CN114854779B - Tomato ascorbic acid biosynthesis gene PMI and application - Google Patents

Tomato ascorbic acid biosynthesis gene PMI and application Download PDF

Info

Publication number
CN114854779B
CN114854779B CN202210403837.5A CN202210403837A CN114854779B CN 114854779 B CN114854779 B CN 114854779B CN 202210403837 A CN202210403837 A CN 202210403837A CN 114854779 B CN114854779 B CN 114854779B
Authority
CN
China
Prior art keywords
ascorbic acid
tomato
pmi2
pmi1
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210403837.5A
Other languages
Chinese (zh)
Other versions
CN114854779A (en
Inventor
张余洋
叶志彪
郑伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan Chuwei Biotechnology Co ltd
Original Assignee
Wuhan Chuwei Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuhan Chuwei Biotechnology Co ltd filed Critical Wuhan Chuwei Biotechnology Co ltd
Priority to CN202210403837.5A priority Critical patent/CN114854779B/en
Publication of CN114854779A publication Critical patent/CN114854779A/en
Application granted granted Critical
Publication of CN114854779B publication Critical patent/CN114854779B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y503/00—Intramolecular oxidoreductases (5.3)
    • C12Y503/01—Intramolecular oxidoreductases (5.3) interconverting aldoses and ketoses (5.3.1)
    • C12Y503/01008—Mannose-6-phosphate isomerase (5.3.1.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Nutrition Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a tomato ascorbic acid biosynthesis gene PMI and application thereof, wherein the tomato ascorbic acid biosynthesis gene PMI is PMI1 and PMI2, and DNA of ORF of PMI1 and PMI2 is SEQ ID NO:1 and SEQ ID NO:2; the protein coded by the tomato ascorbic acid biosynthesis gene PMI comprises SEQ ID NO:3 and SEQ ID NO:4. the invention takes a tomato conventional strain AC as an object, clones ascorbic acid synthesized Smirnoff pathway key genes, constructs corresponding genetic transformation vectors, and transfers the genetic transformation vectors into the tomato strain AC by using an agrobacterium-mediated genetic transformation method to cause the target genes to be over-expressed or inhibit expression; the obtained transgenic tomatoes are subjected to ascorbic acid content analysis, and the effect of the genes in tomato ascorbic acid content regulation is evaluated.

Description

Tomato ascorbic acid biosynthesis gene PMI and application
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a tomato ascorbic acid biosynthesis gene PMI and application thereof.
Background
Currently, the closest prior art:
ascorbic acid (AscorbicAcid, asA), also known as vitamin C (Vc), has important roles in organisms, such as antioxidant, cofactors for important enzymes, etc. In plants, research shows that AsA is positively correlated with stress resistance of plants, and the content of endogenous AsA is increased, so that stress resistance of plants, such as cold resistance, can be improved. At the same time, ascorbic acid is an important substance for human and animal maintenance of growth and development. Whereas primates (e.g. humans) lack the last enzyme in the AsA biosynthetic pathway and are therefore unable to synthesize AsA, only sufficient AsA can be obtained from plants (Jain et al, 2000), and fresh fruits are the major source of ascorbic acid.
Although ascorbic acid plays an important role in the nutrition required by humans, the understanding of its biosynthetic pathway is not complete and the study of the synthetic pathway of plant ascorbic acid was initiated later in animals until 1998, where the synthetic pathway of plant ascorbic acid Smirnoff was not first proposed. Subsequent studies have found that the synthesis of ascorbic acid in plants differs from a single synthetic pathway in animals, and that multiple synthetic pathways may exist, and thus the synthesis of plant ascorbic acid is much more complex in animals than in animals.
Despite its important function, ascorbic acid has been identified for its molecular structure in the last 30 th century. With the development of scientific technology, it has been found that there are differences in the ascorbic acid synthesis pathways of animals, microorganisms and plants. The biosynthetic pathways of animals and microorganisms are revealed earlier. In 1954 lsherwood et al suggested that there was a similar ascorbic acid synthesis pathway in plants as in animals, but no intermediate product was detected and therefore not verified. By the 90 s, the previous has isolated ascorbic acid-deficient from Arabidopsis thaliana mutant, which only made the plant ascorbic acid biosynthetic pathway important and greatly advanced. In 1998, wheeler et al (Wheeler et al, 1998) proposed the first ascorbic acid pathway, the D-mannose/L-galactose pathway, by isotopic labelling, biochemical analysis and early research results. Since then, three pathways have been proposed in succession, namely the galacturonic acid pathway, the gulose pathway and the inositol pathway.
At present, no study on the aspect of PMI transgene is reported yet. There are two PMIs with higher homology in tomato genome, named PMI1 and PMI2 respectively. The excessive and co-suppression expression vectors of PMI1 and PMI2 are constructed, and introduced into tomato strain AC by using agrobacterium-mediated method to make target gene be excessive or suppressed. And (3) measuring the anti-damage blood count content of leaves and fruits of the transgenic tomatoes, and preliminarily identifying the functions of two PMIs in the ascorbic acid synthesis pathway through analysis of experimental results.
Tomatoes are one of the vegetable crops cultivated universally throughout the world and play an important role in the development of the vegetable industry. Tomato contains abundant ascorbic acid, and is an important source of vitamins in diet. Tomatoes have been widely studied as a model plant because of their small genome, short growth cycle and ability to produce plants throughout the year, mature genetic transformation systems and self-pollinating plants. Although some progress has been made in plant ascorbic acid metabolism studies, most have focused on the model plant Arabidopsis. In tomato, only limited genes related to ascorbic acid metabolism have been cloned and identified, and the mechanism studies for regulating ascorbic acid accumulation in tomato are also only in the beginning stage.
The target product content in the transgenic plant or the synthesis of exogenous metabolites can be improved by improving the activity of the rate-limiting enzyme for controlling the synthesis of a specific metabolite through genetic engineering or introducing a new metabolite synthesis path into the plant. The improvement of various important agronomic traits of crops by genetic improvement methods has become a trend in the future. Thus, cloning and functional identification of genes encoding related enzymes in the ascorbate metabolic pathway is a critical task in order to more effectively increase ascorbate levels in tomato.
In summary, the problems of the prior art are:
(1) Only a few ascorbic acid anabolic genes in tomato have been cloned and identified, and there has been little research on the mechanisms regulating ascorbic acid accumulation in tomato. In order to accelerate the genetic improvement of the ascorbic acid content in tomatoes more effectively, the functional identification of related genes PMI1 and PMI2 in the ascorbic acid metabolic pathway is a key task.
(2) There is currently no specific experimental evidence of how the PMIs genes function in tomato ascorbic acid synthesis and metabolic regulation. Therefore, the invention over-expresses PMI1 and PMI2 genes in tomatoes, systematically determines the expression quantity and the ascorbic acid content of corresponding genes of transgenic materials, and publishes the specific functions of the PMI1 and PMI2 genes in tomatoes. … …
The difficulty of solving the technical problems is as follows:
since ascorbic acid anabolism is a quantitative trait, major genes have not yet been elucidated, limiting the genetic improvement of ascorbic acid content in tomatoes. Functional analysis of related genes by molecular biology is required to verify the role of PMIs genes in ascorbic acid synthesis.
Meaning of solving the technical problems:
tomato is an important vegetable crop, and the content of ascorbic acid is one of important traits for measuring tomato fruit quality, and the precursor condition for improving the trait is that the gene functions in the synthesis and oxidation-reduction pathways of ascorbic acid must be comprehensively known, and the regulation mechanism of the gene functions is also known. Currently, few regulatory mechanisms of genes involved in ascorbic acid biosynthesis are reported. The invention mainly discloses the effect of PMI genes in tomato ascorbic acid synthesis, and the two genes of PMI1 and PMI2 are over-expressed or inhibited in tomatoes, so that the effect and the regulation mechanism of the PMI genes in regulating ascorbic acid biosynthesis are researched. This will help to increase the level of ascorbic acid in tomatoes by means of genetic improvement, providing new theoretical techniques and support for tomato variety improvement and cultivation.
Disclosure of Invention
Aiming at the problems existing in the prior art, the invention provides a tomato ascorbic acid biosynthesis gene PMI and application thereof. The invention takes a tomato (Solanum lycopersicum) conventional strain AC (preserved in the laboratory) as an object, clones an ascorbic acid synthesis Smirnoff pathway key gene, constructs corresponding sense and RNAi genetic transformation vectors, and transfers the gene into the tomato strain AC by using an agrobacterium-mediated genetic transformation method to cause the target gene to be over-expressed or inhibit expression. The obtained transgenic tomatoes were subjected to ascorbic acid content analysis to evaluate the role of these genes in tomato ascorbic acid content regulation.
The invention is realized by the way that the tomato ascorbic acid biosynthesis genes PMI are PMI1 and PMI2, and the DNA of ORF of the PMI1 and PMI2 is (Solyc02 g 086090.2) CTCCCATCGTCACTTGCTTTGTCCAAATCCCCAACTTCCCCTCCTCCTCACAACACTTTGCCCCTTCAAAAACTAACCCCCCAATGGAAACTATTCAATTCTCTTCAACTTCAACTTCTTTGTTTATTTCAACTTCTTTCTTTTTCTCTCGGGTCTCTCAACAACAATGGAGATGGAGGAAGGTTTTAAGGGGTTACTCAGGTTAATTGGTTCTGTTAAGAATTACGATTGGGGCCGTACGGCGAAGGAGTCTTGTGTTGGACGTCTGTATAGGCTCAATTCTCGGACGAAAATTGATGAAAAACAGCCATATGCCGAGTTTTGGATGGGAACTCATGACTCTGGACCATCCTACATTGTGGTGGAACGAGGAGGAAGAATTCAGAATGGACATGCTAATGGCGGAGGAATTAGAGACAAGTGTTCTTTGAAAGATTGGATTCAGAAGAACCCTAGTGTACTTGGAGAAACTGTTCTTGCCAAATGGGGTACCCAGCTTCCTTTTCTCTTCAAGGTACTCTCAATTGAGAAAGCTTTGTCTATACAAGCTCATCCAGACAAGGATCTGGCAATTCTTTTGCATAAGGAGCAGCCACTCGTTTACAAGGATGATAACCACAAACCTGAGATGGCTTTGGCATTGACCAAGTTCGAGGCCTTGTGTGGCTTCATAAGTCTTGAGGAGCTTAAAGTGATTGTTCAGACTGTGCCCGAGATTGTTGAAGTAGTTGGTAATGCGCTTGCAGAGCTAGTATTGGACTTGAGCGAGGATGATGAAGAGGAGAAAGGTAAATTAGTGCTCAGAAAATTATTCACGGAGATTATGTCAGCTAGCAAGGATGTGATCACGGAAGTACTTGCTAAGCTGATTAGTCGTCTGAACATTAAAAACAAGGTAAGGGTGCTGACCGACAAGGAACAACTGGTCCTAGGACTTGAGAAGCAGTATCCATCTGATGTTGGTGTTTTAGCAGCATTCTTGTTTAATTACGTGAAGCTCAATCCTGGTGAAGCTTTATATTTAGGGGCAAATGAACCCCATGCATATGTATATGGAGAATGTGTCGAATGTATGGCAACCTCAGATAATGTGGTACGCGCTGGCCTAACTCCCAAGCACCGGGATGTTAGAACTCTCTGTTCAATGCTCACGTATAGACAGGGTAACCCTGAAATTCTGCACGGTACGGCAATAAATCCATACACAGTGAGATACCTCCCTCCTTTTGATGAATTCGAGGTGGATCATTGCATTCTCCCCCCATATTCAACTGTTACCTTCCCTTCTGCTCCTGGTCCGTCCATGTTTTTGGTCATGGGAGGAGAGGGAACAATGACCACATCAGCAGAAGTGATTGTGGTTGAAGGTGATGTCCTATTTGCACCTGCAAACACCAATATTACCATTGCAACCTCCTCTGGTTTGCACTTGTATAGAGCAGGTGTAAACAGCAGATTTTTTGAGGAATGATAGTTGTAGGCTTGTAGCCCCTTATGCTTGCTAATAAAACAGTGAATTTTTCTGTTACACTGGCTGTTCCACCTTGTATTAATAGCATGTTCAGGTATATAACCGCTTAAGTTAAGTGTA respectively
And (solyc02 g 0632220.2) TAGGAAAGGAAGAAATATTTAAAGTTGGCAGGAAAATGTTTTCCCTTAATTAAATTTGAAACCGCTGCTTTGCGTGTGATAAAGAAAAAAACACCAAAACTTGTAAATCCTCACTAATTTTTCTTGAATGGTACAACACCAACATTCATGTGCTCCTCTGTCAATCTTCTTCTTCTTCAAATCATCATCATCTTTGTTTGAACTGAAGCTACTGTTTCCCGTTCCTTGCTCTGAAGCATGAACCAAGACTACTAAACCTTTCGCAGAGGAAAAAAACACGAGAGCTTTTTTTTTTTAAACTTAAAATCTGTTTTATGGACACTGACTTGTTGTCGGTGACGGAAGGGAGAGGGAGGCTGGTGAGGTTGATGGGTTGCGTGAAGAATTACGATTGGGGACCACCCGGGAAGGAATCTCGTGTAGCGCGGTTGTATGCTTGCAATAGTGGTAACTATGTTGACCAAGAGAAGCCTTATGCCGAATTTTGGATGGGTACTCACGATTCTGGGCCTTCCTATGTTGTGGAAGGAACTGAGAATGGGTTGGTTAATGGTAAAGGAGAGGGACACAAGTTAACATTGAAGAATTGGATTCAAAACAACCCTAATGTTCTTGGAGAGAAGGTTGTGAAGAAATGGGGTACCAACCTTCCTTTTCTCTTCAAGGTACTATCTGTTGCAAAAGCTTTGTCCATACAGGCCCATCCAGACAAGGATTTAGCCTCTCGTCTGCATAGTGAGCTTCCGGATGTTTATAAGGATGACAATCACAAACCGGAGATGGCATTGGCGTTGACGGAATTTGAGGCATTGTGTGGATTTATAAGTCTCGAGGAGCTTAAGTTGATTGTTCAAACTGTGCCAGAGATTGTTGAATTGGTCGGTACAGCACACACAGAGCAGGTATTGGAATTGAACGAGGATGATGGGAAGGAAAAAGGTAAATTCGTCCTACAATCAGTATTTACTGAGCTGATGTCAGCAAACAAGGATGTGGTTGCTGAAGTGATAGCCAAGCTGATTAGTCGCCTACACGTTAAAAATCAGGCAAGGGAGCTGACAGAGAAAGAACAAGTGGTGCTTAGACTTGAGAAGCAGTATCCAGCTGATATTGGTGTCTTGGCTGCATTCTTGTTAAATTATGTGAAACTCAATCCTGGTGAAGCCTTATATTTAGGAGCAAATGAACCTCATGCTTATTTATATGGTGATTGTATTGAATGCATGGCAACATCGGACAACGTTGTTCGCGCTGGCCTAACTCCAAAACACCGAGATGTTAAAACACTATGCTCAATGCTCACTTACAGACAGGGTTTTCCTGAAATTCTGCAGGGCACCGCAGTAAATCCTCATGTTATGAGGTACATTCCTCCTTTTGATGAATTTGAAGTTGATCGTTGTATTCTTCCCGAACAATCAACTACTGAATTTCCATCTATTCCCGGTCCATCCATTTTTATGGTCGTGGAGGGAGAGGGAACATTAACCTCATCATCAGACGAGATTATCCATGAAGGTGATGTCCTTTTTGCACCTGCAAACACCAACATTACTGTCTCGACATCTTCTGGTTTGCAATTATATAGAACAGGAATAAACAGCAGGTTTTTTGAGGAGTGAAGGTTGTATACGTATTCTAGTACATAAAATTGTTCATTAATTTTTCTCTATAGGAAAATCGGCTGATCCAACCTTGTAATATTAGCCATTTCTGTAAATCAGGTATACAAATAAATATGACTTGTTATAGTTGCCTCATTGTACTAGTTCAGTGTTTCACAATCTAAGTGCAATAGGTGGAATTAGTATAGGGATTAGGATTTAAGGTTTTGTAAGATACTTTCAAATGCTTTTAATCCAAAACAAAAAGAGCACAGGTATAATTCCCAACAAAAGAAAAAGAGATTGGAGCAGACAATACAGTAATCTTGTGTGCTGTCAAC; the Solyc02g086090.2 fragment is 1591bp; the Solyc02g 0632220.2 fragment is 1945bp; the identity of the PMI1 and PMI2 nucleic acid levels was 79%.
Another object of the present invention is to provide a protein encoded by the tomato ascorbic acid biosynthesis gene PMI, the protein comprising (PMI 1 enzyme protein) MEMEEGFKGLLRLIGSVKNYDWGRTAKESCVGRLYRLNSRTKIDEKQPYAEFWMGTHDSGPSYIVVERGGRIQNGHANGGGIRDKCSLKDWIQKNPSVLGETVLAKWGTQLPFLFKVLSIEKALSIQAHPDKDLAILLHKEQPLVYKDDNHKPEMALALTKFEALCGFISLEELKVIVQTVPEIVEVVGNALAELVLDLSEDDEEEKGKLVLRKLFTEIMSASKDVITEVLAKLISRLNIKNKVRVLTDKEQLVLGLEKQYPSDVGVLAAFLFNYVKLNPGEALYLGANEPHAYVYGECVECMATSDNVVRAGLTPKHRDVRTLCSMLTYRQGNPEILHGTAINPYTVRYLPPFDEFEVDHCILPPYSTVTFPSAPGPSMFLVMGGEGTMTTSAEVIVVEGDVLFAPANTNITIATSSGLHLYRAGVNSRFFEE respectively
And (PM 2 enzyme protein) MDTDLLSVTEGRGRLVRLMGCVKNYDWGPPGKESRVARLYACNSGNYVDQEKPYAEFWMGTHDSGPSYVVEGTENGLVNGKGEGHKLTLKNWIQNNPNVLGEKVVKKWGTNLPFLFKVLSVAKALSIQAHPDKDLASRLHSELPDVYKDDNHKPEMALALTEFEALCGFISLEELKLIVQTVPEIVELVGTAHTEQVLELNEDDGKEKGKFVLQSVFTELMSANKDVVAEVIAKLISRLHVKNQARELTEKEQVVLRLEKQYPADIGVLAAFLLNYVKLNPGEALYLGANEPHAYLYGDCIECMATSDNVVRAGLTPKHRDVKTLCSMLTYRQGFPEILQGTAVNPHVMRYIPPFDEFEVDRCILPEQSTTEFPSIPGPSIFMVVEGEGTLTSSSDEIIHEGDVLFAPANTNITVSTSSGLQLYRTGINSRFFEE;
the PMI1 enzyme protein consists of 434 amino acids; the PMI2 enzyme protein consists of 435 amino acids; the amino acid levels of PMI1 enzyme protein and PMI2 enzyme protein were 70% similar.
Another object of the present invention is to provide an expression vector pMV2 constructed using the tomato ascorbic acid biosynthesis gene PMI (see FIG. 7 for a vector diagram).
Another object of the present invention is to provide a method for constructing the expression vector, which comprises:
firstly, designing a full-length gene Primer by utilizing a Primer5, and amplifying in a PCR instrument by taking cDNA of tomato AC as a template to obtain a target fragment; the PCR product is linked to pEASY-B (pEASY-B is a public commercial vector, the detailed vector information is shown in Beijing full-scale gold biotechnology Co., ltd. (www.transgen.com.cn)) vector, escherichia coli is transformed by a linked product heat shock method, positive clones are screened by a 50mg/L Km resistance flat plate, the positive clones are selected, shake culture is carried out on a shaking table at 37 ℃ for overnight at 200r/min, and the positive clones are selected for sequencing verification after PCR detection by using a gene specific primer;
the sequence of pEASY-B is:
AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTGCCCTTAAGGGCAGCTTCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATTCAGGGCGCAAGGGCTGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCCCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCACGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAG
secondly, selecting clone shaking bacteria with correct sequence comparison to extract plasmids; gene accession numbers with sequences as described above: solyc02g086090.2 and Solyc02g0632220.2. Xbal and KpnI double-enzyme cut recombinant plasmid for 1.5h;
thirdly, cutting the gel, recovering the gel by using a gel recovery kit to obtain a target fragment, and connecting the target fragment to a pMV2 carrier cut by using Xbal and Kpn I by using T4 ligase; e, converting the escherichia coli by a connection product heat shock method, selecting positive clones, carrying out PCR positive detection on the monoclonal by using a 35S binding gene reverse specificity primer, selecting positive clone shaking bacterium extracting plasmid, and transferring the positive clone shaking bacterium extracting plasmid into agrobacterium competent C58 cells by an electric shock method after double enzyme digestion verification is correct;
step four, selecting positive clones, shake culturing overnight at 150r/min on a shaking table at 28 ℃, and carrying out PCR positive detection on bacterial liquid by using a 35S gene-added reverse specific primer on a carrier; adding glycerol into positive clone, mixing, and storing in-70deg.C low temperature refrigerator.
Further, in the first step, the PCR amplification method comprises:
adopting a reaction system of 10 mu L, taking EF1a as an internal reference, and carrying out measurement and analysis by a Roche fluorescence quantitative PCR instrument LC480, wherein the system comprisesPremix Ex Taq TM (2X) 5. Mu.L, each of the forward and reverse primers was 0.5. Mu.L, and the template was 4. Mu.L;
each sample was repeated three times and the reaction procedure: pre-denaturation at 95 ℃ for 5min; and (3) carrying out melting curve analysis after 45 cycles at 95 ℃ for 10s and 58 ℃ for 1min, and determining the specificity of the PMI1 and PMI2 genes.
The invention also aims to provide an application of the tomato ascorbic acid biosynthesis gene PMI in measuring the relative expression quantity and the ascorbic acid content of PMIs over-transgenic plant leaves, wherein the application method of the PMIs over-transgenic plant leaves comprises the following steps:
screening out excessive transgenic plants with higher relative expression quantity in the T0 generation, and detecting and confirming again in the T1 generation; the relative expression quantity is measured and analyzed by qPCR by taking tender leaves of 3 excessive transgenic lines and non-transgenic lines as materials;
the ascorbic acid content is measured by an enzyme-labeled instrument by adopting an HCl extraction method; quickly freezing young leaves of the transformed plants with liquid nitrogen, grinding the samples into powder in the liquid nitrogen, subpackaging 0.1g of the samples in a 2ml centrifuge tube, and repeating each sample for 3 times;
during measurement, 1ml of precooled 0.2mol/L HCl solution is added into each tube for extraction for about half an hour, the mixture is inverted and mixed uniformly every 5min, and the mixture is centrifuged for 10min at 12000r/min at 4 ℃;
mu.L of the supernatant was taken and 50. Mu.L of 0.2mol/L NaH2PO4 (pH 5.6) was added thereto, and the pH was adjusted to 5 and 6 with 0.2mol/L NaOH;
mixing, collecting 100 μl supernatant, sequentially adding 140 μl 0.12mol/L NaH 2 PO 4 And 10. Mu.L of 25mmol/L DTT, were reacted at room temperature for 30min in the dark. 95. Mu.L of the supernatant was taken and added with 0.1ml of 0.2mol/L NaH 2 PO 4 Measuring the value of 265nm of absorption wavelength by an enzyme label instrument;
finally, adding 5 mu L of 40U/ml AO enzyme, and measuring the absorption wavelength value after the reaction; the standard solution of ascorbic acid is measured by an enzyme-labeled instrument, and a standard curve is drawn.
In summary, the invention has the advantages and positive effects that:
the invention clones the ascorbic acid synthesis related gene from tomato, over-expresses the ascorbic acid synthesis related gene in tomato, systematically measures the corresponding expression quantity and the ascorbic acid content of the corresponding transgenic material, and preliminarily identifies the effect of PMIs in tomato ascorbic acid synthesis and metabolism regulation.
Compared with the prior art, the invention has the advantages that:
1) Two members PMI1 and PMI2 in mannose-6 phosphate isomerase gene family are cloned, their ORFs are 1591bp and 1945bp respectively, 434 and 435 amino acids are encoded respectively, the consistency of nucleic acid level is 79%, and the similarity of amino acid level is 70%.
2) The analysis results of the PMI1 and PMI2 tissue expression profiles show that PMIs are expressed in each tissue of tomato, but the expression levels in each organ are greatly different. The PMI1 has the highest expression level in leaves, and secondly, roots and flowers, and the lowest expression level in stems and red ripe fruits; the expression level of PMI2 in flowers is highest, and the PMI2 is next to leaves, and the PMI2 tends to decrease and then increase at different periods of fruits.
3) The invention determines the content of ascorbic acid in the roots, stems, leaves, flowers and fruits of tomato strain AC in each development period, and the result shows that the total ascorbic acid content has larger difference, and the content in the roots is the lowest and the content in the leaves is the highest; as the fruit develops, the total ascorbic acid content tends to increase gradually, with the highest ascorbic acid content of the fruit at the red ripe stage.
4) The invention constructs the PMI1 and PMI2 over-expression vector, and uses agrobacterium-mediated genetic transformation method to transfer them into tomato conventional strain AC. The obtained tomato transformed plant is subjected to PCR detection, and the result shows that the exogenous gene is inserted into the tomato genome.
5) The expression quantity of the target gene in the leaves of the excessive transgenic strain is obviously higher than that of the non-transgenic material, and the expression quantity of the PMI1 excessive transgenic strain O2-6, O11-7 and O12-2 is 157.7 times, 338.9 times and 156.4 times of that of the non-transgenic material respectively; the expression amounts of the PMI2 excessive transgenic strain O4-2, O12-11 and O18-9 are respectively 11.6 times, 33.3 times and 20.3 times of that of the non-transgenic material. The fold over-expression of PMI1 is higher than that of PMI2, probably because the background expression amount of PMI1 in the leaf is lower than that of PMI2.
6) The invention adopts an enzyme-labeled instrument to measure the total ascorbic acid content in the leaves of the PMI1 and PMI2 excessive transgenic lines, the total ascorbic acid content in the tomato leaves is obviously improved by the excessive expression of the PMI1, the total ascorbic acid content in the tomato leaves is also improved by the excessive expression of the PMI2, the up-regulated expression of the APX1 is promoted after the up-regulated expression of the PMI1, the expression of GalUR, galDH and MIOX is inhibited, and the expression of most genes in the ascorbic acid synthesis step is not influenced; after the PMI2 is up-regulated, the expression of ascorbic acid anabolism related genes GLDH, GMP, MDHAR, GME1, GME2, DHAR, APX1, GGP, APX6, PMI1, PMI2, GR, galUR, galDH and MIOX is promoted, wherein the expression level of GGP is up to 5.0 times that of non-transgene, but the expression of upstream GME1 and GME2 is obviously inhibited, and the expression level is respectively reduced to 37.0% and 16.1% of non-transgene.
Drawings
Fig. 1 is a technical roadmap provided by an embodiment of the invention.
FIG. 2 is a graph showing the total ascorbic acid content of tomato in different tissues according to the analysis of the tissue expression profile of PMIs in different tissues of tomato in the present invention.
FIG. 3 is a PCR detection of transgenic plants provided by an embodiment of the present invention.
In the figure: m: a molecular weight marker; n: a negative control; p: positive control (recombinant plasmid); a1 to 5 are PMI1 excessive transgenic plants; b, 1 to 15 are PMI2 excessive transgenic plants; c1 to 14 are PMIs co-suppression transgenic plants; the primer used for PCR detection is a 35S plus gene reverse primer.
FIG. 4 is a graph showing the analysis of the expression of a target gene in leaves of a transgenic line provided by an embodiment of the present invention.
In the figure: a2, O11, O12, O17 and O18 are PMI1 excessive strains; b, O4, O5, O6, O12, O14, O16, O17, O18, O22 and O26 are PMI2 excessive strains; WT wild type.
FIG. 5 shows the detection of the expression level of fruits of the over-expressed PMI1 transgenic strain provided by the embodiment of the invention (A, C); and (3) measuring the AsA content of fruits of the transgenic strain with the over-expressed PMI2 (B, D).
In the figure: WT wild type; o2-6, O11-7 and O12-2 are PMI1 excess plants; o4-2, O12-11 and O18-9 are PMI2 excess plants.
FIG. 6 is an analysis chart of the expression of the gene related to AsA synthesis in leaves of PMIs over-transgenic lines provided by the embodiment of the invention.
In the figure: WT wild type; o12-2: PMI1 excess plants; o4-2: PMI2 excess plants.
FIG. 7 is a diagram of a pMV2 vector provided in the example of the present invention.
Detailed Description
The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
Ascorbic acid (AsA) is an antioxidant that plays an important role in a number of physiological processes in plants. Ascorbic acid is an important vitamin widely present in fresh fruits and vegetables and in many organisms as a bioactive substance that is involved in many metabolic activities. Genetic engineering research on the biosynthetic pathway and metabolic regulation of ascorbic acid has made breakthrough progress. However, in tomato, only a few genes for ascorbic acid anabolism have been cloned and identified, and there is still a need for regulating ascorbic acid anabolism in tomato by cloning key genes. In the prior art, no ascorbic acid synthesis related gene is cloned from tomatoes, the ascorbic acid synthesis related gene is overexpressed in tomatoes, the corresponding expression quantity and the ascorbic acid content of corresponding transgenic materials are systematically measured, and specific theoretical basis is lacked for preliminary identification of the effect of PMIs in tomato ascorbic acid synthesis and metabolism regulation.
Aiming at the problems existing in the prior art, the invention provides a tomato ascorbic acid biosynthesis gene PMI and application thereof, and the invention is described in detail below with reference to the accompanying drawings.
The tomato ascorbic acid biosynthesis genes PMI provided by the embodiment of the invention are PMI1 and PMI2, and DNA of ORF of PMI1 and PMI2 is SEQ ID NO:1 and SEQ ID NO:2; the SEQ ID NO: fragment 1 is 1591bp; the SEQ ID NO: the 2 fragment is 1945bp; the identity of the PMI1 and PMI2 nucleic acid levels was 79%.
The invention provides a protein coded by the tomato ascorbic acid biosynthesis gene PMI, which comprises the amino acid sequence shown in SEQ ID NO:3 and SEQ ID NO:4, a step of; the SEQ ID NO:3 consists of SEQ ID NO:1, 434 amino acids. The SEQ ID NO:4 consists of SEQ ID NO:2, 435 amino acids; SEQ ID NO:3 and SEQ ID NO: similarity at the 4 amino acid level was 70%.
The invention provides an expression vector constructed by utilizing the tomato ascorbic acid biosynthesis gene PMI.
The invention provides a construction method of the expression vector, which comprises the following steps:
firstly, designing a full-length gene Primer by utilizing a Primer5, and amplifying in a PCR instrument by taking cDNA of tomato AC as a template to obtain a target fragment; the PCR product is linked to pEASY-B carrier, the linked product is heat shock transformed into colibacillus, 50mg/L Km resistance plate is used for screening positive clone, the positive clone is selected, shake culture is carried out on a shaking table at 37 ℃ for overnight at 200r/min, and the positive clone is selected and sequenced and verified after PCR detection by using a gene specific primer.
Secondly, selecting clone shaking bacteria with correct sequence comparison to extract plasmids; xbal and KpnI double cleave recombinant plasmid for 1.5h.
Thirdly, cutting the gel, recovering the gel by using a gel recovery kit to obtain a target fragment, and connecting the target fragment to a pMV2 carrier cut by using Xbal and Kpn I by using T4 ligase; e.coli is transformed by a connection product heat shock method, positive clones are selected, PCR positive detection is carried out on the monoclonal by using a 35S binding gene reverse specificity primer, positive clone shaking bacteria extracting plasmid is selected, and the positive clone shaking bacteria extracting plasmid is transferred into agrobacterium competent C58 cells by an electric shock method after double enzyme digestion verification is correct.
Step four, selecting positive clones, shake culturing overnight at 150r/min on a shaking table at 28 ℃, and carrying out PCR positive detection on bacterial liquid by using a 35S gene-added reverse specific primer on a carrier; adding glycerol into positive clone, mixing, and storing in-70deg.C low temperature refrigerator.
In the embodiment of the invention, in the first step, the PCR amplification method comprises the following steps:
adopting a reaction system of 10 mu L, taking EF1a as an internal reference, and carrying out measurement and analysis by a Roche fluorescence quantitative PCR instrument LC480, wherein the system comprisesPremix Ex Taq TM (2X) 5. Mu.L, each of the forward and reverse primers was 0.5. Mu.L, and the template was 4. Mu.L.
Each sample was repeated three times and the reaction procedure: pre-denaturation at 95 ℃ for 5min; and (3) carrying out melting curve analysis after 45 cycles at 95 ℃ for 10s and 58 ℃ for 1min, and determining the specificity of the PMI1 and PMI2 genes.
The invention provides an application method for measuring the relative expression quantity of leaves and the content of ascorbic acid of a PPs excess transgenic plant, which comprises the following steps:
screening out excessive transgenic plants with higher relative expression quantity in the T0 generation, and detecting and confirming again in the T1 generation; the relative expression quantity is measured and analyzed by qPCR by taking tender leaves of 3 excessive transgenic lines and non-transgenic lines as materials.
The ascorbic acid content is measured by an enzyme-labeled instrument by adopting an HCl extraction method; the young leaves of the transformed plants were snap frozen in liquid nitrogen, the samples were ground to powder in liquid nitrogen, and 0.1g of the samples were packed in 2ml centrifuge tubes, each sample being repeated 3 times.
During measurement, 1ml of precooled 0.2mol/L HCl solution is added into each tube for extraction for about half an hour, the mixture is inverted and mixed evenly every 5min, and the mixture is centrifuged for 10min at 12000r/min at 4 ℃.
mu.L of the supernatant was taken and 50. Mu.L of 0.2mol/L NaH2PO4 (pH 5.6) was added thereto, and the pH was adjusted to 5 and 6 with 0.2mol/L NaOH.
Mixing, collecting 100 μl supernatant, sequentially adding 140 μl 0.12mol/L NaH 2 PO 4 And 10. Mu.L of 25mmol/L DTT, were reacted at room temperature for 30min in the dark. 95. Mu.L of the supernatant was taken and added with 0.1ml of 0.2mol/L NaH 2 PO 4 The microplate reader determines the value at an absorption wavelength of 265 nm.
Finally, adding 5 mu L of 40U/ml AO enzyme, and measuring the absorption wavelength value after the reaction; the standard solution of ascorbic acid is measured by an enzyme-labeled instrument, and a standard curve is drawn.
The invention is further described below in connection with specific embodiments.
Examples
1) Plant material:
tomato material was (Solanum lycopersicum) conventional line AC (stored in this laboratory) for gene cloning and genetic transformation. And (3) in the spring of AC pot culture, collecting root, stem, leaf, flower and fruit samples of different development periods of the plant after fruit setting is mature, quick-freezing by liquid nitrogen, and storing in an ultralow temperature refrigerator at-70 ℃ for analyzing the tissue expression pattern of PMIs.
2) PMIs tissue expression profile and ascorbic acid content determination analysis of each tissue:
qPCR primers for PMI gene were designed using Primer5 software. Adopts a reaction system of 10 mu L and takes EF1a as an internal reference (Lovdal and Lillo, 2009), violetThe fluorescent quantitative PCR instrument LC480 is used for determination and analysis, and the system comprisesPremix Ex Taq TM (2X) 5. Mu.L, each of the forward and reverse primers was 0.5. Mu.L, and the template was 4. Mu.L. Each sample was repeated three times and the reaction procedure: pre-denaturation at 95 ℃ for 5min; melting curve analysis was performed after 45 cycles at 95℃for 10s at 58℃for 1min to determine the specificity of the primers. The relative expression of the genes was calculated using equation 2- ΔΔct (Svensson et al, 2006). And (3) measuring the ascorbic acid content of each tissue of the tomatoes by adopting a general high performance liquid chromatography.
3) PMIs gene amplification and sequence analysis:
tomato full-length cDNA sequences were obtained in SGN (http:// solgenomics. Net/index. Pl) using Unigene Solyc02g086090.2 and Solyc02g0632220.2 as probes. The corresponding bioinformatics analysis of PMI1 and PMI2 was performed using software such as NCBI, clustalW, softberry, multalin. Gene specific primers containing the complete coding region were designed using Primer 5.0 software. PCR amplification was performed using tomato line AC leaf cDNA as template.
4) Construction of PMI1 and PMI2 overexpression vectors:
first, primer5 is used to design full-length gene Primer, and cDNA of tomato AC is used as template to amplify in PCR instrument to obtain target fragment. The PCR product is linked to pEASY-B carrier, the linked product is heat shock transformed into colibacillus, 50mg/L Km resistance plate is used for screening positive clone, the positive clone is selected, shake culture is carried out on a shaking table at 37 ℃ for overnight at 200r/min, and the positive clone is selected and sequenced and verified after PCR detection by using a gene specific primer. The clone shaking bacteria with correct sequence alignment is selected to extract plasmids. Xbal and KpnI double cleave recombinant plasmid for 1.5h. The target fragment is obtained by recovering the cut gel by using a gel recovery kit, and the target fragment is connected to the pMV2 vector which is subjected to double digestion by using Xbal and Kpn I by using T4 ligase. E.coli is transformed by a connection product heat shock method, positive clones are selected, PCR positive detection is carried out on the monoclonal by using a 35S binding gene reverse specificity primer, positive clone shaking bacteria extracting plasmid is selected, and the positive clone shaking bacteria extracting plasmid is transferred into agrobacterium competent C58 cells by an electric shock method after double enzyme digestion verification is correct. Positive clones were selected and cultured overnight on a shaker at 28℃at 150r/min with shaking, and PCR positive detection was performed on the bacterial liquid as well using 35S plus gene reverse-specific primers on the vector. The positive clone is added with glycerol, then is uniformly mixed and stored in a low-temperature refrigerator at the temperature of-70 ℃ for the next genetic transformation of tomatoes.
5) Determination of leaf relative expression quantity and ascorbic acid content of PMIs over-transgenic plants:
and screening out excessive transgenic plants with higher relative expression quantity in the T0 generation, and detecting and confirming again in the T1 generation. The relative expression quantity is measured and analyzed by qPCR by taking tender leaves of 3 excessive transgenic lines and non-transgenic lines as materials.
The ascorbic acid content is measured by an enzyme-labeled instrument by adopting an HCl extraction method. The young leaves of the transformed plants were snap frozen in liquid nitrogen, the samples were ground to powder in liquid nitrogen, and 0.1g of the samples were packed in 2ml centrifuge tubes, each sample being repeated 3 times. During measurement, 1ml of precooled 0.2mol/L HCl solution is added into each tube for extraction for about half an hour, the mixture is inverted and mixed evenly every 5min, and the mixture is centrifuged for 10min at 12000r/min at 4 ℃. mu.L of the supernatant was taken and 50. Mu.L of 0.2mol/L NaH2PO4 (pH 5.6) was added thereto, and the pH was adjusted to between 5 and 6 with 0.2mol/L NaOH. After mixing, 100. Mu.L of the supernatant was taken, and 140. Mu.L of 0.12mol/L NaH2PO4 (pH 7.5) and 10. Mu.L of 25mmol/L DTT were added in this order, followed by reaction at room temperature for 30 minutes in the absence of light. The absorbance at 265nm was measured by an ELISA reader by adding 0.1ml of 0.2mol/L NaH2PO4 (pH 5.6) to 95. Mu.L of the supernatant, and finally, 5. Mu.L of 40U/ml AO enzyme was added thereto, and the reaction was carried out. The standard solution of ascorbic acid is measured by an enzyme-labeled instrument, and a standard curve is drawn.
In the embodiment of the invention, the nucleic acid sequences of PMI1 and PMI2 provided by the invention are compared as follows:
in the embodiment of the invention, the PMI1 and PMI2 protein sequences provided by the invention are compared as follows:
in the embodiment of the invention, fig. 2 is a graph of the total ascorbic acid content in different tissues of tomato according to the analysis of tissue expression profile of PMIs in different tissues of tomato provided in the embodiment of the invention. From the example step 2) PMIs tissue expression profile and each tissue ascorbic acid content determination analysis. And (3) measuring the ascorbic acid content of each tissue of the tomatoes by adopting a general high performance liquid chromatography.
FIG. 3 is a PCR detection of transgenic plants provided by an embodiment of the present invention. Firstly, carrying out amplification and sequence analysis of PMIs genes in the step 3) to obtain the full-length sequence of the PMIs genes; then constructing PMI1 and PMI2 over-expression vectors through the step 4); the detection of the relative expression quantity of the leaves of the transgenic plants with excessive amount is obtained by detecting the relative expression quantity of the leaves of the transgenic plants with excessive amount of PMIs in the step 5) of the embodiment. The relative expression level was analyzed by qPCR.
In the figure: m: a molecular weight marker; n: a negative control; p: positive control (recombinant plasmid); a1 to 5 are PMI1 excessive transgenic plants; b, 1 to 15 are PMI2 excessive transgenic plants; c1 to 14 are PMIs co-suppression transgenic plants; the primer used for PCR detection is a 35S plus gene reverse primer.
FIG. 4 is a graph showing the analysis of the expression of a target gene in leaves of a transgenic line provided by an embodiment of the present invention. The method is obtained by detecting the relative expression level of leaves of the PMIs over-transgenic plant in the step 5) of the example. The relative expression level was analyzed by qPCR.
In the figure: a2, O11, O12, O17 and O18 are PMI1 excessive strains; b, O4, O5, O6, O12, O14, O16, O17, O18, O22 and O26 are PMI2 excessive strains; WT wild type.
FIG. 5 shows the detection of the expression level of fruits of the over-expressed PMI1 transgenic strain provided by the embodiment of the invention (A, C); and (3) measuring the AsA content of fruits of the transgenic strain with the over-expressed PMI2 (B, D). From example step 5) determination of the ascorbic acid content of leaves of PMIs-overproducing transgenic plants. The ascorbic acid content is measured by an enzyme-labeled instrument by adopting an HCl extraction method.
In the figure: WT wild type; o2-6, O11-7 and O12-2 are PMI1 excess plants; o4-2, O12-11 and O18-9 are PMI2 excess plants.
FIG. 6 is an analysis chart of the expression of the gene related to AsA synthesis in leaves of PMIs over-transgenic lines provided by the embodiment of the invention. The method is obtained by detecting the relative expression level of leaves of the PMIs over-transgenic plant in the step 5) of the example. The relative expression level was analyzed by qPCR.
In the figure: WT wild type; o12-2: PMI1 excess plants; o4-2: PMI2 excess plants.
FIG. 7 is a diagram of a pMV2 vector provided in the present invention.
Demonstration section (specific examples/experiments/pharmacological analyses/positive experimental data, evidence materials, authentication reports, business data, research and development evidence, business collaboration evidence, etc. capable of proving the inventive aspects of the present invention)
The results of the implementation showed that the ascorbic acid content in tomato fruits increased from 80mg/100gFW to 119mg/100gFW up to 48% in tomato when PMI1 was overexpressed (FIG. 5B). When PMI2 was overexpressed in tomato, the ascorbic acid content in tomato fruit increased from 80mg/100gFW to 112mg/100gFW by up to 40% (FIG. 5D). Thus, PMIs play an important promoting role in the synthesis and accumulation of ascorbic acid in tomato fruits.
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.
Sequence listing
<110> Wuhanchu biological science and technology Co., ltd
<120> tomato ascorbic acid biosynthesis gene PMI and application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1591
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 1945
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 434
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 3
Met Glu Met Glu Glu Gly Phe Lys Gly Leu Leu Arg Leu Ile Gly Ser
1 5 10 15
Val Lys Asn Tyr Asp Trp Gly Arg Thr Ala Lys Glu Ser Cys Val Gly
20 25 30
Arg Leu Tyr Arg Leu Asn Ser Arg Thr Lys Ile Asp Glu Lys Gln Pro
35 40 45
Tyr Ala Glu Phe Trp Met Gly Thr His Asp Ser Gly Pro Ser Tyr Ile
50 55 60
Val Val Glu Arg Gly Gly Arg Ile Gln Asn Gly His Ala Asn Gly Gly
65 70 75 80
Gly Ile Arg Asp Lys Cys Ser Leu Lys Asp Trp Ile Gln Lys Asn Pro
85 90 95
Ser Val Leu Gly Glu Thr Val Leu Ala Lys Trp Gly Thr Gln Leu Pro
100 105 110
Phe Leu Phe Lys Val Leu Ser Ile Glu Lys Ala Leu Ser Ile Gln Ala
115 120 125
His Pro Asp Lys Asp Leu Ala Ile Leu Leu His Lys Glu Gln Pro Leu
130 135 140
Val Tyr Lys Asp Asp Asn His Lys Pro Glu Met Ala Leu Ala Leu Thr
145 150 155 160
Lys Phe Glu Ala Leu Cys Gly Phe Ile Ser Leu Glu Glu Leu Lys Val
165 170 175
Ile Val Gln Thr Val Pro Glu Ile Val Glu Val Val Gly Asn Ala Leu
180 185 190
Ala Glu Leu Val Leu Asp Leu Ser Glu Asp Asp Glu Glu Glu Lys Gly
195 200 205
Lys Leu Val Leu Arg Lys Leu Phe Thr Glu Ile Met Ser Ala Ser Lys
210 215 220
Asp Val Ile Thr Glu Val Leu Ala Lys Leu Ile Ser Arg Leu Asn Ile
225 230 235 240
Lys Asn Lys Val Arg Val Leu Thr Asp Lys Glu Gln Leu Val Leu Gly
245 250 255
Leu Glu Lys Gln Tyr Pro Ser Asp Val Gly Val Leu Ala Ala Phe Leu
260 265 270
Phe Asn Tyr Val Lys Leu Asn Pro Gly Glu Ala Leu Tyr Leu Gly Ala
275 280 285
Asn Glu Pro His Ala Tyr Val Tyr Gly Glu Cys Val Glu Cys Met Ala
290 295 300
Thr Ser Asp Asn Val Val Arg Ala Gly Leu Thr Pro Lys His Arg Asp
305 310 315 320
Val Arg Thr Leu Cys Ser Met Leu Thr Tyr Arg Gln Gly Asn Pro Glu
325 330 335
Ile Leu His Gly Thr Ala Ile Asn Pro Tyr Thr Val Arg Tyr Leu Pro
340 345 350
Pro Phe Asp Glu Phe Glu Val Asp His Cys Ile Leu Pro Pro Tyr Ser
355 360 365
Thr Val Thr Phe Pro Ser Ala Pro Gly Pro Ser Met Phe Leu Val Met
370 375 380
Gly Gly Glu Gly Thr Met Thr Thr Ser Ala Glu Val Ile Val Val Glu
385 390 395 400
Gly Asp Val Leu Phe Ala Pro Ala Asn Thr Asn Ile Thr Ile Ala Thr
405 410 415
Ser Ser Gly Leu His Leu Tyr Arg Ala Gly Val Asn Ser Arg Phe Phe
420 425 430
Glu Glu
<210> 4
<211> 435
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 4
Met Asp Thr Asp Leu Leu Ser Val Thr Glu Gly Arg Gly Arg Leu Val
1 5 10 15
Arg Leu Met Gly Cys Val Lys Asn Tyr Asp Trp Gly Pro Pro Gly Lys
20 25 30
Glu Ser Arg Val Ala Arg Leu Tyr Ala Cys Asn Ser Gly Asn Tyr Val
35 40 45
Asp Gln Glu Lys Pro Tyr Ala Glu Phe Trp Met Gly Thr His Asp Ser
50 55 60
Gly Pro Ser Tyr Val Val Glu Gly Thr Glu Asn Gly Leu Val Asn Gly
65 70 75 80
Lys Gly Glu Gly His Lys Leu Thr Leu Lys Asn Trp Ile Gln Asn Asn
85 90 95
Pro Asn Val Leu Gly Glu Lys Val Val Lys Lys Trp Gly Thr Asn Leu
100 105 110
Pro Phe Leu Phe Lys Val Leu Ser Val Ala Lys Ala Leu Ser Ile Gln
115 120 125
Ala His Pro Asp Lys Asp Leu Ala Ser Arg Leu His Ser Glu Leu Pro
130 135 140
Asp Val Tyr Lys Asp Asp Asn His Lys Pro Glu Met Ala Leu Ala Leu
145 150 155 160
Thr Glu Phe Glu Ala Leu Cys Gly Phe Ile Ser Leu Glu Glu Leu Lys
165 170 175
Leu Ile Val Gln Thr Val Pro Glu Ile Val Glu Leu Val Gly Thr Ala
180 185 190
His Thr Glu Gln Val Leu Glu Leu Asn Glu Asp Asp Gly Lys Glu Lys
195 200 205
Gly Lys Phe Val Leu Gln Ser Val Phe Thr Glu Leu Met Ser Ala Asn
210 215 220
Lys Asp Val Val Ala Glu Val Ile Ala Lys Leu Ile Ser Arg Leu His
225 230 235 240
Val Lys Asn Gln Ala Arg Glu Leu Thr Glu Lys Glu Gln Val Val Leu
245 250 255
Arg Leu Glu Lys Gln Tyr Pro Ala Asp Ile Gly Val Leu Ala Ala Phe
260 265 270
Leu Leu Asn Tyr Val Lys Leu Asn Pro Gly Glu Ala Leu Tyr Leu Gly
275 280 285
Ala Asn Glu Pro His Ala Tyr Leu Tyr Gly Asp Cys Ile Glu Cys Met
290 295 300
Ala Thr Ser Asp Asn Val Val Arg Ala Gly Leu Thr Pro Lys His Arg
305 310 315 320
Asp Val Lys Thr Leu Cys Ser Met Leu Thr Tyr Arg Gln Gly Phe Pro
325 330 335
Glu Ile Leu Gln Gly Thr Ala Val Asn Pro His Val Met Arg Tyr Ile
340 345 350
Pro Pro Phe Asp Glu Phe Glu Val Asp Arg Cys Ile Leu Pro Glu Gln
355 360 365
Ser Thr Thr Glu Phe Pro Ser Ile Pro Gly Pro Ser Ile Phe Met Val
370 375 380
Val Glu Gly Glu Gly Thr Leu Thr Ser Ser Ser Asp Glu Ile Ile His
385 390 395 400
Glu Gly Asp Val Leu Phe Ala Pro Ala Asn Thr Asn Ile Thr Val Ser
405 410 415
Thr Ser Ser Gly Leu Gln Leu Tyr Arg Thr Gly Ile Asn Ser Arg Phe
420 425 430
Phe Glu Glu
435

Claims (5)

1. An application of tomato ascorbic acid biosynthesis gene PMI in improving ascorbic acid content in tomato fruits is characterized in that the tomato ascorbic acid biosynthesis gene PMI is PMI1 and/or PMI2, and DNA of ORF of PMI1 is SEQ ID NO:1, the DNA of the ORF of PMI2 is SEQ ID NO:2.
2. the use according to claim 1, wherein PMI1 encodes SEQ ID NO:3, said PMI2 encodes the protein of SEQ ID NO:4, the protein.
3. The use according to claim 1, characterized in that the PMI gene according to claim 1 is used for constructing an expression vector and the constructed expression vector is used for tomato genetic transformation.
4. The use according to claim 3, wherein the method of constructing the expression vector comprises:
designing a full-length gene Primer by utilizing a Primer5, and amplifying in a PCR instrument by taking cDNA of a tomato strain AC as a template to obtain a target fragment; the PCR product is linked to a pEASY-B carrier, the E.coli is transformed by a linked product heat shock method, a 50mg/L Km resistance plate is used for screening positive clones, the positive clones are selected, shake culture is carried out on a shaking table at 37 ℃ for overnight at 200r/min, and the positive clones are selected for sequencing verification after the PCR detection by using a gene specific primer;
secondly, selecting clone shaking bacteria with correct sequence comparison to extract plasmids; xbal and KpnI double-enzyme cut recombinant plasmid for 1.5h;
thirdly, cutting the glue, recycling the glue by using a glue recycling kit to obtain a target fragment, and using T 4 Ligating the target fragment to the pMV2 vector double digested with Xbal and KpnI by ligase; e, converting the escherichia coli by a connection product heat shock method, selecting positive clones, carrying out PCR positive detection on the monoclonal by using a 35S binding gene reverse specificity primer, selecting positive clone shaking bacterium extracting plasmid, and transferring the positive clone shaking bacterium extracting plasmid into agrobacterium competent C58 cells by an electric shock method after double enzyme digestion verification is correct;
step four, selecting positive clones, shake culturing overnight at 150r/min on a shaking table at 28 ℃, and carrying out PCR positive detection on bacterial liquid by using a 35S gene-added reverse specific primer on a carrier; adding glycerol into positive clone, mixing, and storing in-70deg.C low temperature refrigerator.
5. The method of claim 4, wherein in the first step, the PCR amplification method comprises:
adopting a 10 mu L reaction system, taking EF1a as an internal reference, and carrying out measurement and analysis by a Roche fluorescence quantitative PCR instrument LC480, wherein the system comprises 0.5 mu L of a front primer and a reverse primer respectively and 4 mu L of a template, wherein the Premix Ex TaqTM is 2X 5 mu L;
each sample was repeated three times and the reaction procedure: pre-denaturation at 95 ℃ for 5min; and (3) carrying out melting curve analysis after 45 cycles at 95 ℃ for 10s and 58 ℃ for 1min, and determining the specificity of the PMI1 and PMI2 genes.
CN202210403837.5A 2022-04-18 2022-04-18 Tomato ascorbic acid biosynthesis gene PMI and application Active CN114854779B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210403837.5A CN114854779B (en) 2022-04-18 2022-04-18 Tomato ascorbic acid biosynthesis gene PMI and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210403837.5A CN114854779B (en) 2022-04-18 2022-04-18 Tomato ascorbic acid biosynthesis gene PMI and application

Publications (2)

Publication Number Publication Date
CN114854779A CN114854779A (en) 2022-08-05
CN114854779B true CN114854779B (en) 2024-02-09

Family

ID=82632172

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210403837.5A Active CN114854779B (en) 2022-04-18 2022-04-18 Tomato ascorbic acid biosynthesis gene PMI and application

Country Status (1)

Country Link
CN (1) CN114854779B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111560388A (en) * 2020-06-12 2020-08-21 武汉楚为生物科技股份有限公司 Gene for promoting synthesis of tomato ascorbic acid and application thereof
CN112301040A (en) * 2020-11-09 2021-02-02 华中农业大学 Gene for regulating and controlling accumulation of tomato ascorbic acid and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111560388A (en) * 2020-06-12 2020-08-21 武汉楚为生物科技股份有限公司 Gene for promoting synthesis of tomato ascorbic acid and application thereof
CN112301040A (en) * 2020-11-09 2021-02-02 华中农业大学 Gene for regulating and controlling accumulation of tomato ascorbic acid and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Arabidopsis Phosphomannose Isomerase 1, but Not Phosphomannose Isomerase 2, Is Essential for Ascorbic Acid Biosynthesis;Takanori Maruta等;《THE JOURNAL OF BIOLOGICAL CHEMISTRY》;第283卷(第43期);第28842页左栏第1段 *
Biosynthetic Gene Pyramiding Leads to Ascorbate Accumulation with Enhanced Oxidative Stress Tolerance in Tomato;LI, X. J.等;《Int. J. Mol. Sci.》;第20卷;第1558篇第3页倒数第1-2段，第4页图1 *
XM_004232304.4;genbank;《genbank》;全文 *
XM_004233441.4;genbank;《genbank》;全文 *

Also Published As

Publication number Publication date
CN114854779A (en) 2022-08-05

Similar Documents

Publication Publication Date Title
CN105602911B (en) Soybean PUB E3 ubiquitin ligase GmPUB8 and coding gene and application thereof
Yamada et al. Preferential accumulation of betaine uncoupled to choline monooxygenase in young leaves of sugar beet–importance of long-distance translocation of betaine under normal and salt-stressed conditions
CN113957086B (en) Application of SlBIN2 gene in regulation and control of tomato fruit ripening and carotenoid synthesis
CN109295070A (en) A kind of and paddy rice anti contravariance related gene OsDTH1 and its coding albumen and application
Morita et al. Identification and expression analysis of non-photosynthetic Rubisco small subunit, OsRbcS1-like genes in plants
CN109563519A (en) Increase plant growth and yield using thioredoxin sequence
CN110184279A (en) New a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum
KR20190143157A (en) Transgenic plant having improving nitrogen availability and its manufacturing method
CN114854779B (en) Tomato ascorbic acid biosynthesis gene PMI and application
CN109337884B9 (en) Pyruvate kinase gene and application thereof
CN113801871B (en) Function and application of SiLCYE for regulating and controlling anabolism of zeaxanthin and other millet carotenoids
CN109837265A (en) The method for improving drought tolerance in plants ability
CN114606248A (en) Litchi sucrose non-fermented protein kinase 1 alpha gene and application thereof
CN104017781B (en) Agipanthus Plant hormones regulators,gibberellins synthesis dioxygenase APGA20ox albumen and encoding gene and probe
CN111154772B (en) Pear sugar transport gene PbSWEET4 and application thereof
Chang et al. Cloning and characterization of the 14-3-3 protein gene from Ipomoea batatas (L.) Lam
JP5856283B2 (en) Expression constructs and processes for enhancing carbon, nitrogen, biomass and output of plants
US20060212960A1 (en) Manipulation of ascorbic acid levels in plants
ES2358643T3 (en) POPULATION OF TRANSGENIC PLANTS, MATERIAL DERIVED FROM THE SAME, COLLECTION OF CORRESPONDING PLASID AND POPULATION OF TRANSFORMED GUESTS ORGANISMS, AS WELL AS THEIR USE AND METHODS FOR THEIR GENERATION.
CN112391405A (en) Application of tea tree hexokinase CsHXK3 gene in regulation of plant growth and development and enhancement of cold resistance
CN116970053B (en) Plant carotenoid synthesis related protein DcAPRR2, and coding gene and application thereof
CN109438563A (en) A kind of tobacco KUP7 albumen and its encoding gene and application
CN114015666B (en) Application of OsPARP3 gene in regulation and control of plant drought tolerance
CN113528567B (en) Use of FBA8 protein or protein derived therefrom for regulating vascular bundle division and/or rachis cross-sectional area in plants
Zeng et al. Cloning and expression analysis of tomato SlSPS1 gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant