the like of the damaged host shoot occur. Researches show that the pests eat the citrus phloem juice and spread citrus yellow shoot disease, which poses great threat to the citrus industry of all countries in the world.
Citrus yellow shoot, also known as yellow shoot, dieback and greening fruit, is caused by a phloem-restricted, refractory bacterium (candidus Liberibacter spp.) which has not been artificially cultured so far. The citrus trees infected by the field are mainly characterized in that the tree vigor is declined, mottled etiolated leaves appear, fruits are tasteless, red nose fruits appear and the like, the development of the citrus industry is seriously restricted, and destructive harm is brought to the citrus industry, which is commonly called citrus cancer. According to the information statistics of the global citrus industry, the planting area of the American citrus industry is reduced by nearly 40% in 2020/2021 years due to the influence of citrus yellow shoot, and the yield is less than one third of that before 20 years. At present, the citrus greening disease has no cure method, so the method is particularly key to the monitoring and the prevention and the control of the citrus greening disease, and the prevention and the control are mainly used for cutting diseased trees in a diseased area and preventing the further diffusion of citrus psyllids.
The optimal growth temperature of the diaphorina citri is 24-28 ℃, the optimal spawning temperature is 28-29.6 ℃, and the diapause phenomenon can occur in a high-temperature environment. The propagation is mainly determined by the temperature and the times of young shoot extraction, the development time from eggs to adults is about 15 days at the temperature of 28 ℃, and 14 generations can be propagated all year round under the condition of uninterrupted young shoots. Due to the large reproduction amount and the alternate generation, the psyllids can carry germs for life after eating the susceptible plants and migrate to the healthy plants to spread the yellow dragon germs to the healthy citrus plants after eating, thereby causing great harm to the citrus industry. At present, the high-efficiency citrus psylla monitoring and early warning technology system is not complete, the research on the mechanisms of the citrus psylla elimination and disaster formation in different ecological areas and the current situation of drug resistance of the citrus psylla is not systematic, and in addition, the citrus production areas in China have large differences due to different regionalism and topographic influence, the citrus planting areas in different areas are different, so that the elimination situation of the citrus psylla in the same citrus planting area also has large differences. Therefore, the method is particularly important for forming a set of partitioned control treatment technology suitable for the citrus psylla suitable growing area by combining the actual planting situation of citrus in each area.
Disclosure of Invention
In view of the above, the invention aims to provide a partitioned control treatment method for diaphorina citri, which adopts a multi-means set to effectively solve the problems of environmental pollution and poor control effect caused by large-area use of a single pesticide, effectively reduce the use amount of the pesticide and save manpower and material resources.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a diaphorina citri partitioned prevention and control treatment method, which comprises the following measures: (1) the propaganda work on the diaphorina citri and the citrus greening disease is enhanced;
(2) carrying out gridding partition management on the orchard according to the occurrence level of the diaphorina citri;
(3) establishing a corresponding diaphorina citri monitoring station according to the divided areas of the orchard;
(4) investigating and/or monitoring citrus greening disease trees;
(5) cutting off citrus yellow shoot trees in a targeted manner and enhancing management;
(6) supplementing seedlings without yellow shoot disease through repeated screening in the area where the citrus yellow shoot disease trees are cut off;
(7) and (4) carrying out subarea control according to the occurrence severity of the psylla chinensis.
Preferably, in the step (2), the citrus psyllid occurrence grade is classified into 3 grades according to the geographical environment of the orchard;
wherein, level 1 is a low-grade area of the diaphorina citri, the gradient of the area where the orchard is located is more than 0 degree, the altitude is more than 0m, and the direct solar temperature is more than 6 hours per day and is more than or equal to 29.6 ℃; grade 2 is a moderate emergence area of the diaphorina citri, the slope of the area where the orchard is located is more than 0 degree, the altitude is more than 0m, and the direct solar temperature is in the interval of (28 ℃, 29.6 ℃) within 6 hours every day; the 3-grade is a diaphorina citri height occurrence area, the altitude of the area where the orchard is located is less than 0m, and the direct solar air temperature is within the range of 24 ℃ and 28 ℃ for more than 6 hours every day.
Preferably, when the measure (2) is used for partition management, when the area of a certain level area is too large, the fruit trees are subdivided according to the existing path of the orchard, and the control of the fruit trees in a single area is guaranteed to be 1800-2500.
Preferably, a diaphorina citri monitoring station is established in each area in the measure (3), and each monitoring station is divided into 5 diaphorina citri monitoring points according to the difference of the geographical environment, the temperature and the humidity and the illumination time of the area.
Preferably, the diaphorina citri is monitored by a method of combining manual direct observation with yellow plate capture, and the diaphorina citri occurrence is counted once every half month.
Preferably, the investigation and/or monitoring method in the measure (4) comprises a random investigation method and a field census method.
