CN106177906B

CN106177906B - The application of Ddb1 albumen

Info

Publication number: CN106177906B
Application number: CN201610547976.XA
Authority: CN
Inventors: 楼慧强; 曹勤红; 张晶晶; 孙海涛
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2016-07-12
Filing date: 2016-07-12
Publication date: 2019-06-25
Anticipated expiration: 2036-07-12
Also published as: CN106177906A

Abstract

The present invention provides the applications of Ddb1 albumen, belong to gene therapy technology field.The present invention is equivalent to the Ddb1 albumen of the mankind, it is found that it is able to suppress growth defect caused by Eco1 gene delection by being overexpressed Mms1 albumen in yeast.Therefore the application in genetic disease drug caused by being lacked the present invention provides Ddb1 albumen in preparation treatment ESCO2 (homologous protein of the Eco1 in people's cell is ESCO1 and ESCO2) gene mutation, missing or ESCO2 protein function, and then treat correlated inheritance disease caused by ESCO2 gene mutation, missing or ESCO2 protein function lack, such as Luo Baici syndrome, with good potential applicability in clinical practice, and significant social benefit can be obtained.

Description

The application of Ddb1 albumen

Technical field

The invention belongs to gene therapy technology fields, specifically, being related to Ddb1 albumen and its lacking in treatment Eco1 gene Application in growth defect caused by mistake.

Background technique

DNA replication dna is the movable basis of all life, and the generation of about 40 kinds of diseases is related to DNA replication dna, at present at least 14 kinds of drug targetings act on the albumen during DNA replication dna.Researching DNA duplication and the relationship of human diseases can be dug from profound level The pathogenetic mechanism of disease is dug, is provided fundamental basis for new drug development and disease treatment.The correct transmitting of inhereditary material is to genome Stability it is most important, sister chromatid adhesion plays an indispensable role wherein.

Sister chromatid adhesion (sister chromatid cohesion, SCC) is that two sister chromatids combine The process establishing adhesion together and dissociating, process are strictly regulated and controled, separation of the foundation of SCC for sister chromatid Correct transmitting with inhereditary material has great importance.The performance of SCC function relies primarily on Fibronectin and its regulatory protein Common to complete, wherein Fibronectin is the quaternary cyclic compounds being made of Smc1, Smc3, Scc1 and Scc3.In the cell cycle The G1 phase, Fibronectin is integrated on chromosome, at this time under the action of negative regulatory factor, in conjunction be it is unstable, it is annular Fibronectin can be slided on chromosome；With the traveling of cell cycle, cell enters the S phase, and transacetylase Eco1 will The Smc3 subunit of Fibronectin carries out acetylation, and the Fibronectin stable bond after acetylation is on chromosome；In the G2 phase, sister Chromatid adhesion, which is stablized, establishes, and the effect of energy antagonism negative regulatory factor；After the later period that cell enters m period, point The Scc1 subunit of Fibronectin is cut from enzyme, Fibronectin is detached from from chromosome, and deacetylase Hos1 is to Smc3 Deacetylation is carried out, two sister chromatids are divided to the two poles of the earth to two daughter cells, it is ensured that the stability of inhereditary material.SCC It is not only involved in DNA replication dna, the various biologicals process such as DNA damage reparation is also required to the participation of SCC.It has been reported that working as SCC Foundation generation problem after, it will cause to include melanoma, colon cancer, embryonal carcinoma, breast cancer, it is more including prostate cancer etc. The generation of kind serious disease.Study the foundation of SCC and the relationship of disease, it will bring new wish to a variety of genetic diseases are treated It hopes.

The foundation of sister chromatid adhesion needs transacetylase Eco1 to participate.Eco1 is the discovery that for the first time in yeast In mutant, this mutant shows the raising of chromosome diminution rate, and also defective in heterochromatin regrouping process.Then, Eco1 is found in other biologies in succession, and is all indispensable gene.Compared by the sequence to Eco1 in different plant species It is different to the N-terminal length of discovery different plant species, but its C-terminal sequence is very conservative, is acetyltransferase activity center.It lacks The cell for losing acetyltransferase activity can generate a large amount of sister chromatid adhesion defect, then lead to death, show Eco1 Major function be its transacetylase effect.

In people's cell, there are the homologous protein ESCO1 and ESCO2 of two kinds of Eco1, this two kinds of albumen can be to Smc3 Acetylation is carried out, but their function is also different, it is not completely redundant.Regardless of lacking which ESCO albumen, another egg The white defect that can not cover completely caused by it.It will lead to a kind of growth error disease after ESCO2 mutation, referred to as Luo Baici is comprehensive It closes disease (Roberts syndrome, RBS).Luo Baici syndrome (Roberts Syndrome) be by and only by ESCO2 Disease caused by the mutation of gene, symptom include patient's growth retardation, limbs generation deformity, hand deformity, craniofacial deformity etc., are gone back It can cause the exception of heart, kidney, genitals and hair.

The transcription product of ESCO2 gene has 3376 nucleotide, and mature mRNA is made of 1806 nucleotide, coding 601 amino acid.ESCO2 albumen n end contains the structural domain in conjunction with chromatin, and C-terminal has acetyltransferase activity.ESCO2 Mutation will lead to Luo Baici syndrome.Except two exceptions, most of mutation is all frameshift mutation or nonsense mutation, causes protein Truncation or non-functional protein.Other two belong to missense mutation, due to the ammonia that transacetylase structural domain is highly conserved Base acid residue is substituted, and acetyltransferase activity is caused to lose.In people's cell, ESCO2 be establish chromatid adhesion must It needs.

Adjusting of the duplication and repair process of DNA by ubiquitination, especially by Cullin 4 (Cul4)-RING The regulation of E3 ubiquitin ligase.All Cullin pass through C- end regions and RING finger protein Rbx1/Hrt1 phase Then E2 ubiquitin binding enzyme is recruited in interaction.The N- terminal domains of the Cullin connector with different types of substrate specificity respectively Albumen (adaptor) interaction.Human genome expresses the homologous protein of two kinds of Cul4: Cul4A albumen and Cul4B albumen, it By N- end regions and Ddb1 protein-interacting, the then adaptor protein phase interaction of Ddb1 albumen and various substrate specificities With.These adaptor proteins (adaptor) are called DCAFs (Ddb1-Cul4associated factors).But it is multiple for DNA The adjustment mechanism that ubiquitination substrate and DCAFs are participated in system and reparation is unclear.

There are two types of currently used gene therapy methods: a kind of method is " in vitro method ", i.e., imports foreign gene external The recipient cell of recombination is fed back patient's body by screening technique appropriate by the recipient cell of culture, allows exogenous gene expression It plays a role, with patients in remission.Another kind is known as " in vivo method ", refers to and directly exogenous DNA is injected in body, DNA can It to inject merely, can also be injected together with adminicle such as liposome, transcribe foreign gene in vivo, translate and play treatment Effect.The gene therapy mode of in vivo method is simpler than in vitro method, direct, economical, and curative effect is also relatively more definite.Common mode is ill Malicious mediation, oligonucleotides direct injection, liposome-mediated and internal gene direct injection etc..

In the prior art, the research for being related to Ddb1 albumen is mainly reflected in the small molecule for reducing Cul4 and Ddb1 interaction Compound is used to prepare or treats the drug of DNA damage correlated condition in animal body, (application number 200980115291.6).Mesh Before be not involved with Ddb1 in terms of genetic disease caused by ESCO2 research report.

Summary of the invention

The purpose of the present invention is for current gene therapy, that there are targetings is inaccurate, needs to develop more treatments Gene provides the relevant gene of genetic disease caused by being mutated to ESCO2 and its application to obtain the status of better curative effect.

To achieve the purpose of the present invention, the present invention (is equivalent to the Ddb1 egg of the mankind by being overexpressed Mms1 in yeast It is white), discovery is overexpressed Ddb1 albumen and is able to suppress growth defect caused by Eco1 gene delection.

In turn, the present invention provides Ddb1 albumen in preparation treatment ESCO2 gene mutation, missing or ESCO2 protein function Application in disease medicament caused by lacking, the Ddb1 albumen contain the amino acid sequence as shown in SEQ ID NO.1.

In above-mentioned application, the disease is Luo Baici syndrome.

The present invention provides the genes of encoding D db1 albumen in preparation treatment ESCO2 gene mutation, missing or ESCO2 albumen Application in disease medicament caused by afunction, the gene of the encoding D db1 albumen contain as shown in SEQ ID NO.2 Nucleotide sequence.

In above-mentioned application, the disease is Luo Baici syndrome.

The present invention provides a kind of protein overexpression promotors in preparation ESCO2 gene mutation, missing or ESCO2 albumen function Application in disease therapeuticing medicine caused by capable of lacking, the protein D db1 albumen contain the ammonia as shown in SEQ ID NO.1 Base acid sequence.

In above-mentioned application, the disease is Luo Baici syndrome.

The present invention provides the biomaterials containing Ddb1 protein coding gene in preparation treatment ESCO2 gene mutation, lacks Application in disease medicament caused by mistake or ESCO2 protein function lack, the Ddb1 protein coding gene contain such as SEQ ID Nucleotide sequence shown in NO.2.

In above-mentioned application, the biomaterial is expression vector or host cell.The disease is comprehensive for Luo Baici Disease.

The present invention also provides the drug containing Ddb1 albumen or its encoding gene, the Ddb1 albumen contains such as SEQ ID Amino acid sequence shown in NO.1；Ddb1 protein coding gene contains the nucleotide sequence as shown in SEQ ID NO.2.

The present invention is able to solve deficiency existing for current gene therapy: targeting is inaccurate；It needs to develop more Therapeutic gene is to obtain better curative effect.Find that Ddb1 gene can be used as new therapeutic gene in the present invention, before wide Scape.The present invention is overexpressed Mms1 in yeast and is able to suppress growth defect caused by Eco1 gene delection (Fig. 1), while can also To cover the decline (Fig. 2) of the Smc3 Acetylation Level due to caused by Eco1 gene delection.This mechanism is in eucaryote It is conservative.Therefore, the patient of pernicious Luo Baici syndrome, those skilled in the art are caused for ESCO2 gene function defect The treatment of the disease can be achieved through the following technical solutions: (1) importing Ddb1 gene in body cell, suffering from Ddb1 albumen It is overexpressed in person's body, utilizes one of viral methods or non-viral methods two ways.Viral methods can use and construct Ddb1 Into adenovirus vector, exogenous dna fragment can be introduced directly into cell by non-viral methods, to inhibit ESCO2 gene function Energy defect, achievees the purpose that treatment.(2) direct injection Ddb1 recombinant protein makes up ESCO2 gene function defect.Such as it can lead to Building expression Ddb1 recombinant protein plasmid is crossed, Ddb1 recombinant protein great expression is enabled, the Ddb1 recombinant protein of expression is carried out pure Change, it will be in Ddb1 albumen direct injection after purification to Luo Baici syndrome patients' body.

Detailed description of the invention

Fig. 1 is overexpression ubiquitin ligase complex Rtt101^Mms1Mms1 subunit can inhibit eco1-1 mutant High growth temperature defect schematic diagram.With each mutant strain of gradient dilution Germicidal efficacy at 25 DEG C, 30 DEG C, 34 DEG C, 37 DEG C of growth feelings Condition.Experimental result shows that overexpression Mms1 makes at 30 DEG C, 34 DEG C, and 37 DEG C of lethal mutant are able to normal growth.AD- Eco1 is positive control.

Fig. 2 is overexpression ubiquitin ligase Rtt101^Mms1Mms1 subunit can repair Smc3 in eco1-1 mutant It is used respectively as shown in the figure in acetylation defect schematic diagram, wild type and each mutant strain by the whole-cell protein that TCA is extracted Antibody carries out immunoblotting (Western Blot) detection.It, can as the result is shown in eco1-1 mutant when overexpression Mms1 By the Smc3 acetylation of relatively low amount in mutant cover to wild type same level.Wherein Western Blot result is with micro-pipe Albumen (Tubulin) is compareed as applied sample amount.AD is the abbreviation of carrier pGADT7, refers to and expresses pGADT7's in yeast cells Empty carrier is as control.AD-Mms1 is the abbreviation of carrier pGADT7-Mms1, and pGADT7-Mms1 work is expressed in yeast cells For experimental group.α-ac-Smc3 refers to that the antibody of identification Smc3 acetylation, α-Smc3 refer to that the antibody of identification Smc3, α-Tubulin refer to knowledge The antibody of other Tubulin.

Fig. 3 is people's cell ESCO2 and yeast Eco1 protein sequence comparison result figure, and ESCO2 and Eco1 are No. gi in NCBI Respectively gi62899035 and gi14318550, as can be seen from the figure this two kinds of albumen n ends change greatly, but C-terminal acetyl It is very conservative (ESCO2 534-601 amino acids, Eco1 211-281 amino acids) to shift enzyme domains.

Specific embodiment

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment Used in the conventional means that are well known to those skilled in the art of technological means, in the following example, Phusion high-fidelity is poly- Synthase is purchased from Thermo fisher, and Pfu is purchased from Quan Shijin biotech firm, and Tag polymerase is purchased from Takara company, restricted interior Enzyme cutting purchase is bought from NEB company, T4 ligase from NEB company, and pRS313, pRS316, pGADT7, pAG25 are purchased from Addgene, primer are synthesized by Sheng Gong biotech firm.If not specified, raw materials used is commercial goods.

The building of 1 eco1-1 mutant strain of embodiment

1, the expression vector of transacetylase Eco1 in saccharomyces cerevisiae: pRS316-Eco1, pRS313-Eco1 is constructed

Note: pRS316 be using URA as the Yeast expression carrier of nutrition selection markers,

PRS313 is using HIS as the Yeast expression carrier of nutrition selection markers

(1) using the genomic DNA of saccharomyces cerevisiae (Saccharomyces cerevisiae) BY4741 as template, Pfu is used Polymerase PCR amplification Eco1 target fragment:

Eco1-F:5 '-CGCGGATCCCAATTTGATCTTTTTATAAA-3 '；

Eco1-R:5 '-CCGGAATTCTCATATGTATACCGGCAATA-3 ' is then used

Multifunctional dna purification kit recycles PCR product.

(2) with BamH I and I double digestion Eco1 target fragment of EcoR and carrier pRS316.Reaction system: 5 μ of reaction buffer L is separately added into I 1.5 μ L, DNA2 μ g of BamH I and EcoR, adds water to 50 μ L, 37 DEG C digestion 2 hours.

(3) electrophoresis recycles digestion products with plastic recovery kit.

(4) it takes 3 μ L recovery products to carry out electrophoresis, estimates DNA concentration.Coupled reaction system: carrier 100ng, purpose is set Segment (target fragment is 3:1-10:1 with carrier molar ratio), 1 μ L of T4DNA ligase add water to 10 μ L, 16 DEG C of connections overnight.

(5) it takes 5 μ L connection products to convert bacillus coli DH 5 alpha, is coated on LB solid medium (mycin of benzyl containing ammonia), 37 DEG C It is inverted culture 16 hours.

(6) picking colony is into 5mL LB liquid medium (mycin of benzyl containing ammonia), and 37 DEG C, 220rpm culture 12 hours.

(7) alkaline lysis method of extracting plasmid is used.

(8) plasmid is subjected to digestion identification, reaction system are as follows: reaction buffer each 0.5 μ L of 1 μ L, BamH I and EcoR I, matter 3 μ L of grain, add water to 10 μ L, 37 DEG C digestion 1 hour, electrophoresis detection size.

(9) it send the correct plasmid of digestion to sequencing, obtains correct pRS316-Eco1 carrier, pRS313-Eco1 carrier It constructs identical as the construction method of pRS316-Eco1 carrier.

2, the expression vector of transacetylase Eco1 mutant eco1-1 in saccharomyces cerevisiae is constructed

pRS313-eco1-1

(1) mutational site primer is designed.Point mutation primer are as follows:

Eco1-1 (G211D)-F:

5-CCCGATTTTAAGATTGACATATCGAGAATTTGGGTGTG-3'；

Eco1-1 (G211D)-R:

5-CCAAATTCTCGATATGTCAATCTTAAAATCGGGGTAC-3’。

(2) it is template with pRS316-Eco1, pRS313-Eco1, carries out PCR.PCR reaction system: 5 × HF is set Buffer10μL；dNTPs(10mM)1μL；Template(5-50ng)1μL；Above-mentioned each 0.5 μ L of upstream and downstream primer；Phusion high 0.5 μ L of proofreading polymerase；1.5 μ L of DMSO adds H₂O to 50 μ L.Notice that Phusion polymerase needs thermal starting, should be eventually adding, Immediate response after addition.Response procedures: 98 DEG C 5 minutes；98 DEG C 10 seconds, 58 DEG C 30 seconds, 72 DEG C of 4 minutes (extension of time=template Length/2kb/ minutes), 17 circulations；72 DEG C 20 minutes；PCR amplification is carried out using PCR system as above and program.

(3) 10 μ L PCR products is taken to be added 1 μ L Dpn I, 37 DEG C of digestion templates (because there is methylation and modify in Plasmid DNA, And PCR product does not methylate modification, and Dpn I acts only on the DNA in the presence of methylation modification).

(4) it takes 5 μ L to convert DH5 α postdigestive system, transformant is extracted into plasmid and is sequenced.It obtains correctly PRS313-eco1-1 carrier.

3, it is tested with Plasmid Shuffling and obtains eco1-1 mutant strain

Necessary to be for the growth of saccharomyces cerevisiae because of transacetylase, therefore the ECO1 gene on genome is changed When making, it need to be transferred to the plasmid that can express Eco1 albumen in advance.

(1) yeast conversion of pRS316-Eco1 and pRS313-eco1-1 plasmid

1) Liquid Culture is accessed using saccharomyces cerevisiae (Saccharomyces cerevisiae) BY4741 as background strain In base, 30 DEG C of cultures to 2 × 10⁷A cell/mL (OD600=1.0).

2) cell is collected into sterile 1.5mL centrifuge tube, is gone with 2500g, the centrifugal condition of 30s by the culture bacterium solution of 5mL Fall supernatant liquid culture medium.

3) cell is suspended in the sterile ultrapure water of 1mL, then with 2500g, cell is collected in centrifugation by the centrifugal condition of 30s Guan Zhong removes supernatant.

4) cell is suspended in 1mL 0.1mol/L lithium acetate solution, then with 2500g, the centrifugal condition of 30s is by cell It is collected in centrifuge tube, removes supernatant.

5) 1mL single-stranded vector DNA sample is boiled into 5min, it is quickly cooling in ice water.

6) cell upper layer addition conversion mixed liquor after centrifugation, conversion mixed liquor composition is as follows, adds in the following order: PEG3350 (50%W/V) 240 μ L, 1mol/L LiOAc (lithium acetate) 36 μ L, single-stranded vector DNA (2mg/mL) 50 μ L, needs to convert PRS316-Eco1 and pRS313-eco1-1 each 1 μ L, sterile 32 μ L of ultrapure water, 360 μ L of total volume.Acutely shake after the completion of addition It swings to whole system and mixes completely, be placed in 3min on ice.

7) 42 DEG C of heat shock 40min.

8) with 2500g, cell is collected in centrifuge tube by the centrifugal condition of 30s, removes supernatant.

9) cell is suspended in the sterile ultrapure water of 1mL, then with 2500g, cell is collected in centrifugation by the centrifugal condition of 30s Guan Zhong removes supernatant.

10) cell is suspended in the 100 sterile ultrapure waters of μ L, is uniformly applied on SC-URA-HIS solid medium, 30 DEG C be inverted culture 24-72h, can be obtained with pRS316-Eco1

(2) ECO1 on genome is knocked out using homologous recombination

1) using pAG25 plasmid as template, 5 ' ends of design contain the one of each 39nt homology arm of target sequence position upstream and downstream To primer, the PCR amplification displacement segment.The primer is as follows:

eco1-del-F:

5'-ACATATTAGGGTTCAACAGAATATAAATCGTTGCACAAAACATGGAGGCCCAGAATACCCT–3'；

eco1-del-R:

5’-ATTTTTCCAGTGTCCCTTCTCGCTGTCTTTTCGAAAGAGCAGTATAGCGACCAGCATTCAC–3’。

2) using pAG25 plasmid as template, table can be had by ECO1 in homologous replacement gene group with Tag polymerase PCR amplification Up to the target fragment of NAT resistance.PCR reaction system: 2 × Tag polymerase, 25 μ L；Template(5-50ng)1μL；Primer F 2μL；Primer R 2μL；；Add H₂O to 50 μ L.Response procedures: 95 DEG C 5 minutes；95 DEG C 1 minute, 58 DEG C 30 seconds, 72 DEG C 2 minutes (extension of time=template length/1kb/ minutes), 30 circulations；72 DEG C 20 minutes；It is carried out using PCR system as above and program PCR amplification.

(3) BY4741 pRS316-Eco1 is transferred to using the target fragment that the method for above-mentioned yeast conversion obtains PCR In pRS313-eco1-1 bacterial strain.It is uniformly applied to the solid medium of SC-URA-HIS+NAT, is inverted culture.Picking transformant Single colonie lines on new solid plate.Whether picking thallus, rapidly extracting Yeast genome, PCR identification of dna segment occur Displacement.Finally obtain the bacterial strain that ECO1 is knocked out on genome: BY4741 eco1 Δ:: NAT pRS316-Eco1 pRS313- eco1-1。

(4) eco1-1 mutant strain is obtained with Plasmid Shuffling experiment.5- fluororotic acid (5-FOA) is to make For a kind of negative selection drug, when yeast cells can express URA3, the enzyme of URA3 gene coding can be such that 5-FOA becomes to cell Virose substance grow yeast cells cannot on the culture medium containing 5-FOA.And the pRS316- that above-mentioned experiment is mentioned Eco1 plasmid can express URA3, therefore can screen the bacterial strain of pRS316-Eco1 loss by the way that 5-FOA is added.

The bacterial strain that above-mentioned steps are obtained: BY4741 eco1 Δ:: NAT pRS316-Eco1pRS313-eco1-1 is drawn It is screened on the plate of SC-HIS+5-FOA, obtained bacterial strain is transacetylase defect mutant eco1-1:BY4741 eco1Δ::NAT pRS313-eco1-1。

2 ubiquitin ligase Rtt101 of embodiment^-Mms1Subunit Rtt101 cover transacetylase defect mutant eco1-1 Identification

1, ubiquitin ligase Rtt101^-Mms1Cover the relevant carriers pGADT7- of transacetylase defect mutant eco1-1 The building of Eco1, pGADT7-Mms1

PGADT7 is using LEU as the Yeast expression carrier of nutrition selection markers

(1) poly- with Pfu using the genomic DNA of saccharomyces cerevisiae (Saccharomycescerevisiae) BY4741 as template The target fragment of synthase PCR amplification Eco1, Mms1.

The primer sequence is as follows:

Eco1-2-F:5 '-CCGGAATTCATGAAAGCTAGGAAATCGCA-3 '

Eco1-2-R:5 '-CGCGGATCCTCATATGTATACCGGCAATA-3 '

Mms1-F:5 '-TCCCCCCGGGTATGCTAGGTTTGCGAACTCAT-3 '

Mms1-R:5 '-CCGCTCGAGGGGAATTATACTGTGTTCTTGC-3 '

Then PCR product is recycled with multifunctional dna purification kit.

(2) BamH I and EcoR I double digestion target fragment ECO1 and carrier pGADT7 is used.Reaction system: 5 μ of reaction buffer L is separately added into I 1.5 μ L, DNA2 μ g of BamH I and EcoR, adds water to 50 μ L, 37 DEG C digestion 2 hours.

(3) Xma I and Xho I double digestion target fragment MMS1 and carrier pGADT7 is used.Reaction system: 5 μ L of reaction buffer, Be separately added into I 1.5 μ L, DNA2 μ g of Xma I and Xho, add water to 50 μ L, 37 DEG C digestion 2 hours.

(4) electrophoresis recycles digestion products with plastic recovery kit.

(5) it takes 3 μ L recovery products to carry out electrophoresis, estimates DNA concentration.Coupled reaction system: carrier 100ng, purpose is set Segment (target fragment is 3:1-10:1 with carrier molar ratio), 1 μ L of T4DNA ligase add water to 10 μ L, 16 DEG C of connections overnight.

(6) it takes 5 μ L connection products to convert bacillus coli DH 5 alpha, is coated on LB solid medium (mycin of benzyl containing ammonia), 37 DEG C It is inverted culture 16 hours.

(7) picking colony is into 5mLLB fluid nutrient medium (mycin of benzyl containing ammonia), and 37 DEG C, 220rpm culture 12 hours.

(8) alkaline lysis method of extracting plasmid is used.

(9) plasmid is subjected to digestion identification, 1) pGADT7-Eco1 reaction system are as follows: 1 I He of μ L, BamH of reaction buffer EcoR I each 0.5 μ L, 3 μ L of plasmid, add water to 10 μ L, 37 DEG C digestion 1 hour, electrophoresis detection size.2) pGADT7-Mms1 reacts System are as follows: reaction buffer 1 μ L, Xma I and Xho I each 0.5 μ L, 3 μ L of plasmid add water to 10 μ L, 37 DEG C digestion 1 hour, electrophoresis Detected magnitude.

(10) it send the correct plasmid of digestion to sequencing, obtains correct pGADT7-Eco1, pGADT7-Mms1 carrier.Building Obtain ubiquitin ligase Rtt101^-Mms1The relevant carriers pGADT7-Eco1 of covering transacetylase defect mutant eco1-1, pGADT7-Mms1。

2, ubiquitin ligase complex Rtt101^-Mms1Cover the strain construction of transacetylase defect mutant eco1-1

Expression vector obtained in step 1 is transferred to transacetylase made from embodiment 1 using the method for yeast conversion In defect mutant eco1-1 i.e.: BY4741eco1 Δ:: in NAT pRS313-eco1-1, it is compound to finally obtain ubiquitin ligase The overexpression of object subunit covers bacterial strain.

1) in transacetylase defect mutant eco1-1 made from embodiment 1 i.e.: BY4741eco1 Δ:: NAT As in background strain access fluid nutrient medium, 30 DEG C are cultivated to 2 × 10 pRS313-eco1-1⁷A cell/mL (OD600= 1.0)。

6) cell upper layer addition conversion mixed liquor after centrifugation, conversion mixed liquor is as follows by forming, and adds in the following order Add: PEG3350 (50%W/V) 240 μ L, 1mol/L LiOAc (lithium acetate) 36 μ L, single-stranded vector DNA (2mg/mL) 50 μ L is needed PGADT7, pGADT7-Eco1 or the pGADT7-Mms1 of conversion each 1 μ L, sterile 32 μ L of ultrapure water, 360 μ L of total volume.It has added It is mixed completely at rear violent concussion to whole system, is placed in 3min on ice.

7) 42 DEG C of heat shock 40min.

10) cell is suspended in the 100 sterile ultrapure waters of μ L, is uniformly applied on SC-HIS-LEU solid medium, 30 DEG C be inverted culture 24-72h.

11) picking transformant single colonie lines on new solid plate.

12) pGADT7 is transferred in the normally functioning cell of transacetylase Eco1 (i.e. background strain BY4741) simultaneously Empty carrier as control, method for transformation is shown in above-mentioned i.e. step 2) -11).

13) the overexpression covering bacterial strain of ubiquitin ligase complex subunit is finally obtained.I.e.

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7；

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7-ECO1；

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7-MMS1；

3, ubiquitin ligase Mms1 is detected by immunoblot experiment to return transacetylase defect mutant eco1-1 It mends.

(1) TCA- acetone method extracts the yeast cells that yeast cells total protein collects 5OD, with 1mL 0.25mol/L Thallus is resuspended in NaOH, 1% beta -mercaptoethanol, is blown and beaten uniformly with pipettor, places 10min on ice.It is molten that 160 μ L 50%TCA are added Liquid, oscillation mix postposition 10min on ice.With 15000g revolving speed, 4 DEG C of centrifugation 10min, supernatant is eliminated.It is resuspended with the pre- cold acetone of 1mL Precipitating, is blown and beaten fully dispersed to its is precipitated to using micropipettor, with 15000g revolving speed, 4 DEG C of centrifugation 10min, eliminates supernatant. It will be deposited in 60 DEG C of baking ovens and dry, and be suspended and precipitated with 1 × SDS albumen sample loading buffer, boiling water bath 5min.Wherein 1 × SDS egg White sample loading buffer component: Tris-Cl (pH6.8) 50mmol/L, SDS 2%, bromine phenol 0.1%, glycerol 10%, beta -mercaptoethanol 100mM。

(2) immunoblotting separates the PAGE gel that above-mentioned sample carries out 8%.The SDS-PAGE for completing electrophoresis is coagulated Glue is placed in transferring film buffer and balances.It cuts the pvdf membrane big with gel etc. and is placed in transferring film after impregnating 1min activation in methanol It is balanced in buffer.Clamping plate is opened, black clamping plate side is soaked in transferring film buffer, places impregnated respectively from top to bottom The filter paper of size is fitted in the foam-rubber cushion crossed and two opening and closing.It is entirely partially submerged in transferring film buffer, prevents bubble from generating.In filter paper On with from top to bottom sequence place, gel, pvdf membrane and two filter paper impregnated.Entire movement is immersed in transferring film buffer In to prevent bubble from generating.It finally places the sponge impregnated and is padded on top layer, tightening closure transferring film clamping plate, aligning electrodes are inserted Enter in transferring film slot.250mA, 1h, 4 DEG C of transferring film electrophoresis.After the completion of transferring film, pvdf membrane is taken out, is placed in 5% degreasing prepared with PBST In milk, room temperature closes 1h.Remove confining liquid, antibody is diluted to suitable concentration, room temperature with 2% skim milk that PBST is prepared It is incubated for 1h.(anti-ac-Smc3, anti-Smc3, anti-Tubulin) removes primary antibody liquid, washes pvdf membrane 3 with PBST at room temperature It is secondary, each 10min.Corresponding secondary antibody is diluted to suitable concentration with 2% skim milk that PBST is prepared, is incubated at room temperature 1h.Remove Secondary antibody Incubating Solution washes pvdf membrane 3 times with PBST at room temperature, each 10min.After ECL developing solution A, B mixed in equal amounts, with PVDF Film reacts at room temperature 3min, removes extra developing solution on film, is fixed in camera obscura after pvdf membrane is sealed, darkroom exposure development.Knot Fruit sees Fig. 2.

Be overexpressed in 3 yeast of embodiment Mms1 (the Ddb1 albumen for being equivalent to the mankind) be able to suppress Eco1 gene delection and Caused growth defect

Gradient sensing experiment is carried out with bacterial strain is obtained in embodiment 2.That is:

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7；

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7-ECO1；

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7-MMS1

Concrete operations are as follows:

1) above-mentioned bacterial strains are incubated overnight, experimental day counts cell, and the cell of all experimental strains is dense Degree is adjusted to 2 × 10 with water⁶A cell/mL.

2) 250 microlitres of each experimental strain cells are drawn, 96 orifice plate first rows are added drop-wise to, with multi-channel micropipettor 96 200 microlitres of sterilizing ultrapure waters are added dropwise in orifice plate secondary series to the 5th column.

3) five dilutions are set altogether from 96 orifice plate first rows to the 6th column, inhaled using multi-channel micropipettor from first row It takes 50 microlitres of cell to secondary series to mix well, then draws 50 microlitres of cells to third from secondary series and arrange, carry out 5 with this step Gradient dilution again.

4) it is drawn using multi-channel micropipettor from each dilution 5 microlitres of cells of absorption and is added dropwise to-HIS-LEU plate On, the distance between yeast spot that each dilution is added dropwise is 1.5cm.Temperature gradient plate is respectively at 25 DEG C, 30 DEG C, 34 DEG C It is cultivated with 37 DEG C.

5) it carries out photographing to record experimental result, the result is shown in Figure 1 after 48 hours of incubation.Fig. 1 is overexpression ubiquitinbond Multienzyme complex Rtt101^Mms1Mms1 subunit can inhibit the high growth temperature defect schematic diagram of eco1-1 mutant.Use gradient dilution Each mutant strain of Germicidal efficacy is at 25 DEG C, 30 DEG C, 34 DEG C, 37 DEG C of growing state.Experimental result shows that overexpression Mms1 makes At 30 DEG C, 34 DEG C, 37 DEG C of lethal mutant are able to normal growth.AD-Eco1 is positive control, and AD is negative control, and AD-Mms1 is Experimental group.Because the mechanism of chromatid adhesion (SCC) is all conservative, the acetylase of people's acetylation Smc3 from yeast to people Eco1 in ESCO2 and yeast is also highly conserved (Fig. 3), so the result can be applied to as caused by mankind ESCO2 Disease treatment.

Although above having used general explanation, specific embodiment and test, the present invention is made to retouch in detail It states, but on the basis of the present invention, it can be made some modifications or improvements, this is apparent to those skilled in the art 's.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to claimed Range.

Claims

In disease medicament caused by 1.Ddb1 albumen is lacked in preparation treatment ESCO2 gene mutation, missing or ESCO2 protein function Application, the amino acid sequence of the Ddb1 albumen is as shown in SEQ ID NO.1.
2. application as described in claim 1, the disease is Luo Baici syndrome.
3. the gene of encoding D db1 albumen is caused by preparation treatment ESCO2 gene mutation, missing or ESCO2 protein function lack Application in disease medicament, the gene of the encoding D db1 albumen are the nucleotide sequence as shown in SEQ ID NO.2.
4. application as claimed in claim 3, the disease is Luo Baici syndrome.
5. the biomaterial containing Ddb1 protein coding gene is in preparation treatment ESCO2 gene mutation, missing or ESCO2 albumen function Application in disease medicament caused by capable of lacking, the Ddb1 protein coding gene are the nucleotide as shown in SEQ ID NO.2 Sequence.
6. application as claimed in claim 5, the biomaterial is expression vector or host cell.
7. application as claimed in claim 5, the disease is Luo Baici syndrome.