CN114836474A

CN114836474A - Construction of grass carp ctnnb1 gene overexpression lentivirus and application thereof in improving utilization capacity of fish hepatocyte sugar

Info

Publication number: CN114836474A
Application number: CN202210583515.3A
Authority: CN
Inventors: 罗智; 徐一闯; 谭肖英; 赵涛; 魏晓雷; 宋玉峰; 郑华
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-05-25
Filing date: 2022-05-25
Publication date: 2022-08-02
Anticipated expiration: 2042-05-25
Also published as: CN114836474B

Abstract

The invention discloses a construction of grass carp ctnnb1 gene overexpression lentivirus and application thereof in improving the utilization capacity of fish hepatocyte sugar. The invention obtains grass carp ctnnb1 overexpression lentivirus by constructing recombinant lentivirus containing ctnnb1 gene of coding beta-catenin protein, the lentivirus can efficiently infect L8824 cells and successfully introduce ctnnb1 sequence into the genome of host cells, and the recombinant grass carp liver cell line L8824-beta-catenin capable of stably overexpressing ctnnb1 is obtained. The sugar utilization capacity of grass carp liver cells can be effectively improved by over-expression of ctnnb1, and the in-vivo experiment verifies that the expression level of ctnnb1 is related to the sugar utilization capacity of grass carp livers, so that an effective target is provided for researching and improving the sugar utilization capacity of fish livers, and the sugar utilization capacity of grass carp livers has great significance for improving the production performance of fishes and reducing the cost of aquatic feeds.

Description

Construction of grass carp ctnnb1 gene overexpression lentivirus and application thereof in improving utilization capacity of fish hepatocyte sugar

Technical Field

The invention relates to the technical field of fish biology, in particular to construction of a grass carp ctnnb1 gene overexpression lentivirus and application thereof in improving the utilization capacity of fish hepatocyte sugar.

Background

The sugar is an important cheap energy substance in the fish compound feed, and the proper addition of the sugar substance can not only reduce the feed cost, but also reduce the consumption of protein, and is beneficial to the activation of amino acid and the promotion of the growth of fish. However, unlike mammals, fish have a low ability to utilize sugars, often manifested as "glucose intolerance", which limits the use of sugars in fish feed. Improving the utilization capability of the fish to the saccharides is beneficial to reducing the feed cost and increasing the production performance of the fish. The existence of partial genes in animal bodies can regulate the digestion, absorption and metabolism capability of the bodies on carbohydrate substances in the feed. The liver is the fish metabolic reaction center and the main place for fish to metabolize glucose, and a large amount of sugar metabolic enzymes such as glucose transporters exist in the liver of fish: sodium/glucose transporter 1(SGLT 1); key enzymes in the glycolytic pathway: glucokinase (GK), Pyruvate Kinase (PK); major enzymes in the gluconeogenic pathway: phosphoenolpyruvate Carboxykinase (PEPCK). The glycolysis pathway is the only pathway for glucose decomposition of all tissues and organs of a fish body, while the gluconeogenesis pathway relates to the process of catalytically synthesizing glucose by a non-sugar substrate, and the regulation of the two pathways plays an important role in the utilization of sugars by the liver.

Beta-catenin, an intracellular protein, is considered to be the core protein of the canonical Wnt/beta-catenin signaling pathway, which is also an effector of this pathway, and its functioning depends on the accumulation of beta-catenin in the nucleus. Beta-catenin is mainly responsible for transmitting Wnt signals from cytoplasm to nucleus, and is used as a transcription coactivator to be combined with a T cell specific transcription factor/lymphokines so as to regulate and control the expression of target genes at the downstream of the signal path. Beta-catenin is very conservative in evolution, and the similarity of beta-catenin of different species is very high. Beta-catenin participates in various biological processes such as regulation of cell cycle, apoptosis, proliferation, differentiation, metabolism, oxidative stress and the like. Meanwhile, the beta-catenin plays an important role in the aspects of growth, development, regeneration, metabolism and the like of the liver and plays an important role in the life activity of the liver.

In conclusion, the fish liver plays a very important role in carbohydrate metabolism, and the liver metabolism is influenced by the change of the expression amount and activity of the beta-catenin. In addition, various components in the feed have very obvious influence on the expression amount and activity of the beta-catenin. The research on the molecular action of the beta-catenin in the liver cells is very important for promoting the utilization of liver saccharides and reducing the cost of feed. Therefore, the establishment of the grass carp liver cell line stably overexpressing the beta-catenin has very important significance for researching the utilization of sugar by the beta-catenin regulation liver cells, and provides an important target for improving the utilization capacity of the fish liver to the sugar.

At present, reports about the application of establishing a stable over-expression cell line through lentivirus infection and improving the utilization capacity of liver cells to saccharides by improving the level of beta-catenin in economic fish are not found.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a construction method of grass carp ctnnb1 gene overexpression lentivirus and application thereof in improving the utilization capacity of fish hepatocyte sugar; the invention efficiently and conveniently realizes the stable over-expression of the ctnnb1 gene in the grass carp liver cell line L8824, thereby improving the sugar utilization capability of the grass carp liver cell line and providing a very effective target for improving the sugar utilization capability of fish livers. Meanwhile, the in-vivo glucose injection experiment result shows that the ctnnb1 gene level in grass carp liver is obviously related to the expression level of a key gene-gk in glycolysis pathway and a key gene-pepeck in gluconeogenesis pathway, and then the correlation between the beta-catenin level in liver and the sugar utilization capability of liver is verified again from the protein level. The method shows that the protein level of the beta-catenin has correlation with the sugar utilization capability of grass carp livers, and also shows that the sugar utilization capability of the grass carp livers can be judged by measuring the protein level of the beta-catenin. In addition, the invention also provides guidance for the application of the over-expressed lentivirus in other economic fish cell lines.

In order to achieve the aim, the invention designs a construction method of a grass carp ctnnb1 gene overexpression lentivirus, which comprises the following steps:

1) construction of ctnnb1 gene overexpression lentiviral vector

a. Using full-length cDNA of grass carp as a template, and adopting the following ctnnb1 PCR amplification primers to obtain a ctnnb1 PCR product through PCR reaction; wherein, the PCR amplification primer ctnnb1 is as follows:

ctnnb1 upstream primer:

atagaagacaccgactctagaatggctacccaatctgacttgatg (shown in SEQ ID NO: 1);

ctnnb1 downstream primer:

ctcaccatggtggcgaccggtcagatcggtatcaaaccaggc (shown in SEQ ID NO: 2);

carrying out double enzyme digestion on the pLV-eGFP lentiviral expression vector by using restriction endonucleases XbaI and Age I to obtain a linearized pLV-eGFP lentiviral expression vector;

c. recombining the ctnnb1 cDNA PCR product with a linearized pLV-eGFP lentiviral expression vector, and transforming the obtained recombinant product into a fresh competent escherichia coli cell to obtain a pLV-eGFP-ctnnb1 lentiviral vector containing a target gene;

2) construction of grass carp ctnnb1 gene overexpression lentivirus

The pLV-eGFP-ctnnb1 lentivirus vector, the lentivirus packaging auxiliary vector pSPAX2 plasmid and the pMD2.G plasmid are co-transfected into human embryonic kidney cell HEK293T cells at the same time, the virus is packaged in the cells, the packaged virus can be secreted into a culture medium outside the cells, the culture medium is collected, the culture medium is centrifuged to obtain a supernatant, and the supernatant is filtered, centrifuged and concentrated to obtain the grass carp ctnnb1 gene overexpression lentivirus.

Further, in the step 2), the mass ratio of the pLV-eGFP-ctnnb1 lentiviral vector to the lentiviral packaging helper vector pSPAX2 plasmid to the pMD2.G plasmid was 4:3: 1.

the invention also provides application of the grass carp ctnnb1 gene overexpression lentivirus constructed by the method in improving the utilization capacity of fish hepatocyte sugar.

Further, the fish is grass carp.

The invention also provides a recombinant cell line named L8824-beta-catenin capable of stably overexpressing the ctnnb1 gene, wherein the recombinant grass carp liver cell line L8824-beta-catenin contains a ctnnb1 gene capable of stably overexpressing grass carp (exogenous beta-catenin protein coded by the ctnnb1 gene is stably expressed in the cell line); the nucleotide sequence of the ctnnb1 gene is shown as SEQ ID NO. 3.

The invention also provides a construction method of the recombinant grass carp liver cell line L8824-beta-catenin, which comprises the following steps:

1) according to 2-3X 10 ⁵ Inoculating L8824 cells on a 6-well plate at the cell/well density, culturing for 24 hours, discarding the original culture medium, adding 2.5ml of complete culture medium, and continuously culturing until the cell confluence reaches 30-50%;

2) replacing the L8824 cell culture medium with a fresh culture medium containing the grass carp ctnnb1 gene overexpression lentivirus and polybrene constructed by the method of claim 1, and replacing the fresh culture medium containing puromycin after culturing for 24 hours for screening; the recombinant grass carp liver cell line L8824-beta-catenin capable of over-expressing the ctnnb1 gene is obtained (the ctnnb1 gene is the coding gene of beta-catenin protein, so the recombinant cell line is named as L8824-beta-catenin).

The invention also provides application of the recombinant grass carp liver cell line L8824-beta-catenin in improving the utilization capacity of fish liver cell sugar.

Further, the fish is grass carp.

The invention also provides application of the recombinant grass carp liver cell line L8824-beta-catenin in resisting damage of high-concentration glucose to liver cells (after the ctnnb1 gene is stably over-expressed, the grass carp liver cells can better resist damage of the high-concentration glucose to the liver cells).

The principle of the invention is as follows:

1. overexpression of the ctnnb1 gene can improve the capacity of L8824 cells to resist high-concentration glucose-damaged cells and improve the capacity of L8824 cells to utilize sugar.

2. The live glucose injection experiment proves that the glucose tolerance of young grass carp is poor, the relative expression amounts of ctnnb1, gk, pk and pepck genes are determined and found to be obviously changed through Real-time PCR, and the expression amount of ctnnb1 is obviously related to the expression amounts of pk and pepck. The correlation between the level of β -catenin in the liver and the ability of the liver to utilize sugars was then re-verified from the protein level.

The invention has the beneficial effects that:

the ctnnb1 gene overexpression lentivirus of the economic fish is constructed for the first time, the grass carp liver cell line can be efficiently and conveniently infected, and the ctnnb1 gene can be stably overexpressed by the grass carp cell line. The stable overexpression of the ctnnb1 gene can promote the utilization of the saccharides by L8824, thereby providing a very effective target of beta-catenin for improving the utilization capability of the saccharides by fishes. Meanwhile, the result of a living glucose injection experiment shows that the expression level of grass carp liver beta-catenin has correlation with the sugar utilization capability of the liver, and the result shows that the sugar utilization capability of the fish liver can be judged by measuring the expression level of beta-catenin, so that the method has great significance for improving the sugar utilization capability of the fish and reducing the feed cost.

Drawings

FIG. 1 is a pLV-eGFP plasmid map;

FIG. 2 is a map of the pSPAX2 plasmid;

FIG. 3 is a pMD2.G plasmid map;

FIG. 4 is a schematic fluorescence diagram showing the results of L8824 grass carp hepatocytes infected with a ctnnb1 gene overexpression lentivirus and a negative control virus;

FIG. 5 is a diagram showing the relative expression amount of ctnnb1 gene and the expression condition of exogenous beta-catenin protein after L8824 grass carp hepatocytes are infected by ctnnb1 gene overexpression lentivirus and negative control virus;

in the figure, A is a ctnnb1 gene relative expression level graph; b is an exogenous beta-catenin protein expression condition diagram;

FIG. 6 shows the results of the resistance of the ctnnb1 gene to excessive glucose incubation after infecting L8824 grass carp hepatocytes with an overexpressed lentivirus and a control virus;

FIG. 7 shows the results of relative expression amounts of sglt1, gk, pk and pepck genes under glucose incubation conditions after L8824 grass carp hepatocytes were infected with ctnnb1 gene overexpression lentivirus and control virus;

FIG. 8 is a graph showing the change of blood glucose concentration, the level of beta-catenin protein in liver and the relative expression of related genes after intraperitoneal injection of glucose into grass carp;

in the figure, A is a graph of the change rule of the blood sugar of the grass carp after glucose injection; b is a related gene change rule chart in the liver of the grass carp after glucose injection; c is a correlation analysis chart of ctnnb1 expression quantity and gk expression quantity; d is a correlation analysis chart of ctnnb1 expression quantity and pk expression quantity; e is a correlation analysis chart of the ctnnb1 expression quantity and the pepck expression quantity; f is a graph showing the change rule of the protein level of grass carp liver beta-catenin after glucose injection.

Detailed Description

The present invention is described in further detail below with reference to specific examples so as to be understood by those skilled in the art.

Fig. 1 to 8 show an embodiment of the ctnnb1 gene overexpression lentivirus, the construction method thereof and the application of the overexpression ctnnb1 in improving the sugar utilization capability of grass carp liver cells, wherein a grass carp ctnnb1 gene overexpression lentivirus is designed and constructed to efficiently infect L8824 grass carp liver cells and enable the ctnnb1 gene to be stably overexpressed in the L8824 grass carp liver cells, so that the sugar utilization capability of the L8824 cells is effectively improved. Through a glucose injection experiment, grass carp 'glucose intolerance' is identified, the expression level of the ctnnb1 gene is obviously related to the gene expression level of glycolysis key enzyme-Glucokinase (GK) and gluconeogenesis key enzyme-phosphoenolpyruvate carboxykinase (PEPCK), and then the correlation between the level of beta-catenin in the liver and the capability of the liver to utilize sugar is verified again from the protein level.

Example 1

1. Construction of ctnnb1 Gene overexpression Lentiviral vector

The full-length cDNA of grass carp is taken as a template, PCR amplification primers are designed as shown in table 1 (sequence 1 and sequence 2 in the same sequence table), and a PCR product with size of 2343bp is obtained through PCR reaction (the reaction system and conditions are respectively shown in table 2 and table 3). The DNA map of the pLV-eGFP lentiviral expression vector is shown in figure 1, the vector is subjected to double enzyme digestion, restriction enzymes are Xba I and Age I, the enzyme digestion system is shown in table 4, and the enzyme digestion condition is incubation for 2h at 37 ℃. The ctnnb1 cDNA PCR product is recombined with the linearized pLV-eGFP lentiviral expression vector, the recombination reaction system is shown in Table 5, and the reaction condition is incubation for 30min at 37 ℃. The recombinant products were transformed into fresh competent E.coli cells, the transformation system being shown in Table 6.

TABLE 1 ctnnb1 cDNA PCR amplification primers

Name (R)	Sequence of
		ctnnb1 upstream primer	atagaagacaccgactctagaatggctacccaatctgacttgatg (shown as SEQ ID NO: 1)
ctnnb1 downstream primer	ctcaccatggtggcgaccggtcagatcggtatcaaaccaggc (shown as SEQ ID NO: 2)

Description of the primers: contains exchange pairing base, enzyme cutting site (underlined mark) and target gene 5' end part sequence for PCR fishing target gene.

TABLE 2 ctnnb1 cDNA PCR amplification reaction System

Reagent	Volume of
		2×Taq polymerase premix	25μL
Upstream primer
	10. mu.M	1μL
Downstream primer 10. mu.M			1μL
	Grass carp full-length cDNA template	1μL
ddH ₂ O			22μL
	Total of	50μL

TABLE 3 PCR amplification reaction conditions

TABLE 4 pLV-eGFP lentiviral expression vector enzyme digestion reaction system

Reagent	Volume of
		Purified DNA plasmid (1. mu.g/. mu.L)	2μL
Xba Ⅰ(15U/μL)	1μL
		Age Ⅰ(5U/μL)	3μL
10×buffer	5μL
		ddH ₂ O	39μL
Total of	50μL

TABLE 5 recombination reaction system of ctnnb1 cDNA PCR product and linearized pLV-eGFP lentiviral expression vector

Components	Recombination reaction (uL)	Negative control (. mu.L)
			Linearized vector	X	X
PCR products	Y					0
			Recombinant enzyme	2	0
5 × recombinant buffer	4	0
			ddH ₂ O	14-X-Y	20-X
Total of	20	20

Description of the drawings: a) the molar ratio of the added linearized vector DNA and the purified PCR product was 1: 2.

b) The negative control was used to confirm the presence or absence of circular plasmid remaining in the linearized vector.

And (3) carrying out PCR identification (a PCR reaction system is shown in a table 7, and PCR reaction conditions are shown in a table 8) according to the universal primers (shown in a table 6, and a sequence 4 and a sequence 5 in the same sequence table) near the insertion site of the pLV-eGFP lentiviral expression vector, sequencing and comparing the clones with positive PCR identification, wherein the clones with correct comparison are the successfully constructed lentiviral expression vector containing the ctnnb1 gene sequence, and the vector is named as the pLV-eGFP-ctnnb1 lentiviral vector.

TABLE 6 PCR identification of primer sequences

Name (R)	Sequence of
		Upstream (CMV-F)	cgcaaatgggcggtaggcgtg (shown as SEQ ID NO: 4)
Downstream (WPRE-R)	cgtcgccgtccagctcgaccag (shown as SEQ ID NO: 5)

TABLE 7 PCR identification reaction System

Reagent	Volume of
		2×Taq polymerase premix	12.5μL
Upstream primer (CMV-F) 10. mu.M	0.5μL
		Downstream primer (WPRE-R) 10. mu.M	0.5μL
Form panel	0.5μL
		ddH ₂ O	11μL
Total of	20μL

TABLE 8 PCR identification reaction conditions

2. Construction of grass carp ctnnb1 gene overexpression lentivirus

The plasmid pLV-eGFP-ctnnb1 lentiviral vector plasmid, the lentiviral packaging auxiliary vector pSPAX2 plasmid (the DNA map is shown in figure 2) and the pMD2.G plasmid (the DNA map is shown in figure 3) are extracted by using a plasmid extraction kit of an OMEGA company, the plasmids are dissolved in a TE buffer, and the concentration and the purity of the plasmids are determined by using ultraviolet absorption, so that the A260/A280 of all the plasmids is ensured to be between 1.8 and 2.0. 16-24h before transfection, the cell density is 1X 10 ⁶ Cell/well human embryonic Kidney cell 293T cells were seeded in 6-well plates and 293T cells were cultured in DMEM medium containing 10% fetal bovine serum at 37 ℃ with 5% CO ₂ The cell is cultured in the incubator, and transfection is carried out when the cell density reaches 70-80% after 18-24 h. The cell culture medium was changed to serum-free medium 2-4h before transfection. Respectively preparing a mixture solution of the plasmid and the Opti-MEM and a mixture solution of the Lipofectamine2000 and the Opti-MEM in a sterilized centrifuge tube, wherein the required amounts of the lentivirus overexpression plasmid and the lentivirus packaging auxiliary vector in each well are respectively as follows: pLV-eGFP-ctnnb1 plasmid 1.2. mu.g, pSPAX2 plasmid 0.9. mu.g and pMD2.G plasmid 0.3. mu.g, the amount of Lipofectamine2000 required per well was 5. mu.L, and the two mixed solutions were incubated at room temperature for 5min and then mixed, i.e., the diluted plasmid was mixed with the diluted Lipofectamine2000 and incubated at room temperature for 20min to form a plasmid-Lipofectamine 2000 transfection complex. The complex was added to 293T cell culture medium at 37 ℃ with 5% CO ₂ The culture medium containing the transfection complex is discarded after 4-8h of incubation in the incubator. Each time2.5mL of fresh DMEM medium containing 10% fetal calf serum was added to the wells, and then the mixture was incubated at 37 ℃ with 5% CO ₂ The culture box is used for culturing for 48 hours. After 48h, 293T cell supernatant was collected, centrifuged at 3000g for 10min at 4 ℃ to remove cell debris, and the centrifuged supernatant was passed through a 0.45 μm filter. The filtered virus solution is centrifuged for 1.5h under the condition of 30000g to concentrate the virus solution, the supernatant is discarded, and DMEM with 1% volume of the original virus solution is added to suspend virus particles based on the weight.

Example 2

1. Method for constructing recombinant grass carp liver cell line L8824-beta-catenin by infecting L8824 grass carp liver cell line with lentivirus

According to 2-3X 10 ⁵ Cell/well Density L8824 cells were inoculated in 6-well plates, after 16-24h of culture the cell fusion degree reached about 30% -50%, the original culture medium was discarded, 2.5mL of fresh DMEM medium containing virus solution and polybrene at final concentration of 8-10 μ g/mL was added again, 5% CO at 37 deg.C ₂ After culturing for 12 hours, the medium containing the virus solution was discarded, 2.5mL of fresh M199 medium containing 10% fetal calf serum was added thereto, and the mixture was incubated at 28 ℃ with 5% CO ₂ The cultivation was continued for 60 h. L8824 cells were subjected to fluorescent microscopy to observe the overexpression of the ctnnb1 gene 72h after infection with the overexpressed lentivirus. After satisfactory overexpression, the medium is discarded and fresh M199 medium containing puromycin at a final concentration of 2-3. mu.g/mL is added at 28 ℃ with 5% CO ₂ The culture box is continuously cultured until all L8824 cells which are not infected with the over-expression lentivirus group die, the L8824 cells which survive in the over-expression lentivirus group are the L8824 cells which successfully over-express the ctnnb1 gene, and the ctnnb1 gene is the coding gene of the beta-catenin protein, so the recombinant grass carp liver cell line is named as L8824-beta-catenin, and the L8824-beta-catenin cells can stably over-express the grass carp ctnnb1 gene; the nucleotide sequence of the ctnnb1 gene is shown as SEQ ID NO. 3; the fluorescence diagram of the recombinant grass carp liver cell line L8824-beta-catenin is shown in figure 5.

2. Real-time PCR determination of relative expression level of ctnnb1 gene in cells

Extracting cell RNA and reverse transcribing to obtain cDNA. The relative expression level of ctnnb1 gene was determined by Real-time PCR.

2.1 RNA extraction

(a) 1mL of Trizol was added, the mixture was decomposed with shaking for 1 minute, then lysed at room temperature for 5 minutes, and transferred to a 1.5mL centrifuge tube.

(b) 200 microliters of chloroform was added, shaken for 10 seconds and then allowed to stand at room temperature for 5 minutes.

(c) Centrifuge at 12000g for 15 min at 4 ℃.

(d) And sucking the supernatant, transferring the supernatant into a 1.5mL centrifuge tube, adding isopropanol with the same volume, shaking, uniformly mixing, and standing for 10 minutes.

(e) Centrifuge at 12000g for 10min at 4 ℃.

(f) The supernatant was discarded and the precipitate was washed with 1mL of 75% ethanol.

(g) Centrifuge at 12000g for 5min at 4 ℃.

(h) The supernatant was discarded, the RNA precipitate was dried to transparency, an appropriate amount of DEPC water was added to dissolve the RNA, and the RNA concentration was determined using an ultraviolet spectrophotometer.

2.2 reverse transcription

(a) Take 1. mu.g of RNA, reconfigure the corresponding reaction system in the PCR tube, the reaction system is shown in Table 9.

TABLE 9 first step reverse transcription reaction System

Reagent	Volume of
		RNA	1μg
Random primer N6/oligo d(T)	1μL
		DEPC water	XμL
Total volume	17.5μL

(b) After 5 minutes of reaction at 70 ℃ the reaction mixture was taken out and iced for 2 minutes.

(c) The corresponding reagents were added to each tube and mixed well, and the reaction system is shown in Table 10.

TABLE 10 second step reverse transcription reaction System

Reagent	Volume of
		5×RT buffer	5μL
dNTPs(100mmol/L)	1μL
		MMLV(200U/μL)	1μL
RNase(40U/μL)	0.5μL
		Total volume	7.5μL

(d) The reaction was carried out at 37 ℃ for 60 minutes, and the reverse transcription was completed after 10 minutes at 70 ℃.

Real-time PCR

Designing a Real-time PCR primer for detecting the expression level of the ctnnb1 gene, wherein the primer sequence is as follows:

ctnnb1 Real-time PCR upstream primer: agaaggtctgcttgccatct (shown in SEQ ID NO: 6),

ctnnb1 Real-time PCR downstream primer: tgaaggcagtctgtcgtgat (shown in SEQ ID NO: 7);

the Real-time PCR amplification system was configured as described in Table 11, and 3 replicates were set.

TABLE 11 Real-time PCR amplification System

Reagent	Volume of
		2×SYRB Green Master	10μL
cDNA	1μL
		Upstream primer
10. mu.M	2μL
		Downstream primer 10. mu.M	2μL
ddH ₂ O	5μL
		Total volume	20μL

The Real-time PCR amplification reaction was carried out according to the conditions described in Table 12

TABLE 12 Real-time PCR amplification reaction conditions

And (3) calculating the relative expression quantity of the gene by using beta-actin and gapdh as internal references and adopting a 2-delta-Ct calculation method. The results are shown in fig. 5, the levels of ctnnb1 gene in the over-expressed group are significantly increased relative to the blank control group, indicating that the ctnnb1 gene is stably over-expressed in L8824-beta-catenin cells.

3. Western blot detection of beta-catenin protein overexpression level in cells

Taking L8824-beta-catenin cells with good growth state and L8824 cells containing blank carriers, discarding the culture medium, washing with precooled PBS for 3 times, discarding the PBS, adding a mixture of a proper amount of precooled RIPA lysis buffer and PMSF with a final concentration of 1mM, scraping the cells with a cell scraper, transferring the mixture into a centrifuge tube, and incubating on ice for 20 min. After the incubation, the mixture was centrifuged at 12000g at 4 ℃ for 10min, the supernatant was collected, and 5 SDS-PAGE loading buffer in the volume of 1/4 supernatant was mixed with the supernatant and placed in a boiling water bath for 10 min. The denatured protein samples were stored at-80 ℃. Preparing SDS-PAGE gel, after the gel is solidified, loading the denatured protein, and then carrying out electrophoresis under the conditions that the constant voltage is firstly 80V and the running is carried out for 20min, and then the voltage is increased to 120V and the running is continuously carried out for 100 min. After the electrophoresis is finished, the membrane is transferred under the condition of constant current 300mA, the electricity is transferred for 120min, and the protein is transferred to the PVDF membrane. The PVDF membrane was blocked with a blocking solution (TBST containing 8% skim milk) for 1h at room temperature. GFP antibody was diluted with blocking solution, and the blocked PVDF membrane was incubated with the antibody at 4 ℃ overnight. After the primary antibody incubation was completed, the PVDF membrane was washed with TBST four times for 10min each. The corresponding diluted secondary antibodies were then incubated for 1h at room temperature. The PVDF membrane was washed four times with TBST for 10min each. After the washing is finished, ECL luminous liquid is used for developing the eGFP-beta-catenin/eGFP on the PVDF membrane. As shown in FIG. 5, the eGFP-beta-catenin/eGFP protein band is clear, and the eGFP-beta-catenin/eGFP protein is proved to be stably expressed in the recombinant grass carp liver cell line L8824-beta-catenin.

4. CCK-8 method for detecting influence of glucose incubation with different concentrations on activity of L8824-beta-catenin cells

L8824 cell suspension (100. mu.L/well) was seeded in 96-well plates. After culturing for 16-24h, the cell fusion degree reaches about 70%, the original culture medium is discarded, 100 mu L/hole of fresh culture medium is added again, glucose is added to ensure that the glucose concentration in the culture medium reaches 0,10,20,40,80,160 and 320mM respectively, and after culturing for 12 hours, 10 mu LCCK-8 solution is added into each hole. After incubation in the incubator for 1-4 hours, absorbance at 450nm was measured with a microplate reader. And cell viability was calculated according to the formula:

cell viability (%) - [ absorbance (glucose treatment) -absorbance (blank) ]/[ absorbance (0 glucose) -absorbance (blank) ] × 100.

As shown in FIG. 6, when the concentration of glucose in the culture medium reaches 320mM, the activity of the recombinant grass carp liver cell line L8824-beta-catenin is significantly higher than that of the L8824 cell containing only a blank carrier, and the L8824-beta-catenin cell capable of increasing the protein level of the beta-catenin is proved to be capable of better resisting the damage of high-concentration glucose to the liver cells.

5. Relative expression quantity result of glucose metabolism related gene of L8824-beta-catenin cell under glucose incubation condition

Recombinant grass carp liver cell line L8824-beta-catenin suspension (1 mL/well) was inoculated into 12-well plates. After culturing for 16-24h, the cell fusion degree reaches about 70%, the original culture medium is discarded, 1 mL/hole of fresh culture medium is added again, glucose is added to enable the glucose concentration in the culture medium to reach 20mM, and the culture is continued for 12 hours. After the culture is finished, extracting cell RNA according to the method, and carrying out reverse transcription to obtain cDNA. Relative expression levels of sglt1, gk, pk and pepck genes were determined by Real-time PCR.

Real-time PCR primers for detecting the expression levels of sglt1, gk, pk and pepck genes are designed, and the primer sequences are as follows:

sglt1 Real-time PCR upstream primer: gctcttcgtgcccatctaca (shown in SEQ ID NO: 8),

sglt1 Real-time PCR downstream primer: tcactgggaatcttgccgtc (shown in SEQ ID NO: 9),

gk Real-time PCR upstream primers: tcactgggaatcttgccgtc (shown in SEQ ID NO: 10),

gk Real-time PCR downstream primers: gaggagtcatttcccgcaca (shown in SEQ ID NO: 11),

pk Real-time PCR upstream primer: acgggtcggttatctggttg (shown in SEQ ID NO: 12),

pk Real-time PCR downstream primer: ttgcgacttcccagaatccc (shown in SEQ ID NO: 13),

pepck Real-time PCR upstream primer: ggccctgtgaactcttctct (shown in SEQ ID NO: 14),

pepck Real-time PCR downstream primers: tctctgggttacaaggccag (shown in SEQ ID NO: 15);

and (3) calculating the relative expression quantity of the gene by using a 2-delta Ct calculation method by taking beta-actin and gapdh as internal references. The results are shown in fig. 7, after glucose incubation, the gene expression levels of gk and pk in the L8824 cells are increased, the gene expression level of pepeck is decreased, and the overexpression of the ctnnb1 gene can further increase the gene expression levels of gk and pk in the recombinant grass carp liver cell line L8824-beta-catenin and further decrease the gene expression level of pepeck. The method shows that the sugar utilization capability of grass carp hepatocytes can be improved by increasing the protein level of the beta-catenin.

Example 3

1. Abdominal injection glucose for grass carp

Three repeated groups are set in the experiment, the test fish is young grass carp, the glucose injection experiment is carried out after temporary rearing for two weeks, and the fish is fasted for 24 hours before the injection experiment is started. Before injection, the young grass carp was anesthetized with MS222, and 1670mg/kg of glucose was injected into the abdominal cavity from the ventral fin base of the young grass carp using a syringe.

2. Determination of grass carp blood sugar

Blood was collected from the tail vein of grass carp at 1, 2, 4, 8, 12 hours after glucose injection, centrifuged at 4000 rpm for 10 minutes, serum was collected, and the glucose content in the serum was measured. As shown in fig. 8, the blood glucose value of the young grass carp reaches the maximum value 1 hour after the glucose injection, and the blood glucose level does not return to the level before the injection until 8 hours after the glucose injection, which reflects that the young grass carp has poor glucose utilization. (blood sugar determination operation reference: the national people's republic of China sanitary industry Standard WS/T350-.

3. Relative expression quantity determination of ctnnb1, sglt1, gk, pk and pepck genes in grass carp liver tissue

Collecting liver tissue samples of

young grass carp

1, 2, 4, 8 and 12 hours after glucose injection, extracting liver tissue RNA according to the method, carrying out reverse transcription on the extracted RNA samples, and carrying out Real-time PCR experiment.

The relative expression quantity of genes is calculated by adopting a 2-delta Ct calculation method by taking beta-actin and gapdh as internal references, as shown in figure 8, after young grass carps are injected with glucose, the relative expression quantities of ctnnb1, gk, pk and pepck genes are remarkably changed, wherein the expression quantity of ctnnb1 is highest at 8 hours of injection, the expression quantities of gk and pk are highest at 4 hours of injection, the expression quantity of pepck is lowest at 4 hours and 8 hours of injection, and the expression quantity of ctnnb1 is remarkably related to the expression quantities of pk and pepck.

4. Determination of expression quantity of beta-catenin protein in grass carp liver tissue after glucose injection

Collecting liver tissues of young grass carp fishes 1, 2, 4, 8 and 12 hours after glucose injection, washing with precooled PBS for 3 times, discarding PBS, adding a mixture of a proper amount of precooled RIPA lysis buffer and PMSF with a final concentration of 1mM, crushing the tissues, transferring the mixture into a centrifuge tube, and incubating for 20min on ice. After the incubation, the mixture was centrifuged at 12000g at 4 ℃ for 10min, the supernatant was collected, and 5 SDS-PAGE loading buffer in the volume of 1/4 supernatant was mixed with the supernatant and placed in a boiling water bath for 10 min. The denatured protein samples were stored at-80 ℃. Preparing SDS-PAGE gel, after the gel is solidified, loading the denatured protein, and then carrying out electrophoresis under the conditions that the constant voltage is firstly 80V and the running is carried out for 20min, and then the voltage is increased to 120V and the running is continuously carried out for 100 min. After the electrophoresis is finished, the membrane is transferred under the condition of constant current 300mA, the electricity is transferred for 120min, and the protein is transferred to the PVDF membrane. The PVDF membrane was blocked with a blocking solution (TBST containing 8% skim milk) for 1h at room temperature. Diluting the beta-catenin antibody by the blocking solution, incubating the blocked PVDF membrane by the antibody, and incubating overnight at 4 ℃. After the primary antibody incubation was completed, the PVDF membrane was washed with TBST four times for 10min each. The corresponding diluted secondary antibodies were then incubated for 1h at room temperature. The PVDF membrane was washed four times with TBST for 10min each. And after the washing is finished, developing the beta-catenin on the PVDF film by using ECL luminous liquid. As shown in fig. 8, β -catenin protein levels first increased with increasing time after glucose injection until reaching a maximum at hour 8 and decreased again by hour 12. The correlation between the level of beta-catenin in the liver and the expression level of pk and pepck is verified again from the protein level.

Other parts not described in detail are prior art. Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

Construction of <120> grass carp ctnnb1 gene overexpression lentivirus and application thereof in improvement of fish hepatocyte sugar utilization capacity

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atagaagaca ccgactctag aatggctacc caatctgact tgatg 45

<210> 2

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctcaccatgg tggcgaccgg tcagatcggt atcaaaccag gc 42

<210> 3

<211> 2343

<212> DNA

<213> grass carp (Ctenophaggodon idella)

<400> 3

atggctaccc aatctgactt gatggagctg gacatggcca tggagccgga tcgcaaggct 60

gcggtcagcc attggcagca gcagtcttac ctggactcag gtatccactc tggggccaca 120

accactgccc catccctgag tggcaagggc aacccagagg atgaagatgt ggataatcag 180

gtgctttatg agtgggagca gggctttaac cagtccttca accaggagcc ggtagcagac 240

attgatggtc agtacgccat gaccagagcc cagagagtcc gggcggccat gttccccgag 300

actctagatg agggcatgca gataccttcc acacagtttg actctgctca ccccaccaat 360

gtccagcgcc tggccgagcc ctcgcagatg ctcaaacacg ccgtggtcaa cctcatcaac 420

taccaggacg atgcagagct ggccacccgt gccattccag agctcaccaa actactgaat 480

gatgaggatc aggtggtggt taataaggca gctgtgatgg tgcatcagct ctcgaagaag 540

gaggcctctc gtcacgccat catgcgatcc ccacagatgg tgtcagccat tgtgaggacc 600

atgcagaaca ctagtgatgt agaaacggcc cgctgcacct ccggcaccct gcacaacctt 660

tcccaccaca gagaaggtct gcttgccatc ttcaaatcgg gaggcatccc tgccctcgtc 720

aaaatgcttg gctccccggt ggactctgta ttgttttatg ccattacgac tctacacaac 780

ctgctactgc accaggaagg ggccaagatg gctgtccgtc tggctggagg cctacagaaa 840

atggtggcct tgttaaacaa aacaaatgtg aaattcctcg ccatcacgac agactgcctt 900

cagattctgg catacggaaa tcaggaaagc aaacttatca ttctggccag cggaggccca 960

caggctctgg tcaacatcat gaggacctac acctatgaga aactattgtg gaccaccagt 1020

cgagtgctca aagtgctctc tgtttgctcc agtaacaaac ctgccatcgt tgaggctggt 1080

ggcatgcaag cacttggcct ccatctcaca gaccccagtc agcgactggt acagaactgc 1140

ttgtggactt tgaggaatct ttcagatgct gccaccaaac aggagggtat ggaggggctc 1200

ttgggcaccc tggtccagtt gctcggttca gacgacatca atgtggtgac gtgtgctgct 1260

ggaatcctgt ccaacctcac ctgcaacaac tacaagaaca agatgatggt gtgccaagtg 1320

ggcggcattg aggccctcgt gcgcactgtt cttcgtgccg gagacagaga ggacatcaca 1380

gagcccgcta tctgtgctct ccgtcacctt acttccagac accaggatgc agagatggcc 1440

cagaatgcag tgcggctgca ctatgggctg cctgtggtgg tcaaattact ccaccctccc 1500

tcacattggc ctctcattaa ggccacagtt ggactaatcc gtaacctggc gctgtgccct 1560

gccaaccacg ccccgctcag agagcagggt gccattcccc gcctggtgca gcttctggtc 1620

agggcccatc aggacactca gagacgcacc tccatgggtg gaacacagca gcagtttgtg 1680

gagggtgtgc gaatggagga gattgtggag ggctgcactg gagctctgca cattctagcc 1740

agagacattc ataacagaat tgtcatcaga ggactcaaca ctattccact ttttgttcag 1800

ttgctgtatt ctcctatcga gaacatccag cgtgtggctg caggtgtgct gtgtgagctg 1860

gctcaggata aggaggcagc cgaggccatc gaggcagaag gagccaccgc tcccctcaca 1920

gagctactcc actccagaaa cgagggcgtt gccacgtacg ctgccgcagt tctgttccgc 1980

atgtctgagg ataagcccca ggactacaag aaacgactgt ctgtggagct caccagctct 2040

ctgttcagaa ctgagcccat gacctggaac gagactggag atctagggct ggacatcggt 2100

gcacagggag agcctctagg ctacagacag gacgacccaa gctaccgctc cttccattcc 2160

ggaggttacg ggcaggatgc catgggcatg gatcccatga tggagcacga gatgggcggg 2220

caccaccccg gcccagatta ccccgtagac ggccttcccg acctcggcca cgcccaggac 2280

ctgatcgacg gcctcccgcc aggcgacagc aatcagctgg cctggtttga taccgatctg 2340

taa 2343

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgcaaatggg cggtaggcgt g 21

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgtcgccgtc cagctcgacc ag 22

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agaaggtctg cttgccatct 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgaaggcagt ctgtcgtgat 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gctcttcgtg cccatctaca 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcactgggaa tcttgccgtc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcactgggaa tcttgccgtc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gaggagtcat ttcccgcaca 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

acgggtcggt tatctggttg 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ttgcgacttc ccagaatccc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggccctgtga actcttctct 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tctctgggtt acaaggccag 20

Claims

1. A construction method of grass carp ctnnb1 gene overexpression lentivirus is characterized by comprising the following steps: the method comprises the following steps:

1) construction of ctnnb1 gene overexpression lentiviral vector

a. Using full-length cDNA of grass carp as a template, and adopting the following ctnnb1 PCR amplification primer to obtain a ctnnb1 CDS PCR product through PCR reaction; wherein, the primers for PCR amplification ctnnb1 are as follows:

ctnnb1 upstream primer:

atagaagacaccgactctagaatggctacccaatctgacttgatg；

ctnnb1 downstream primer:

ctcaccatggtggcgaccggtcagatcggtatcaaaccaggc；

c. recombining the ctnnb1 PCR product with a linearized pLV-eGFP lentiviral expression vector, and transforming the obtained recombinant product into a fresh competent escherichia coli cell to obtain a pLV-eGFP-ctnnb1 lentiviral vector containing a target gene;

2) construction of grass carp ctnnb1 gene overexpression lentivirus

2. The construction method of the grass carp ctnnb1 gene overexpression lentivirus according to claim 1, which is characterized in that: in the step 2), the mass ratio of the pLV-eGFP-ctnnb1 lentiviral vector to the lentiviral packaging helper vector pSPAX2 plasmid to the pMD2.G plasmid is 4:3: 1.

3. The application of the grass carp ctnnb1 gene overexpression lentivirus constructed by the method in claim 1 in improving the sugar utilization capability of fish hepatocytes.

4. Use according to claim 3, characterized in that: the fish is grass carp.

5. A recombinant cell line L8824-beta-catenin capable of stably overexpressing ctnnb1 gene, which is characterized in that: the recombinant grass carp liver cell line L8824-beta-catenin contains a ctnnb1 gene capable of stably over-expressing grass carp; the nucleotide sequence of the ctnnb1 gene is shown as SEQ ID NO. 3.

6. A construction method of a recombinant grass carp liver cell line L8824-beta-catenin is characterized by comprising the following steps: the method comprises the following steps:

2) replacing the L8824 cell culture medium with a fresh culture medium containing the grass carp ctnnb1 gene overexpression lentivirus and polybrene constructed by the method of claim 1, and replacing the fresh culture medium containing puromycin after culturing for 24 hours for screening; obtaining the recombinant grass carp liver cell line L8824-beta-catenin capable of over-expressing the ctnnb1 gene.

7. The use of the recombinant grass carp liver cell line L8824-beta-catenin as defined in claim 5 or 6 for improving the sugar utilization capacity of fish liver cells.

8. Use according to claim 7, characterized in that: the fish is grass carp.

9. The use of the recombinant grass carp liver cell line L8824-beta-catenin as defined in claim 4 or 5 in resisting high-concentration glucose damage to liver cells.