CN109504679A

CN109504679A - The promoter and application specific expressed in birds skeletal muscle for gene

Info

Publication number: CN109504679A
Application number: CN201811377552.9A
Authority: CN
Inventors: 马国达; 汪亚君; 梁春梅; 李友
Original assignee: Affiliated Hospital of Guangdong Medical University
Current assignee: Affiliated Hospital of Guangdong Medical University
Priority date: 2018-11-19
Filing date: 2018-11-19
Publication date: 2019-03-22

Abstract

The invention belongs to field of biotechnology, more particularly, to gene promoter and application specific expressed in birds skeletal muscle.The present invention provides a kind of promoters specific expressed in birds skeletal muscle for gene, including at least one E-box；The nucleotides sequence of E-box is classified as CANNTG, wherein the N is selected from A, T, C or G.The present invention also provides a kind of applications of gene promoter that can be expressed in birds skeletal muscle specificity.The present invention provides it is a kind of can be in the promoter of skeletal muscle specificity expressing gene, it can be used for constructing various birds skeletal muscle specific transgene expression vectors, high abundance is expressed or passed through technique for gene engineering and improves birds meat quality and muscle treating correlative diseases in the cell of birds skeletal muscle tissue or skeletal muscle origin for promotor gene.

Description

The promoter and application specific expressed in birds skeletal muscle for gene

Technical field

The invention belongs to field of biotechnology, more particularly, to gene startings specific expressed in birds skeletal muscle Son and application.

Background technique

Foreign gene in body can high efficiency stable expression formula genetic engineering research key, while to solve the problems, such as Be foreign gene expression will because need due to open, that is, have stringent Space-time speciality.Genetic engineering is utilized in eukaryocyte It has been a common technology that technology, which constructs a variety of eukaryotic expression systems and carries out the expression of foreign gene, but often face Problem is that the expression quantity of foreign gene is lower, and the expression regulation most critical of gene be transcriptional level regulation.Promoter It is the section of DNA sequence that correctly can effectively originate rna transcription, it can be with transcription factor interaction and in conjunction with RNA polymerase.Promoter It is the important component of gene, the expression of gene is controlled in time, space and expression degree.CMV and SN40 starting Son is at this stage in genetic engineering using wide promoter, both can with foreign gene-carrying with it is almost all kinds of It is efficiently expressed in cell.Both efficient promoters are not the problem is that it will be apparent that have Targeted-control gene The ability of expression.

This problem of tissue-specific promoter's very good solution can regulate and control external source base using tissue-specific promoter The targeted expression of cause.Tissue-specific promoter is also known as organ specific promoters, under the driving of this kind of promoter, gene Expression is often only defined in certain specific organ or tissue positions, and shows the characteristics such as growth adjustment.Tissue specificity is usual Based on specific tissue cellularity and chemistry, physical signal, there is certain common ground with inducible promoter.In view of group It knits specificity starting and has such speciality, the favor of researcher is increasingly obtained in genetic engineering.

But found from the tissue-specific promoter's analysis obtained in animal and plant at present, it is generally existing to ask below Topic: specificity is not very high；It separates and the specificity promoter quantity for obtaining application is few；The problems such as activity is low, this is greatly Limit application of the tissue-specific promoter in genetic engineering.

The study found that skeletal muscle is to lead to specific transcription factor under the stringent regulation of outer signals molecule Activation and gene expression as a result, this process includes exiting for cell cycle, the transcription of muscle specific albumen, and having The formation etc. of the multicore muscle fibre of contractile function.But in the past to the research of tissue-specific promoter's sequence mostly with lactation Animal is model.Chicken genomic DNA total length is 1.2x10⁹The 40% of the mammals such as bp is about people, mouse, the coding of chicken Gene and regulating and controlling sequence have bigger difference with mammal, it means that the transcription regulation mechanism of birds skeletal development also has Not in mammal.For example, cardiac muscle anchoring repeat sequence protein (CardiacAnkyrin RepeatProtein, CARP) gene It is expressed in mammals in Cardiac-specific.The study found that expression pattern and the food in one's mouth of the CARP in the birds using chicken as representative Newborn animal is completely different, its skeletal muscle specifically expressing in birds.Therefore, using birds skeletal muscle specificity promoter, pass through Corresponding expression vector is constructed, gene can be opened is fixed in poultry muscle and express.Pass through the albumen or RNAs of foreign gene Expression in birds skeletal muscle can be very good research muscle differentiation, treatment muscle it is diseases related and improve poultry muscle Quality or flavor.However, being reported in the efficient specific promotor gene expression of energy in birds skeletal muscle currently without research Promoter, this greatly hinders the application of birds skeletal muscle specificity expression alien gene.

Summary of the invention

In view of this, the purpose of this hair invention is to provide the starting specific expressed in birds skeletal muscle for gene Son.

It is a further object to provide a kind of product that can improve poultry muscle quality diseases related to treatment muscle The gene engineering method of disease.

The present invention provides a kind of promoter specific expressed in birds skeletal muscle for gene, including at least one E- Box element；The nucleotides sequence of the E-box is classified as CANNTG, wherein the N is selected from A, T, C or G.

Preferably, the CANNTG is selected from CAGCTG or CATGTG.

Preferably, the promoter include two E-box elements, the cis-acting elements be selected from CAGCTG or/and CATGTG。

Wherein, the nucleotides sequence of SEQ ID NO:2 is classified as CATGTG；The nucleotides sequence of SEQ ID NO:3 is classified as CAGCTG.

More there is choosing, the promoter includes E-box element, and the E-box element is CATGTG.

Preferably, further including TATA-box.

Preferably, the nucleotides sequence of the TATA-box is classified as TATATAA.

Preferably, it has any one in nucleotide sequence shown in (I), (II) or (III):

(I) as shown in SEQ ID NO:1；

(II) there is the sequence of at least 90% homology with the sequence as shown in SEQ ID NO:1；

(III) the sequence as shown in SEQ ID NO:1 is modified, replaces, misses or adds one or several nucleotide acquisitions Nucleotide sequence.

It should be noted that the nucleotides sequence of SEQ ID NO:1 is classified as TACATCAACAGACAGCTGTCCCAGTGGGCA CTGGGAACACAGGATGACTCACATAGCTGAGCCATGTGGTCATGGCCAAAGGCATGATGAGCTCACATTTCATTCC GATGCACATACGCAGTGCGGTCAGACTGTGGGACTCGGCCACCCCCACCCTCCTGACGCCCCCCGCTCGGTCTCGA CACTAGATCTGGCTAGTTAACATGTCTGGAATGAGCACGAGCCTACCTCCCAGCTGGCAAGTCTTCAGGCGTACTC GGATTCCAAGGTTGGAAGATTATCTCATTCAAGCATAGCTCTCCCAAAGATATATAAGCAAAGCTAGTGTGGTGGT CCC.SEQ ID NO:1 is that-the 337bp of the transcripting start point upstream of CARP arrives the segment of transcripting start point, total 337bp, wherein The segment that-the 325bp of the transcripting start point upstream of CARP arrives the -320bp of transcripting start point upstream is E-box element, is denoted as E- The segment that-the 277bp of the transcripting start point upstream of box2, CARP arrives the -272bp of transcripting start point upstream is E-box element, note It is TATA-box for the E-box1, -29bp of the transcripting start point upstream of the CARP segment for arriving -23bp of transcripting start point upstream.

Preferably, it is described be substituted by substitution 1,2,3,4,5,6,7,8,9,10,11, 12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27, 28,29,30,31,32 or 33 nucleotide.

The invention discloses the promoters to start application in downstream gene high efficient expression in birds skeletal muscle.

It should be noted that the cell of the birds skeletal muscle is chicken embryo tire sarcoblast (chicken fetal Myoblast, CFM).

The invention discloses application of the promoter in the product that preparation improves poultry muscle quality.

It should be noted that promoter of the invention and the target gene for improving poultry muscle quality or flavor can be total to Same carrier construction enables target gene specific expressed to improve poultry muscle in poultry muscle by technique for gene engineering Quality or flavor.

The invention discloses application of the promoter in the genetically engineered drug of preparation treatment poultry muscle disease.

It should be noted that can be common by the target gene of promoter of the invention and treatment poultry muscle related disease Carrier construction enables target gene specific expressed to treat poultry muscle in poultry muscle by technique for gene engineering Related disease.

The present invention also provides a kind of expression vectors, contain the promoter.

The present invention also provides a kind of host cells, contain the expression vector.

The present invention provides the promoters specific expressed in skeletal muscle for gene, and promoter disclosed by the invention can With the expression of specificity efficient promotor gene in birds skeletal muscle.From the experimental results, it is a discovery of the invention that including at least one A E-box element；The nucleotides sequence of the E-box element is classified as CANNTG, wherein the N is selected from A, T, C or G.It is of the invention public The promoter opened can effectively activate the transcription of downstream gene in birds skeletal muscle, which is E-box, E-box It is and to facilitate the expression of promoter downstream gene necessary to activation MyoD.Present invention discover that E-box can combine muscle-derived tune The factor is saved, it is of the invention by activating the starting of promoter downstream gene in conjunction with MyoD such as MyoD, Myogenin and MRF 4 The promoter of offer can promote birds skeletal muscle as the application of bioreactor, by the segment of required destination protein and this The promoter connection of invention is transfected into skeletal muscle, and specific expressed in birds skeletal muscle, can by technique for gene engineering Largely to obtain destination protein in birds skeletal muscle；Promoter of the invention can also be improved the quality and wind of poultry muscle The segment for improving the destination protein of poultry muscle quality or flavor connect with promoter of the invention and is transfected into birds bone by taste In flesh, and it is specific expressed in birds skeletal muscle, the quality or wind of birds skeletal muscle can be improved by technique for gene engineering Taste；Promoter of the invention also can treat poultry muscle related disease, will treat the piece of the destination protein of muscle related disease Section is connect with promoter of the invention to be transfected into birds skeletal muscle, and specific expressed in birds skeletal muscle, passes through gene Engineering technology can treat the related disease of birds skeletal muscle.

Detailed description of the invention

In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described.

Fig. 1 show the embodiment of the present invention fluorescence report experiment detection different length CAPR gene promoter primary CFM, Activity in DT40 (chicken lymphoma cell) and Fibroblast (chicken fibroblasts), wherein P-386 (- 386~+ 203bp), P-355 (- 355~+203bp), P-337 (- 337~+203bp), P-319 (- 319~+203bp), P-286 (- 286 ~+203bp), P-269 (- 269~+203bp), P257 (- 257~+203bp), P227 (- 227~+203bp), P-189 (- 189~+203bp), it (-): indicates transcription initiation upstream, (+): indicating transcription initiation downstream；

Fig. 2 show the WesternBlot experiment detection CARP gene of the embodiment of the present invention in primary CFM, DT40 and Expression in Fibroblast (chicken fibroblasts)；

Fig. 3 shows the q-PCR experiment detection CARP gene of the embodiment of the present invention in primary CFM, DT40 and Fibroblast (chicken Fibroblast) in expression；

Fig. 4 show the embodiment of the present invention using TFSEARCH online software to the transcription initiation site upstream of CARP gene 1kb sequence carries out bioinformatic analysis map, wherein there is E-box2 at -325~-320 place of transcription initiation upstream of CARP gene There are E-box1 element, the transcription initiation upstream -29 of CARP gene in element, -277~-272 place of transcription initiation upstream of CARP gene There is TATA-box element at~-23 places；

Fig. 5 shows that the fluorescence report experiment of the embodiment of the present invention detects the starting of CARP gene after E-box1 and E-box1 mutation The active situation of son, wherein P-337 is to originate to swim over to downstream -337~+203bp carrier cell containing CARP genetic transcription Fluorescence activity, P-337mE2 are to originate to swim over to downstream -337~+203bp (E-box2 element mutations) containing CARP genetic transcription The cell fluorescence activity of carrier, P-337mE1 are to originate to swim over to downstream -337~+203bp (E- containing CARP genetic transcription Box1 element mutations) carrier cell fluorescence activity, P-337mE2mE1 be containing CARP genetic transcription starting on swim over to downstream- The cell fluorescence activity of 337~+203bp (simultaneous mutation of E-box1 and E-box2 element) carrier；

Fig. 6 shows the case where the detection E-box2 or E-box1 of the embodiment of the present invention are whether in conjunction with MyoD, wherein Input To transfect the genome containing E-box2 or E-box1 carrier in CFMs cell, Anti-MyoD is transfection E-box2 or E-box1 After carrier, genome and MyoD antibody incubation experimental group are extracted, Anti-IgG is extraction after transfection E-box2 or E-box1 carrier Control group of the genome in conjunction with IgG antibody；

Fig. 7 shows after the detection site the E-box wild type and mutation of the embodiment of the present invention to the promoter activity of CARP gene Influence, wherein Mock is blank group, and WT-E1 is wild type E-box1, and mE1 is saltant type E-box1, and WT-E2 is wild type E-box2, mE2 are saltant type E-box2；

Fig. 8 shows the expression that MyoD is interfered in the CFMs cell of the embodiment of the present invention, wherein Mock is blank group, Si- MyoD is interference MyoD expression group；

Detection P-337 and P-319 is to the promoter of CARP gene after Fig. 9 shows the expression of the interference MyoD of the embodiment of the present invention Influence, wherein P-337 is living containing downstream -337~+203bp carrier cell fluorescence is swum over in CARP genetic transcription starting Property, P-319 is active containing downstream -319~+203bp carrier cell fluorescence is swum over in CARP genetic transcription starting.

Specific embodiment

It is current for filling up the present invention provides a kind of promoter specific expressed in birds skeletal muscle for gene Lack can in birds Skeletal Muscle Cell the promoter of different expression gene vacancy.

The technical scheme in the embodiments of the invention will be clearly and completely described below, it is clear that described implementation Example is only a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, this field is common Technical staff's every other embodiment obtained without making creative work belongs to the model that the present invention protects It encloses.

Wherein, it is commercially available or self-control that following embodiment is raw materials used.

Embodiment 1

The embodiment of the present invention by PCR method amplify CARP transcripting start point upstream 1000bp to transcripting start point The segment (i.e. (-): -1000~+203bp indicates transcription initiation upstream, (+): indicating transcription initiation downstream) of the 203bp in downstream, The Gene ID:378926 of CARP gene.This segment is cloned into luciferase reporter vector pGL3-basic (Promega). Using a series of primers with restriction enzyme site, a series of carrier of 5 ' deletion constructs is constructed with PCR method.Respectively P- 386 (- 1000~+203bp), P-386 (- 386~+203bp), P-355 (- 355~+203bp), P-337 (- 337~+ 203bp), P-319 (- 319~+203bp), P-286 (- 286~+203bp), P-269 (- 269~+203bp), P257 (- 257 ~+203bp), P227 (- 227~+203bp), P-189 (- 189~+203bp), (-): indicate transcription initiation upstream, (+): table Show transcription initiation downstream, such as: P-337 (- 337~+203bp) is the transcripting start point upstream that CARP is connected in carrier 337bp to transcripting start point downstream 203bp segment, and so on.

It should be noted that heartspecific anchoring repetitive proteins (CARP) is specific expressed in cardiac muscle of mammal, And it plays an important role in transcriptional control, cytoskeletal structure and the stretching sensing in heart development and pathologic process.With the food in one's mouth The homology of newborn animal is different, previous the study found that the expression of chicken CARP gene is only limitted to skeletal muscle, and may be given birth to by muscle Long main negative growth factor Myostatin is lowered.In addition, nearest functional study shows that CARP may be in control chicken bone Key effect is played in myogenetic Myostatin signal cascade.Research shows that the reaction of Myostatin signal cascade is in bone The generation of chicken skeletal muscle is controlled with Apoptosis is avoided by proliferative induction in myocyte (CFM) atomization.

Embodiment 2

The carrier of embodiment 1 is transfected into 40 cell of CFM, chicken fibroblasts and DT, CFM, chicken fibroblasts and DT40 cell culture is placed in containing the dual anti-DMEM of 10% fetal calf serum and 1% containing 5% carbon dioxide, 37 DEG C of trainings Support case.Transfection experiment is carried out with lip2000 (Invitrogen, USA) when cell density is up to 70%.

Embodiment 3

Luciferase reporting test, step are carried out to CFM, chicken fibroblasts and 40 cell of DT that embodiment 2 completes transfection It is rapid as follows: by CFM, chicken fibroblasts and 40 cell inoculation of DT in 12 orifice plates, after Lip2000 transfection for 24 hours, to use fluorescence Plain enzyme reporting system (Promega, USA) detects uciferase activity.All transfections are triplicate, and to the light of firefly of each sample Luciferin enzymatic activity and kidney uciferase activity carry out normalization analysis, and data are average ± standard deviation, include at least three A individual experiment.Two groups of independent samples are compared using t inspection.All analyses are all to select two-tailed test, and difference has Significant property is (P < 0.05).As a result as shown in Figure 1, known to Fig. 1 in CFM cell, the missing of the base-pair of -1kb~-373 (bp) It does not make significant difference to CARP promoter activity.However, the missing in the region -337bp to -227bp causes promoter activity significant It reduces, this shows that there are the regulating elements of CARP gene expression in the region.Meanwhile it finding in DT40 and fibroblast not Under the conditions of the promoter of length, the activity of CARP is all very low.

Embodiment 4

Using WesternBlotting and q-PCR technology detection chicken CARP gene expression, result figure such as Fig. 2 and Fig. 3, Fig. 2 and Fig. 3 show expression quantity of the chicken CARP gene in DT40 and fibroblast almost without chicken CARP gene is illustrated It is specific expressed in CFM cell.

Embodiment 5

Bioinformatics is carried out using 1kb sequence of the TFSEARCH online software to CARP gene transcription start site upstream Analysis, as a result such as Fig. 4, -29 Dao -23bp places that discovery is located at transcription initiation site upstream are TATA-box typical there are one Point, and there are two E-box elements between -325 to -320bp and -277 to -272bp, are -325 to -320bp respectively (E-box2) and -277 arrive -272bp (E-box1).

Embodiment 6

Using QuickChange mutagenesis kit (Stratagene, La Jolla, CA, USA) to each binding site into Row direct mutagenesis, carrier construction, P-337 are normally to originate to swim over to downstream -337~+203bp load containing CARP genetic transcription Body, P-337mE2 are containing the load for swimming over to downstream -337~+203bp (E-box2 element mutations) in CARP genetic transcription starting Body, P-337mE1 are containing the load for swimming over to downstream -337~+203bp (E-box1 element mutations) in CARP genetic transcription starting Body, P-337mE2mE2 are to originate to swim over to downstream -337~+203bp (E-box1 and E-box2 element containing CARP genetic transcription Simultaneous mutation) carrier；The above carrier is tested into discovery (result is as shown in Figure 5) by fluorescence report, is mutated E-box1 respectively After E-box2, the activity of CARP promoter is all had dropped；And at the same time after mutation E-box1 and E-box2, CARP promoter Activity declines to become apparent from.Therefore, two sites E-box of chicken CARP gene transcription start site upstream are the genes in CFM The critical sites of expression activity in cell.

Embodiment 7

The embodiment of the present invention is that transfection extracts genome and MyoD containing after E-box2 and E-box1 carrier in CFMs cell Antibody incubation.As can be seen from Figure 6, IP experiment discovery E-box1 is carried out by DNA and the MyoD albumen of the DNA of E-box2 and E-box1 Can be in conjunction with MyoD with E-box2, and the binding ability ratio E-box2's of apparent E-box1 is strong.

Embodiment 8

The embodiment of the present invention is to detect the site E-box wild type and saltant type to the shadow of the promoter activity of CARP gene It rings, as can be seen from Figure 7, Mock is blank group in Fig. 7, and WT-E1 is wild type E-box1, and mE1 is saltant type E-box1, and WT-E2 is Wild type E-box2, mE2 are saltant type E-box2.The DNA sequence dna transfection of the DNA sequence dna and E-box2 of the E-box1 of wild type Find that the activity of CARP starting is all higher than blank group when CFMs, likewise, the activity of E-box1 is stronger than E-box2.With it is wild Type group compares, and when E-box1 and E-box2 mutates, can all reduce the activity of CARP starting significantly.

Embodiment 9

The embodiment of the present invention is to detect P- after interfering the expression of MyoD, and the expression of interference MyoD in CFMs cell Influence of the 337 and P-319 to the promoter of CARP gene.From Fig. 8-9 it is found that after the expression silencing of MyoD, cotransfection P-337 (normally originate containing CARP genetic transcription and swim over to downstream -337~+203bp carrier) and P-319 (normally contain Downstream -319~+203bp carrier is swum over in CARP genetic transcription starting).As a result, it has been found that CARP is opened after the expression of interference MyoD Dynamic activity all significantly reduces.These are studies have shown that MyoD can be in conjunction with the E-box in promoter, and in myogenic differentiation CARP gene is activated in the process.Above embodiments show that E-box1 and/or E-box2 start CARP and then in conjunction with MyoD Gene is specific expressed in CFMs cell, illustrate E-box1 and/or E-box2 can in skeletal muscle specific promotor gene Expression.

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.

Sequence table

<110>Guangdong affiliated hospital, medical university

<120>promoter and application specific expressed in birds skeletal muscle for gene

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 337

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

catcaacaga cagctgtccc agtgggcact gggaacacag gatgactcac atagctgagc 60

catgtggtca tggccaaagg catgatgagc tcacatttca ttccgatgca catacgcagt 120

gcggtcagac tgtgggactc ggccaccccc accctcctga cgccccccgc tcggtctcga 180

cactagatct ggctagttaa catgtctgga atgagcacga gcctacctcc cagctggcaa 240

gtcttcaggc gtactcggat tccaaggttg gaagattatc tcattcaagc atagctctcc 300

caaagatata taagcaaagc tagtgtggtg gtcccag 337

<210> 2

<211> 6

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

catgtg 6

<210> 3

<211> 6

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

cagctg 6

Claims

1. the promoter specific expressed in birds skeletal muscle for gene, which is characterized in that including at least one E-box member Part；The nucleotides sequence of the E-box is classified as CANNTG, wherein the N is selected from A, T, C or G.

2. promoter according to claim 1, which is characterized in that the CANNTG is selected from CAGCTG or CATGTG.

3. promoter according to claim 1, which is characterized in that the promoter includes two E-box elements, the E- Box element is selected from CAGCTG or/and CATGTG.

4. according to claim 1 to promoter described in 3 any one, which is characterized in that further include TATA-box.

5. promoter according to claim 4, which is characterized in that the nucleotides sequence of the TATA-box is classified as TATATAA.

6. promoter according to any one of claims 1 to 4, which is characterized in that it has (I), (II) or (III) institute Any one in the nucleotide sequence shown:

(I) as shown in SEQ ID NO:1；

(III) sequence as shown in SEQ ID NO:1 is modified, replaces, misses or adds the nucleosides that one or several nucleotide obtain Acid sequence.

7. promoter according to claim 6, which is characterized in that it is described be substituted by substitution 1,2,3,4,5, 6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22 A, 23,24,25,26,27,28,29,30,31,32 or 33 nucleotide.

8. application of the promoter according to any one of claims 1 to 7 in the product that preparation improves poultry muscle quality.

9. application of the promoter according to any one of claims 1 to 7 in the drug of preparation treatment poultry muscle disease.

10. a kind of expression vector, which is characterized in that contain promoter as described in any one of claim 1 to 7.