Preferably, the management in the step (5) comprises reasonable fertilization and reinforcement of the resistance of the citrus;
the method for cutting off the citrus greening disease trees comprises the following steps: sawing off the trunk of the diseased tree, and reserving a tree pocket of 5-10 cm; processing the tree bag, and forming a cross opening on the cut surface; uniformly coating 41% glyphosate stock solution by volume at the cross opening, compacting the cut by adopting a dark plastic bag, and then sealing soil by utilizing garden soil.
Preferably, the partitioned control of the measure (7) comprises unified application of drugs to the medium-occurrence area and the high-occurrence area of the diaphorina citri in the initial stage, the full stage and the terminal stage of the diaphorina citri, and after the diaphorina citri is oviposited and fruit is picked in the orchard.
Preferably, the initial stage of diaphorina citri comprises the first 3 th of each year, the terminal stage of diaphorina citri comprises the first 5 th of each year, the first 8 th of each year and the last 8 th of each year, and the terminal stage of diaphorina citri comprises the second 10 th of each year.
Preferably, the zonal control of measure (7) comprises, in the area with low emergence of diaphorina citri: spraying 1500 times of the main tree in the 3-month early ten days of the initial stage of the diaphorina citri; spraying 1000 times of chlorpyrifos and 8000 times of thiamethoxam in the 5-month first ten days of the full-growth period of the diaphorina citri, spraying 1000 times of beta-cypermethrin and 800 times of thiamethoxam in the 8-month first ten days, and spraying 1500 times of Xiumu fiber brake in the 8-month last ten days; and (3) spraying 800 times of thiamethoxam and 1000 times of chlorpyrifos in the last 10 months of the terminal emergence period of the diaphorina citri.
Has the advantages that: the invention provides a method for controlling and managing diaphorina citri by partitioning, which is characterized in that a set of method for controlling and managing diaphorina citri by partitioning is refined on the basis of combined control of diaphorina citri, namely scientific propaganda and on-site training are combined, random investigation and field general investigation are combined, quarantine and field management are unified, combined control of diaphorina citri is carried out in time according to reasonable partitioning of geographic environment, so that the propaganda work of the diaphorina citri and diaphorina citri is enhanced; halving, namely performing gridding partition management on the orchard according to different emergence levels of the diaphorina citri; the method comprises the steps of 'three-building', namely building a corresponding diaphorina citri monitoring station according to areas divided in an orchard; the citrus greening disease trees are surveyed/monitored by random survey and field general survey; the five-cutting method is characterized in that according to the general survey result of the Huanglong disease tree, the five-cutting method is used for cutting off and strengthening management; six rechecks, and repeatedly screening the reseeded plantlets; the seven-prevention and control carries out the partition prevention and control according to the severity. According to the partitioned prevention and control treatment method, the citrus psyllids in different growing areas are subjected to graded prevention and control through the gridding partitioned management of the citrus planting areas and the targeted adoption of prevention and control technical measures, so that the method has the prevention and control pertinence; the method has the advantages of realizing accurate application and treatment of the pesticide to the psylla, reducing the pesticide consumption, reducing the serious pollution problem of the pesticide to the environment, being particularly suitable for serious psylla occurrence areas, and having good practical value for prevention and control of the citrus greening disease. By utilizing the partitioned prevention and control treatment method, the citrus greening disease infection rate can be stably reduced year by year, and the feasibility of the scheme is proved, so that the method has a positive effect on killing the citrus psyllids, and simultaneously has a good research background on the prevention and control of the citrus greening disease.
Drawings
FIG. 1 is a schematic diagram of a Chongyi county customs level fox Jie navel orange planting location in an embodiment of the invention;
FIG. 2 is a distribution diagram of diaphorina citri monitoring points in each region, wherein the diaphorina citri monitoring points are shown in the diagram;
FIG. 3 shows the occurrence of diaphorina citri in 2015-2017.
Detailed Description
The invention provides a diaphorina citri partitioned prevention and control treatment method, which comprises the following measures: (1) the propaganda work on the diaphorina citri and the citrus greening disease is enhanced;
(2) carrying out gridding partition management on the orchard according to the occurrence level of the diaphorina citri;
(3) establishing a corresponding diaphorina citri monitoring station according to the divided areas of the orchard;
(4) investigating and/or monitoring citrus greening disease trees;
(5) cutting off citrus yellow shoot trees in a targeted manner and enhancing management;
(6) supplementing seedlings without yellow shoot disease through repeated screening in the area where the citrus yellow shoot disease trees are cut off;
(7) and (4) carrying out subarea control according to the occurrence severity of the psylla chinensis.
The subarea prevention and control treatment method is preferably a specific method refined on the basis of joint prevention and joint control of the psyllids. The first measure of the invention is to enhance the propaganda work on the diaphorina citri and the citrus greening disease. The propaganda work preferably comprises the steps of greatly improving the propaganda strength for identifying the diaphorina citri and judging the symptom of the citrus huanglongbing tree, and helping fruit growers to independently prevent diseases; and the propaganda activity is to actively organize professionals to scientifically and comprehensively perform propaganda activity on fruit growers, and comprises field guidance, PPT teaching, knowledge manual issuing and WeChat end real-time updating prevention and control information and drug recommendation.
The second measure of the method is to perform gridding partition management on the orchard according to the occurrence grade of the diaphorina citri, namely to divide the orchard into two halves, and perform gridding partition management on the orchard according to different occurrence grades of the diaphorina citri. According to the method, the generation grade of the diaphorina citri is preferably classified into 3 grades according to the geographical environment of the orchard; wherein, level 1 is a low-degree occurrence area of the diaphorina citri, the slope of the area where the orchard is located is more than 0 degree, the altitude is more than 0m, and the direct solar air temperature is more than 6 hours per day and is more than or equal to 29.6 ℃; grade 2 is a moderate emergence area of the diaphorina citri, the slope of the area where the orchard is located is more than 0 degree, the altitude is more than 0m, and the direct solar temperature is in the interval of (28 ℃, 29.6 ℃) within 6 hours every day; the 3-grade is a diaphorina citri height occurrence area, the altitude of the area where the orchard is located is less than 0m, and the direct solar air temperature is within the range of 24 ℃ and 28 ℃ for more than 6 hours every day. When the area of a certain grade area is too large, subdivision is performed according to the existing path of the orchard during the zone management, and the fruit trees in a single area are controlled to be 1800-2500 trees, and more preferably 2000 trees.
The third measure of the invention is to establish a corresponding diaphorina citri monitoring station according to the divided areas of the orchard, namely 'three-building', and establish a corresponding diaphorina citri monitoring station according to the divided areas of the orchard. According to the invention, a diaphorina citri monitoring station is preferably established in each area, and each monitoring station is divided into 5 diaphorina citri monitoring points according to the difference of the geographical environment, the temperature, the humidity and the illumination time of the area. According to the areas divided in the orchard, each area is provided with a diaphorina citri monitoring station, and each monitoring station is divided into 5 diaphorina citri monitoring points according to the difference of the geographical environment, the temperature and the humidity and the illumination time of the area. When the citrus psylla is monitored by using the monitoring points and the monitoring stations, the citrus psylla is preferably monitored by adopting a method of combining direct manual observation with yellow board capture, the occurrence condition of the citrus psylla is counted once every half month, more preferably, a station length is arranged at each monitoring station, the station length is responsible for the monitoring work of the citrus psylla in the area, the monitoring method adopts a method of combining direct manual observation (mainly the tender tip part of the citrus psylla) with the yellow board capture method, and the occurrence condition of the citrus psylla is counted once every half month.
The fourth measure of the invention is to investigate and/or monitor the citrus yellow shoot sick tree, namely 'four surveys', and survey/monitor the citrus yellow shoot sick tree by combining random survey and field general survey; the methods of investigation and/or monitoring preferably include stochastic survey methods and field census methods. Due to early infection of diaphorina citri or early infection of citrus trees with citrus greening disease, the symptoms are not obvious, and common visual observation is difficultJudging, preferably objectively judging whether the yellow dragon disease tree is detected by a PCR technology in a laboratory. The random investigation method is not particularly limited, preferably comprises a 5-point sampling method, and particularly comprises the steps of sampling according to 1% of the total number of citrus plants in a region, collecting five directions of citrus trees for each sample, collecting 4 leaves in each direction, and conveniently carrying out PCR detection after the collected leaves are processed as soon as possible or stored at 4 ℃ and marked. The specific method of PCR detection is not particularly limited in the present invention, and preferably includes primers of OI1(SEQ ID NO.1: GCGCGTATGCAATACGAGCGGCA) and OI2c (SEQ ID NO.2: GCCTCGCGACTTCGCAACCCAT), which are 25. mu.L in total and include ddH 2 O16.1. mu.L, 10 XPCRBBuffer 4.5. mu.L, 2.5mM dNTPs 2. mu.L, 0.5. mu.L of each of the primers OI1 and OI2c, 0.4. mu.L of rTaq enzyme, 1. mu.L of DNA, using a program of 96 ℃ for 5 min; 30s at 94 ℃, 30s at 64 ℃ and 60s at 72 ℃; circulating for 35 times; the field general survey method preferably comprises the steps of carrying out field general survey on an orchard when fruit disease symptoms are obvious (mainly 'red nose fruit', mottled leaf yellowing and the like) at 72 ℃ for 10min, wherein the size of a yellow dragon disease positive strip is 1167bp, observing plants, confirming disease-sensitive states of each plant and marking, and collecting leaves in the same way as that of random survey when the field general survey is carried out, so that the detailed description is omitted. The fifth measure of the invention is to purposefully cut off and strengthen the management of the citrus huanglongbing trees, namely, to 'cut off five', and purposefully cut off and strengthen the management according to the general survey result of the citrus huanglongbing trees.
The management of the invention preferably comprises reasonable fertilization, strengthens the self resistance of the citrus, particularly strengthens the management of susceptible varieties (Nanfeng mandarin orange, wide-peel mandarin orange and the like) and prevents the increase of disease sources. The invention preferably performs the cutting-off of citrus trees infected with citrus greening disease, and the cutting-off method preferably comprises the following steps: sawing off the trunk of the diseased tree, and reserving a tree pocket about 10 cm; processing the tree bag, and forming a cross opening on the cut surface; uniformly smearing 41% glyphosate stock solution at the cross opening; adopting a dark plastic bag to pack the cut; sealing with garden soil. The reasonable fertilization is preferably carried out by a method of a slow-release method (the slow-release method, a soil improvement and fertilization technology taking the improvement of the quality of oranges as a target [ J ]. New rural area, 2021(07): 25-26.).
The sixth measure of the invention is to supplement the seedlings which are repeatedly screened and have no yellow shoot disease in the area where the citrus yellow shoot disease trees are cut off, namely 'six rechecks', and repeatedly screen the reseeded seedlings, preferably comprises strictly detecting the citrus seedlings which are cut off and reseeded, and confirming that no yellow shoot disease exists and then reseeding. The understanding of fruit growers on the harm of citrus yellow shoot and the pressure of governments on illegal seedlings are enhanced, the citrus seedlings which are subjected to detoxification treatment must be selected as the reseeding seedlings, and undetected citrus seedlings should never enter an orchard.
The seventh measure of the invention is to perform zonal control according to the severity of the occurrence of the psyllids, namely 'seven control', and the zonal control is performed according to the severity, wherein the zonal control preferably comprises unified application of pesticide to a moderate-occurrence area and a high-occurrence area of the citrus psyllids in the initial stage, the full stage and the terminal stage of the citrus psyllids, and after the citrus psyllids lay eggs and fruit picking in an orchard. In the present invention, the initial stage of the psylla citrifolia preferably includes the first 3 th of each year, the full stage of the psylla citrifolia preferably includes the first 5 th of each year, the first 8 th of each year, and the last stage of the psylla citrifolia preferably includes the second 10 th of each year.
The invention adopts different control schemes aiming at different diaphorina citri occurrence degrees, such as in a diaphorina citri low-occurrence area: spraying 1500 times of the main tree in the 3-month early ten days of the initial stage of the diaphorina citri; spraying 1000 times of chlorpyrifos and 8000 times of thiamethoxam in the 5-month first ten days of the full-growth period of the diaphorina citri, spraying 1000 times of beta-cypermethrin and 800 times of thiamethoxam in the 8-month first ten days, and spraying 1500 times of Xiumu fiber brake in the 8-month last ten days; and (3) spraying 800 times of thiamethoxam and 1000 times of chlorpyrifos in the last 10 months of the terminal emergence period of the diaphorina citri.
The invention aims at a moderate diaphorina citri occurrence area, and the prevention and control method preferably comprises the steps of applying the same pesticides to the low diaphorina citri occurrence area, namely the initial stage (3 th-day), the full stage (5 th-day, 8 th-day and 8 th-day), and the final stage (10 th-day), and also comprises the steps of spraying 1000 times of kindergard and 500 times of beta-cypermethrin to the diaphorina citri in the 2 th-day, spraying 1000 times of cyfluthrin and 500 times of acetamiprid (40%), spraying 800 times of thiamethoxam and 1000 times of chlorpyrifos to the 9 th-day.
The invention aims at the occurrence area of the citrus psyllid with high altitude, and the prevention and control method preferably comprises the following steps: spraying 150 times of mineral oil and 1000 times of propaquilegic in the 12-month upper ten days of the overwintering adult period of the diaphorina citri, and spraying 200 times of mineral oil and 1000 times of propaquilegic in the 1-month lower ten days; spraying 1000 times of Jinhuimin and 500 times of beta-cypermethrin in the 2 nd ten-month later of the oviposition period of the diaphorina citri; 1500 times of native wood is sprayed in the first 3 th of the early stage of the diaphorina citri, 1500 times of acesulfame carboy is sprayed in the last 3 th of the late month, and 2000 times of pre-sprout of a chain of trees is sprayed in the last 4 th of the late month; spraying 1000-time chlorpyrifos and 8000-time thiamethoxam (5%) in the first 5 th of the full-growth period of diaphorina citri, spraying 2000-time bifenthrin in the second 5 th of the month, spraying 3000-time Trojan killing in the first 6 th of the month, spraying 1500-time bentwood in the first 7 th of the month, spraying 1000-time beta-cypermethrin and 800-time thiamethoxam in the first 8 th of the month, spraying 1500-time Fimbristylis glauca in the first 8 th of the month, spraying 1000-time cyhalothrin and 500-time acetamiprid (40%) in the first 9 th of the month; 300 times of mineral oil and 1500 times of carbosulfan are sprayed in the last 10 th of the terminal emergence period of the diaphorina citri, 800 times of thiamethoxam and 1000 times of chlorpyrifos are sprayed in the last 10 th of the terminal emergence period of the diaphorina citri.
In the present invention, in the seventh measure, agricultural control of diaphorina citri is preferably further included, and more preferably, the method includes: the daily management of the orchard is enhanced, vegetation for survival and propagation of natural enemies (ladybug, lacewing, ant and the like) of the diaphorina citri is reserved in a planned mode, and the natural enemies are used for preventing and controlling the diaphorina citri; strengthening the tip stage management of a base, and controlling the tender tips of the orchard in a similar time so as to uniformly perform pesticide control; timely management such as pruning, pruning and bud picking is carried out, early food and spawning tender bud places of overwintering diaphorina citri are controlled, and other hosts of diaphorina citri around the orchard are timely eliminated.
In conclusion, the zonal prevention and control of the diaphorina citri is to distinguish the survival suitable area and the migration flying area of the diaphorina citri according to the geographical environment of the orchard. In order to reduce the tedious dispensing of pesticide spraying, the orchard is uniformly dosed in 3 key control stages of the diaphorina citri, namely the initial stage (3 last ten days) of the diaphorina citri, the full stage (5 last ten days, 8 last ten days and 8 last ten days) of the diaphorina citri and the final stage (10 last ten days) of the diaphorina citri; uniformly applying the pesticide to the medium-occurrence area and the high-occurrence area of the diaphorina citri in the late 2 months of the oviposition period of the diaphorina citri and in the late 10 months after fruit picking in the orchard, and applying the pesticide to the rest months according to the scheme shown in the table 1.
TABLE 1 Citrus psyllid Standard for zonal prevention and control
Note: the I, the II and the III respectively represent that the generation grades of the diaphorina citri are 1 grade, 2 grade and 3 grade, namely, the 1 grade is a diaphorina citri low-degree generation area, the 2 grade is a diaphorina citri medium-degree generation area, and the 3 grade is a diaphorina citri high-degree generation area.
According to the partitioned prevention and control treatment method for the diaphorina citri, the knowledge about the diaphorina citri and the citrus greening disease is actively taught by a fruit grower, so that the deep cognition of the fruit grower on the diaphorina citri spreading the citrus greening disease and the optimal pesticide dosage and period are realized, the man killing the diaphorina citri participates, the consensus is achieved, and the joint prevention and control are realized; through gridding and partitioning treatment on the citrus planting area, a proper growth area of the diaphorina citri is determined, pesticides are used in a targeted manner, environmental pollution is reduced, and manpower and material resources are saved; meanwhile, the quarantine work of reseeding seedlings is strengthened, the propagation path is reduced, the prevention and control effect is further improved, the problems of environmental pollution and poor prevention and control effect caused by the fact that a large amount of pesticides are used for the diaphorina citri at present are effectively solved, the method is particularly suitable for severe emergence areas of the diaphorina citri, and the method has good practical value for prevention and control of the citrus greening disease.
The method for partitioned control and treatment of diaphorina citri provided by the invention is described in detail with reference to the following examples, but the method is not to be construed as limiting the scope of the invention.
Example 1
The prevention and control method is implemented in the Guanjie Yangxi village plateau of the Yangxi city of Chongzhou province in Jiangxi province, and is hereinafter referred to as a 'base'. The base occupies about 360 mu of land, and the cultivated variety is 'Newhall' navel orange.
In 2015-2017, 17 fruit growers in the base organization perform citrus greening disease declaration activities, and according to the response of the fruit growers, partial contents of 'life habits and migration rules of citrus psyllids, citrus greening disease expression symptoms and differences of citrus deficiency and greening disease symptoms' in the declaration activities are beneficial. In later-period investigation, fruit growers who take part in the propaganda activity can accurately identify the diaphorina citri in a plurality of pests, and part of the fruit growers can judge whether the pests are diseases or lack elements according to the symptoms of the citrus plants.
The base is composed of high-hilly areas, slow-hilly areas and low-lying areas (figure 1), the areas which are the same as the slow-hilly areas are divided into 2 and 3 areas and 5 and 6 areas according to the original walking route in the base according to the partition rule of measure (2) for carrying out partition management on an orchard according to different geographic positions, the undeveloped area on the upper left side of the base and the route form the high-hilly area 1, the 4 areas belong to the low-lying areas, and the dividing line of each area is the walking route. There are 14346 citrus plants based on 2015, including 2564 plant, 2345 plant, 2246 plant, 2129 plant, 2798 plant, and 2264 plant.
And (4) after gridding and partitioning treatment is carried out according to the measures, selecting 5 diaphorina citri monitoring points in each area according to the measure (3), and establishing a diaphorina citri monitoring station. Each monitoring point is monitored by a fixed person, the monitoring method adopts a manual direct observation method (mainly a citrus tender tip part) and a yellow board capturing method to be combined, and the counting of the diaphorina citri occurrence condition is carried out on the monitoring station every half month (figure 2).
In 2015 (in the period without adopting a control measure), the citrus psylla monitoring data shows that 503 psylla are discovered in the base all the year round, and the generation rule can be divided into four stages: the first stage is march to 4 months, and the peak value reaches 41 heads at most; the second stage is from late 5 months to late 6 months, and the peak value reaches 67 heads at most; the third stage is 8-9 months, and the peak value reaches 52 heads at most; the last stage is 10 months, and the peak value is 40 heads at most; the generation conditions of the diaphorina citri in the subareas from 2015 to 2017 are shown in table 2, wherein the 254 heads of the 4 zones (low-lying zones, diaphorina citri high-occurrence zones) account for 50.50% of the whole zone, the 23 heads of the 1 zone (high-hilly zones, diaphorina citri low-occurrence zones) account for 4.57% of the whole zone, the 2 heads of the other four zones (slow-hilly zones, diaphorina citri medium-occurrence zones) respectively account for 43 heads of the 2 zones, 46 heads of the 3 zones, 56 heads of the 5 zones and 81 heads of the 6 zones, and the proportions of the whole zone are respectively 8.55%, 9.15%, 11.13% and 16.10%. The occurrence rate of diaphorina citri is highest in zone 4, possibly related to its geographical location. The 4 area belongs to a low-lying area, and the daily average illumination time is long, so that the method is suitable for the survival and the propagation of the diaphorina citri; and the area 1 belongs to a high hilly land, and the daily average illumination time is short, so the incidence rate is low.
Table 22015 to 2017 diaphorina citri grading statistics
Note: the diaphorina citri control is not carried out in 2015, the number of diaphorina citri in one year is treated in a subarea manner in 2016, and the number of diaphorina citri in two years is treated in a subarea manner in 2017; the level I is a high hill zone, a citrus psylla low-degree occurrence area and corresponds to a base 1 area; level II is a slow hilly area and a moderate citrus psylla occurrence area, and corresponds to areas 2, 3, 5 and 6 of the base; the level III is a low-lying zone, a diaphorina citri height generation zone and corresponds to a base 4 zone.
And (4) carrying out gridding and partitioning control on the base according to the pesticide control method in the measure (6) according to the growth rule of the diaphorina citri and the investigation result of gridding and partitioning diaphorina citri in the base in 2016. The concentrations and the types of the sprayed pesticides in the 4 zones (low-lying zone, where diaphorina citri occurs the highest) are shown in table 4, the concentrations and the types of the sprayed pesticides in the 1 zone (high-hilly zone, where diaphorina citri occurs the lowest) are shown in table 3, and the concentrations and the types of the sprayed pesticides in the 2 zones, the 3 zones, the 5 zones, and the 6 zones (slow hilly zone) are shown in table 5.
Table 32016 year 4 zone (low-lying zone) pesticide use
Note: the pesticide using time and specification in 2017 are the same as those in 2016.
TABLE 42016 year 1 area (high hilly land) pesticide usage
Note: the pesticide using time and specification in 2017 are the same as those in 2016.
Table 52016 pesticide application conditions of 2, 3, 5 and 6 zones (slow hilly land)
Note: the pesticide using time and specification in 2017 are the same as those in 2016.
The optimal control period is divided into three stages, the first stage is in the initial stage of the diaphorina citri, the control time is 3 months last, the diaphorina citri lays eggs in a large amount in the period, and the control can be carried out in time to effectively control the propagation of the diaphorina citri population; in the second stage, in the full-growth period of the diaphorina citri, the control time is 5 months and 8 months, the diaphorina citri is fed with young shoots in large quantity in the period, and all areas of a control base are uniformly carried out to prevent the diaphorina citri from migrating to other areas; in the last stage, in the late stage of the diaphorina citri, the control time is 10 days in the middle of the month, the diaphorina citri has relatively few eggs and weaker life activity in the period, and as the citrus is close to mature in the period, pesticide residue is not left in the pesticide for controlling the diaphorina citri, and the fruit is safe.
In the embodiment, after the gridding and partitioning treatment is carried out in 2016 and 2017 according to the measures, the incidence rate of the diaphorina citri is obviously reduced compared with that of the diaphorina citri in 2015, the occurrence condition of the diaphorina citri is shown in table 5, but the diaphorina citri still has diaphorina citri activity in the peak period, and one of the diaphorina citri activity is that a small number of diaphorina citri can generate immune reaction to pesticides or hide on other vegetation when the control is carried out; the second possibility is that the farm operation of fruit growers in 2015 or external wind influence causes the weakening of the effect of the natural isolation belt of the base and the invasion of diaphorina citri (figure 3).
Through the implementation of the embodiment, the infection rate of citrus greening disease in the base is steadily reduced year by year after the outbreak of citrus greening disease in Chongyi county in 2012 is carried out to 2016 and 2017 by adopting the regional treatment. By 2017, the total number of citrus plants infected with citrus yellow shoot in the base is 197, the infection rate is 1.46%, and is reduced by 14.42% compared with the infection rate in 2014, and specific data refer to table 6. The data show the feasibility of the invention, and the invention has positive effect on killing diaphorina citri and has good research background on prevention and control of citrus greening disease.
TABLE 62013 to 2017 cases of citrus greening disease
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of Jiangxian teachers
<120> citrus psylla partition prevention and control treatment method
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcgcgtatgc aatacgagcg gca 23
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gcctcgcgac ttcgcaaccc at 22
Claims (10)
1. The partitioned prevention and control treatment method for the diaphorina citri is characterized by comprising the following measures: (1) the propaganda work on the diaphorina citri and the citrus greening disease is enhanced;
(2) carrying out gridding partition management on the orchard according to the occurrence level of the diaphorina citri;
(3) establishing a corresponding diaphorina citri monitoring station according to the divided areas of the orchard;
(4) investigating and/or monitoring citrus greening disease trees;
(5) cutting off citrus yellow shoot trees in a targeted manner and enhancing management;
(6) supplementing seedlings without yellow shoot disease through repeated screening in the area where the citrus yellow shoot disease trees are cut off;
(7) and (4) carrying out subarea control according to the occurrence severity of the psylla chinensis.
2. The zonal prevention and control treatment method according to claim 1, wherein in the measure (2), the citrus psyllid occurrence grade is classified into 3 grades according to the geographical environment of the orchard;
wherein, level 1 is a low-degree occurrence area of the diaphorina citri, the slope of the area where the orchard is located is more than 0 degree, the altitude is more than 0m, and the direct solar air temperature is more than 6 hours per day and is more than or equal to 29.6 ℃; grade 2 is a moderate emergence area of the diaphorina citri, the slope of the area where the orchard is located is more than 0 degree, the altitude is more than 0m, and the direct solar temperature is in the interval of (28 ℃, 29.6 ℃) within 6 hours every day; the 3-grade is a diaphorina citri height occurrence area, the altitude of the area where the orchard is located is less than 0m, and the direct solar air temperature is within the range of 24 ℃ and 28 ℃ for more than 6 hours every day.
3. The partition prevention and control method according to claim 1 or 2, characterized in that when the measure (2) is used for partition management, when the area of a certain level area is too large, the area is subdivided according to the existing path of the orchard, and the control of fruit trees in a single area is ensured to be 1800-2500 trees.
4. The zonal prevention and control treatment method according to claim 1, wherein a diaphorina citri monitoring station is established in each area in the measure (3), and each monitoring station is divided into 5 diaphorina citri monitoring points according to the difference of the geographical environment, the temperature, the humidity and the illumination time of the area.
5. The zonal prevention and control treatment method according to claim 4, wherein the diaphorina citri is monitored by a method of combining direct manual observation with yellow board capture, and the diaphorina citri occurrence is counted every half month.
6. The zonal prevention and treatment method according to claim 1, wherein the investigation and/or monitoring method in the measure (4) comprises a stochastic survey method and a field census method.
7. The zonal prevention and treatment method according to claim 1, wherein the management in measure (5) comprises rational fertilization and reinforcement of citrus resistance;
the method for cutting off the citrus greening disease trees comprises the following steps: sawing off the trunk of the diseased tree, and reserving a tree pocket of 5-10 cm; processing the tree bag, and forming a cross opening on the cut surface; uniformly coating 41% glyphosate stock solution by volume at the cross opening, compacting the cut by adopting a dark plastic bag, and then sealing soil by utilizing garden soil.
8. The partitioned prevention and control treatment method according to claim 1, characterized in that the partitioned prevention and control of the step (7) comprises unified administration of the pesticide to the midmost-occurring region of the diaphorina citri and the high-occurring region of the diaphorina citri after the midmost-occurring period of the diaphorina citri, the full-occurring period of the diaphorina citri and the end-most period of the diaphorina citri, and the oviposition period of the diaphorina citri and the fruit picking in the orchard.
9. The zonal prevention and treatment method according to claim 8, wherein the initial stage of the psyllid comprises the first 3 th of the year, the full stage of the psyllid comprises the first 5 th, the first 8 th and the second 8 th of the year, and the final stage of the psyllid comprises the second 10 th of the year.
10. The zonal control strategy of claim 1, wherein measure (7) comprises, in a low incidence area of diaphorina citri: spraying 1500 times of the main tree in the 3-month early ten days of the initial stage of the diaphorina citri; spraying 1000 times of chlorpyrifos and 8000 times of thiamethoxam in the 5-month first ten days of the full-growth period of the diaphorina citri, spraying 1000 times of beta-cypermethrin and 800 times of thiamethoxam in the 8-month first ten days, and spraying 1500 times of Xiumu fiber brake in the 8-month last ten days; and (3) spraying 800 times of thiamethoxam and 1000 times of chlorpyrifos in the last 10 months of the terminal emergence period of the diaphorina citri.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210653269.4A CN114885724A (en) | 2022-06-08 | 2022-06-08 | Citrus psylla partition prevention and control treatment method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210653269.4A CN114885724A (en) | 2022-06-08 | 2022-06-08 | Citrus psylla partition prevention and control treatment method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114885724A true CN114885724A (en) | 2022-08-12 |
Family
ID=82727130
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210653269.4A Pending CN114885724A (en) | 2022-06-08 | 2022-06-08 | Citrus psylla partition prevention and control treatment method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114885724A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108781934A (en) * | 2018-06-29 | 2018-11-13 | 广东省农业科学院植物保护研究所 | A kind of classification preventing control method in Citrus Huanglongbing pathogen Endemic Area orchard |
| CN110150011A (en) * | 2019-05-30 | 2019-08-23 | 广西壮族自治区农业科学院 | A kind of method that mandarin orange yellow twig is irrigated in field indetification and prevention and control |
| CN110192488A (en) * | 2019-06-13 | 2019-09-03 | 赣州市果树植保站 | A set of efficient Synthetical prevention technology of Citrus Huanglongbing pathogen |
| CN112369272A (en) * | 2020-11-16 | 2021-02-19 | 广西壮族自治区农业科学院植物保护研究所 | Method for monitoring and forecasting diaphorina citri |
| CN114467582A (en) * | 2022-01-19 | 2022-05-13 | 广西特色作物研究院 | Experimental method for unmanned aerial vehicle pesticide application for controlling diaphorina citri |
-
2022
- 2022-06-08 CN CN202210653269.4A patent/CN114885724A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108781934A (en) * | 2018-06-29 | 2018-11-13 | 广东省农业科学院植物保护研究所 | A kind of classification preventing control method in Citrus Huanglongbing pathogen Endemic Area orchard |
| CN110150011A (en) * | 2019-05-30 | 2019-08-23 | 广西壮族自治区农业科学院 | A kind of method that mandarin orange yellow twig is irrigated in field indetification and prevention and control |
| CN110192488A (en) * | 2019-06-13 | 2019-09-03 | 赣州市果树植保站 | A set of efficient Synthetical prevention technology of Citrus Huanglongbing pathogen |
| CN112369272A (en) * | 2020-11-16 | 2021-02-19 | 广西壮族自治区农业科学院植物保护研究所 | Method for monitoring and forecasting diaphorina citri |
| CN114467582A (en) * | 2022-01-19 | 2022-05-13 | 广西特色作物研究院 | Experimental method for unmanned aerial vehicle pesticide application for controlling diaphorina citri |
Non-Patent Citations (1)
| Title |
|---|
| 姚林建: "赣南柑橘黄龙病低度流行区建设技术研究", 中国优秀硕士学位论文全文数据库农业科技辑, no. 1, pages 12 - 18 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| James et al. | Integrated pest management in vegetable production: A guide for extension workers in West Africa | |
| Fernandez et al. | A global review of Ligustrum lucidum (OLEACEAE) invasion | |
| Curran et al. | Experimental tests of the spatiotemporal scale of seed predation in mast‐fruiting Dipterocarpaceae | |
| Duncan et al. | Seed dispersal and potential forest succession in abandoned agriculture in tropical Africa | |
| Salamanca et al. | Cascading effects of combining synthetic herbivore‐induced plant volatiles with companion plants to manipulate natural enemies in an agro‐ecosystem | |
| Arias-Calderón et al. | Pre-breeding for resistance to Verticillium wilt in olive: Fishing in the wild relative gene pool | |
| Chen et al. | Mechanisms of Douglas-fir resistance to western spruce budworm defoliation: bud burst phenology, photosynthetic compensation and growth rate | |
| Benítez-Malvido et al. | Responses of seedling transplants to environmental variations in contrasting habitats of Central Amazonia | |
| Ryalls et al. | Above–belowground herbivore interactions in mixed plant communities are influenced by altered precipitation patterns | |
| Qu | Ecophysiological study on the natural regeneration of the two larch species with special references to soil environment in larch forests | |
| Stuiver et al. | Seedling responses to changes in canopy and soil properties during stand development following clear-cutting | |
| Gonthier et al. | Bottom‐up effects of soil quality on a coffee arthropod interaction web | |
| Campbell et al. | Coyote and porcupine spread Russian olive seeds through endozoochory | |
| CN114885724A (en) | Citrus psylla partition prevention and control treatment method | |
| de Assis et al. | The participatory construction of agro-ecological knowledge as a soil conservation strategy in the mountain region of Rio de Janeiro state (Brazil) | |
| Wotton | Consequences of dispersal failure: kereru and large seeds in New Zealand | |
| Runion et al. | Effects of elevated CO2 on growth of the industrial sweetpotato cultivar CX-1 | |
| Nescolarde-Selva et al. | Reproductive system and interaction with fauna in a Mediterranean Pyrophite shrub | |
| Gaese et al. | Biodiversity and land use systems in the fragmented Mata Atlântica of Rio de Janeiro | |
| Keeler | Tritrophic Mutualisms in a Changing Climate | |
| Lonergan | The use of native ectomycorrhizal fungi in the restoration of whitebark pine | |
| Batters | The impact of invasive thistle species on dynamics of Cercopidae in the Stikine-Skeena region of northern British Columbia | |
| Mohamed | Arbuscular mycorrhizal fungi and their influence on growth and water relations of sweet cherry rootstock and tomato plants | |
| García | Study of the differences between alien and native populations of Cicerbita alpina (L.) Wallr. & Woodsia ilvensis (L.) R. Br.: A conservation project of two arctic-alpine rarities of Britain | |
| Noble | The effects of tropical forest fragmentation and land use on leaf litter decomposition and nutrient cycling |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |