CN114805515A - Application of F-box protein coding gene OsFBX250 in rice breeding - Google Patents
Application of F-box protein coding gene OsFBX250 in rice breeding Download PDFInfo
- Publication number
- CN114805515A CN114805515A CN202210510818.2A CN202210510818A CN114805515A CN 114805515 A CN114805515 A CN 114805515A CN 202210510818 A CN202210510818 A CN 202210510818A CN 114805515 A CN114805515 A CN 114805515A
- Authority
- CN
- China
- Prior art keywords
- osfbx250
- gene
- grain
- rice
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Abstract
The invention discloses application of an F-box protein coding gene OsFBX250 in rice breeding, and belongs to the fields of genetic engineering and plant genetic breeding. The invention firstly separates and clones a new gene OsFBX250 for regulating rice grain type, and the grain length, the grain width and the grain thickness of grains in the functionally-obtained mutant lg7 are lengthened, widened and thickened, so that the grain weight is increased. Transgenic rice with enlarged grains and increased grain weight can be obtained by over-expressing OsFBX250 gene; meanwhile, the OsFBX250 gene expression is knocked out or reduced, so that rice grains can be reduced in size and grain weight. Therefore, the OsFBX250 gene can be used for rice breeding, so that the rice grain type is enlarged, and the rice yield is improved. The invention lays a foundation for cultivating transgenic plants with changed grain types.
Description
Technical Field
The invention relates to the field of genetic engineering and plant genetic breeding, in particular to application of an F-box protein coding gene OsFBX250 in rice breeding.
Background
The F-box protein is widely existed in eukaryote, the N end of the protein has a highly conserved F-box motif, the motif can mediate the interaction between the protein and the protein, and the related substrate protein can be specifically identified in the ubiquitin-proteasome pathway, so that the protein participates in various life activities, such as cell cycle regulation, cell signal transduction, apoptosis, transcription regulation, immunoreaction, male sterility, plant leaf development and the like. Most F-box proteins often contain a relevant functional domain at the C-terminus, and are classified into 3 types according to their C-termini: leucine-rich repeats (FBL), WD-40-rich repeats (FBW), and sequences containing some unidentified or no obvious structural Features (FBX).
In Arabidopsis thaliana and rice there are 779 and 687F-box proteins, respectively, which play a role in many signaling pathways. In Arabidopsis, F-box protein is combined with ASK protein to form SCF complex specific recognition substrate protein, and participates in the degradation of protein through ubiquitin proteasome pathway, thereby exerting corresponding biological function. UFO (unsual floral organisns) is the first F-box gene identified in plants, which can cause a series of floral dysplasias of Arabidopsis thaliana after mutation, and UFO and ATCUL1 have direct interaction, and the form of SCF-UFO complex is involved in the multi-aspect regulation and control of plant floral organ development. Slepy 1(SLY1) is a 151 amino acid F-box protein that also plays an important role in the Gibberellin (GA) signaling pathway: in the presence of GA, SLY1 can recognize RGA and GAI and mediate ubiquitination degradation of these two DELLA proteins. The Arabidopsis F-box protein TIR1 acts as an auxin receptor and mediates a series of auxin responses through direct interaction with auxin. The F-box protein is also found to participate in stress reactions such as ABA, drought, high salt and the like.
Most of the F-box proteins in rice belong to the FBX subfamily and play an important role in the growth and development process of rice. OsFBK12 participates in 26S proteasome degradation pathway through interaction with OSK1, and further recognizes the substrate OsSAMS1 to degrade the substrate, so that the ethylene level is changed to regulate the aging of leaves. The expression level of OsFBX352 is induced by abscisic acid (ABA), and the ABA level in vivo is maintained by influencing the synthesis and metabolism of ABA, so that the germination of rice seeds is regulated. APO1 is an F-box protein which codes 429 amino acids and is homologous with Arabidopsis UFO, and the increase of the expression level of the gene leads to the increase of inflorescence branches and spikelets, thereby leading to the increase of the number and the yield of rice seeds. DDF1(Dwarf and formed flower 1), an F-box protein coding gene, is important for the nutrition and flower development of rice. OsFBK12 encodes an F-box protein containing a Kelch repeat motif, which interacts with SAMS1 to regulate leaf senescence, seed size and grain number in rice.
The F-box protein coding gene plays an important role in the growth and development process of rice, but reports on rice grain development are very few, and the influence of the rice OsFBX250 gene on the growth and development of rice is not studied at present. The invention discovers that the OsFBX250 gene has extremely important regulation and control functions on the development of rice grains and can be applied to the genetic improvement of plant grain traits.
Disclosure of Invention
The invention aims to provide application of an F-box protein coding gene OsFBX250 in rice breeding.
The purpose of the invention is realized by the following technical scheme:
the invention finds that the grain length, the grain width and the grain thickness of the material lg7 of the T-DNA insertion mutant are obviously increased compared with the thousand grain weight and the flower 11(ZH11) in a control variety. Through identification of an insertion site of the T-DNA, a new gene OsFBX250 for regulating grain type is successfully cloned, and the expression level of the gene in young ears of T-DNA insertion mutants is obviously higher than that of a control ZH11, so that the OsFBX250 gene is presumed to positively regulate the grain type of rice. Further, through genetic transformation experiments, the grain length of the grains is shortened, the grain width is narrowed and the thousand seed weight is reduced after the gene is knocked out by the CRISPR technology; and the grain length, the grain width, the grain thickness and the grain weight of the grains can be lengthened, widened and thickened by over-expression of OsFBX 250. These results show that the OsFBX250 gene has important breeding application potential and can be used for deeply researching the molecular mechanism of the F-box protein for regulating and controlling the rice grain type.
Based on the functions of the OsFBX250 gene discovered by the invention, the gene can be used for rice breeding. The rice breeding is to enlarge the rice grain type, including increasing the grain length, the grain width, the grain thickness and the grain weight of rice grains, and the rice yield is increased by enlarging the rice grain type. The rice grain shape enlargement is realized by improving the expression of the OsFBX250 gene, and particularly, the expression of the OsFBX250 gene can be improved by transgenosis or changing the promoter sequence of the OsFBX250 gene.
The protein amino acid sequence coded by the OsFBX250 gene is shown in SEQ ID NO. 1; the cDNA sequence of the OsFBX250 gene is preferably shown as SEQ ID NO. 2; the promoter sequence of the OsFBX250 gene is shown in SEQ ID NO. 3.
The OsFBX250 gene has the application of improving plant varieties or preparing transgenic plants.
The invention has the advantages and effects that:
(1) experiments prove that transgenic rice with enlarged grain size can be obtained by transferring the OsFBX250 gene into a wild rice variety ZH 11; the rice material with reduced grain type can be obtained by knocking out the gene in ZH 11. Compared with a control ZH11, the grain width, the grain length and the grain weight of the over-expression transgenic rice line of the OsFBX250 are obviously increased. Therefore, the OsFBX250 gene is related to rice grain type, and lays a foundation for cultivating transgenic plants with changed grain type.
(2) The successful cloning of the OsFBX250 gene further proves the important function of the F-box gene family in the rice growth and development process and has important significance for the elucidation of the biological functions of the F-box gene family.
(3) Although some genes regulating rice grain type have been cloned, it is unclear how the F-box gene family is a molecular mechanism influencing plant growth and development through key genes. The OsFBX250 gene cloned by the invention can improve the size of rice grains, and has important theoretical significance and practical significance for further clarifying the molecular mechanism of plant grain development and cultivating new varieties of high-quality and high-yield crops by means of genetic engineering.
Drawings
Fig. 1 is a kernel phenotype plot of control ZH11 and lg7 mutants. The scale is 1 cm.
Fig. 2 is a histogram of traits for grain of control ZH11 and lg7 mutants. The data were analyzed for significance (t-test) using GraphPad software, A, B, C, D referring to statistical plots of grain length, grain width, grain thickness and thousand grain weight, where "+" and "+" represent p <0.01 and p <0.001, respectively.
FIG. 3 is a sequence alignment chart of lg7 mutant after three generations of sequencing. A is sequence data generated by sequencing, and B is the result of Blast alignment of the sequence data. Wherein the blue marker sequence is a rice Nipponbare reference sequence, and the green marker sequence is a pCR1301 vector sequence.
FIG. 4 is a diagram showing the identification of the insertion site of T-DNA in the lg7 mutant. A is a pattern diagram of T-DNA insertion sites; b and C are identification diagrams of the insertion sites of the PCR; d and E are RT-PCR and RT-qPCR respectively identifying expression level difference plots for OsFBX250, "×" represents p < 0.001.
FIG. 5 is a statistic chart of grain traits of OsFBX250 gene interference strains compared with over-expression of ZH11 and OsFBX250 genes. A and B are respectively grain graphs of OsFBX250 gene overexpression and interference strains; C. d, E, F is the statistical chart of grain length, grain thickness, thousand seed weight and grain width of the transgenic line grains. Wherein OE-1, OE-2 and OE-3 refer to three strains with OsFBX250 gene over-expression, and Ri-1, Ri-2 and Ri-3 refer to three strains with OsFBX250 gene interference. ", and" × "represent p <0.05, p <0.01, and p <0.001, respectively.
Fig. 6 is a phenotype plot of OsFBX250 gene knock-out using CRISPR technique in ZH11 background. A is a sequencing verification diagram of a knockout strain of the OsFBX250 gene; b is a kernel phenotype graph of the knockout strain; C. d, E, F and G are respectively the statistical graphs of grain length, grain width, grain thickness, thousand seed weight and seed setting rate of the knock-out strain grains. C10, C12, C14 and C15 refer to knock-out strains different from the OsFBX250 gene. ", and". indicates p <0.05, p <0.01, and p <0.001, respectively.
Detailed Description
The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the experimental procedures used are conventional and can be carried out according to recombinant techniques already described (see molecular cloning, A laboratory Manual, 2 nd edition, Cold spring harbor laboratory Press, Cold spring harbor, N.Y.); the materials, reagents and the like used are commercially available.
Example 1 cloning of LG7 Gene
The invention identifies a T-DNA mutant lg7 (figure 1) with increased rice grains, and compared with a control ZH11, the length, width, thickness and weight of the lg7 mutant grains are obviously increased (figure 2). Genomic DNA of lg7 mutant was extracted and re-sequenced in Biotech, Inc., Baimaike, Beijing. The insertion site of the T-DNA in the mutant was analyzed by sequence alignment using the partial sequence of the T-DNA and the DNA sequence generated by resequencing, and the 22066392bp position of the T-DNA inserted into chromosome 7 of the rice genome was preliminarily determined (FIG. 3).
According to the result of the re-sequencing, primers are respectively designed on the left side and the right side of 22066392bp of the rice chromosome 7 and T-DNA, and the insertion sites of the T-DNA are further verified. The sequences of the relevant primers are as follows:
GSP-F：5'-GGTCTCGGCCTTGGTAT-3'；
GSP-R：5'-GCGACAGGGTTCGTTCT-3'；
TSP-F：5'-GGCGGTAACAAGAAAGGGA-3'。
and amplifying DNAs of the ZH11 mutant and the lg7 mutant by using GSP-F/R and TSP-F/GSP-R primer pairs respectively, sequencing and identifying the amplified fragments, determining the insertion position of the T-DNA, wherein the T-DNA is inserted at-21 bp before the initiation codon of the OsFBX250 gene as can be seen from figure 4, and the expression level of the OsFBX250 gene in the scion of the mutant lg7 is obviously higher than that of the control ZH 11.
Example 2 functional analysis of LG7 Gene
Extracting RNA of rice ZH11, reversely transcribing the RNA into cDNA, and performing primer pair:
F1：5'-AGAGGATCCGGCAGCGAGAAGCCG-3'(BamH I)，
R1：5'-GAGGGTACCCCAGCAGAAGCAGCC-3'(Kpn I)；
F2：5'-GATACTAGTCCAGCAGAAGCAGCC-3'(SpeI)，
R2：5'-TTCGAGCTCGGCAGCGAGAAGCCG-3'(Sac I)；
respectively amplifying cDNA fragments of the OsFBX250 gene, digesting the cDNA fragments by using the corresponding restriction enzymes, and then connecting the cDNA fragments into a pTCK303 vector to construct an interference expression vector OsFBX250-pTCK303 of the OsFBX250 gene. The interference expression vector is introduced into a normal japonica rice variety ZH11 by adopting an agrobacterium EHA105 mediated genetic transformation method.
Using KOD high fidelity DNA polymerase and using cDNA of ZH11 as a template, and using a primer pair:
5'-ACGGGGGACGAGCTCGGTACCATGGCCGGCGACGAAATGGCCTCGC-3'，
5'-TCGTCGACTCTAGAGGATCCTCATGGCCGCGTCAGCTTCCCGCCC-3'；
the cDNA sequence of the OsFBX250 gene is amplified, and the cDNA of the OsFBX250 gene is inserted between 5'KpnI/BamHI 3' of the multiple cloning site of pCAMBIA1301-35S-NOS vector through homologous recombination technology, so as to construct the overexpression vector pCAMBIA1301-35S-OsFBX250-NOS of the OsFBX250 gene. The interference expression vector is introduced into a normal japonica rice variety ZH11 by adopting an agrobacterium EHA105 mediated genetic transformation method.
Transplanting all transgenic seedlings obtained by screening with a hygromycin solution for 48 hours into a greenhouse for planting, harvesting seeds of single positive plants until homozygous transgenic plants are identified in T2 generations, and obtaining an interference strain and an over-expression strain of the OsFBX250 gene respectively.
Grain length, grain width, grain thickness and grain weight of OsFBX250 gene overexpression plant grains are all obviously higher than those of a control ZH11, and grain length, grain width and grain weight of OsFBX250 gene interference plant grains are all obviously lower than those of a control ZH11 (figure 5), which indicates that the OsFBX250 gene positively regulates the size of rice grains.
Example 3 knockout analysis of LG7 Gene
According to the cDNA sequence of the OsFBX250 gene, the following 2 targets are selected for CRISPR knockout:
Target 1：GATACCAAGGCCGAGACCGGAGG，
Target 2：GGAGGACGATACCTCATTCAAGG。
and carrying out CRISPR knockout vector construction and genetic transformation on Wuhan Boehfar biotechnology limited company to obtain a knockout strain of OsFBX250 gene on ZH11 background. Taking the leaf of the knock-out strain, extracting DNA, and carrying out PCR amplification on a target sequence by adopting the following primers:
5'-GCCCTTCGTCGGCTTCCTCG-3'，
5'-CCGGTGACGAAAACACTAGGCTC-3'。
after the amplification product is cut and recovered, sequencing analysis is carried out, the results show that 4 strains are successfully knocked out, namely C10, C12, C14 and C15, and the grain length, grain width and grain weight of knocked-out strain grains are obviously lower than those of a control ZH11 (figure 6), so that the influence of the OsFBX250 gene on the rice grain development is further proved.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> Wuhan bioengineering college
Application of <120> F-box protein coding gene OsFBX250 in rice breeding
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 585
<212> PRT
<213> Oryza sativa
<400> 1
Met Ala Gly Asp Glu Met Ala Ser Pro Ser Pro Pro Val Ala Ala Leu
1 5 10 15
Thr Asn Asp Leu Ile Ala Glu Ile Phe Leu Arg Leu Pro Thr Pro Glu
20 25 30
Asp Leu Val Arg Ala Ser Ala Ala Cys Val Ser Phe Arg Arg Leu Val
35 40 45
Thr Thr Asp Arg Ser Phe Leu Arg Arg Phe Arg Ser Leu His Ala Pro
50 55 60
Pro Phe Val Gly Phe Leu Asp His Arg Gly Phe His Pro Ala Leu Pro
65 70 75 80
Pro His Pro Ser Ala Pro Val Ala Arg Ala Val Ala Asp Ala Ala Asp
85 90 95
Phe Ala Leu Ser Phe Leu Pro Ser Pro Ala Gly Ser Trp Met Val Arg
100 105 110
Asp Val Arg Gly Gly Arg Val Leu Val Asp Arg Asp Thr Lys Ala Glu
115 120 125
Thr Gly Gly Ser Glu Lys Pro Leu Val Phe Thr Glu Ile Ala Val Cys
130 135 140
Asp Pro Leu Arg Arg Arg Phe Leu Leu Leu Pro Pro Ile Pro Asp Asp
145 150 155 160
Leu Ala Ala Ser Val Asp Arg Pro Val Arg Val His Leu Asp Arg Trp
165 170 175
Cys Glu Pro Phe Leu Ala Pro His Ile Glu Glu Glu Glu Asp Asp Thr
180 185 190
Ser Phe Lys Val Ile Trp Met Ala Gln Cys Lys Ala Lys Ile Ile Ala
195 200 205
Phe Val Phe Asn Ser Ser Thr Gly Gln Trp Leu Ala Gly Ala Ser Pro
210 215 220
Ser Thr Thr Asp Leu Phe Asn Gly Ala Gly Leu Ser Pro Pro Pro Ser
225 230 235 240
Ser Ser Ser Pro Ser Leu Val Phe Ser Ser Pro Gly Arg Val Phe Ser
245 250 255
Ser Arg Arg Tyr Ala Cys Gly Cys Phe Cys Trp Gly Ile Leu Arg Thr
260 265 270
Met Leu Leu Val Leu Asp Thr Arg Leu Met Lys Phe Ser Ile Ala Glu
275 280 285
Pro Pro Pro Val Cys Leu Gly Gly Pro Thr Ala Ile Val Glu Ala Gly
290 295 300
Glu Gly Met Thr Gly Ile Phe Ala Leu Arg Gly Ser Val Gly Gly Thr
305 310 315 320
Phe Asp Leu His Tyr Ser Ile Trp Gly Lys Glu Gly Ala Thr Arg Arg
325 330 335
Glu Gln Met Glu Lys Ile Ile Pro Leu Asp His Gly Tyr Arg Tyr Tyr
340 345 350
Ile Arg Gly Ala Met Glu Lys His Leu Leu Leu Ala Arg Ser Arg Gly
355 360 365
Glu Gly Glu Glu Asp Thr Pro Glu Glu Pro Asp Leu Glu Cys Phe Ser
370 375 380
Leu Asp Val Lys Thr Leu Gln Leu Glu Pro Asp Leu Thr Tyr Pro Gly
385 390 395 400
Thr Thr Ile Leu Asp Lys Pro Phe Arg Ala Arg Leu Tyr Pro Thr Leu
405 410 415
Asp Gly Val Ser Val Met Val Ile Val Met Val Ile Glu Thr Leu Tyr
420 425 430
Asp Leu Asp Ile Tyr Val His Lys Ile Leu Ser Lys Gln Leu Cys Lys
435 440 445
Arg Phe Ser Tyr Thr Thr Ser Phe Val Val Pro Lys Ala Asn Glu Leu
450 455 460
Lys Ile Gln Leu Lys His Arg Tyr Val Phe Pro Lys Ala Asn Asn Leu
465 470 475 480
Lys Asn Val Gly Phe Gly Ala Val Gly Ser Trp Leu Arg Ser Gly Gly
485 490 495
Glu Val Gly Ser Gly Gly Glu Ser Ala Ser Asp Gly Ser Gly Gly Val
500 505 510
Arg Arg Leu Gly Gly Leu Glu Ala Ala Glu Val Asp Glu Pro Glu Glu
515 520 525
Glu Arg Arg Val Val Asp Gly Ala Val Ala Ala Glu Glu Val Ala Ala
530 535 540
Gly Asp Glu Ser Ala Glu Gly Asp Val Gly Gly Gly Gly Ala Gly Glu
545 550 555 560
Val Arg Gly Arg Ala Asp Thr Glu Glu Asp Leu Leu Gln Glu Leu Val
565 570 575
Ser Glu Gly Gly Lys Leu Thr Arg Pro
580 585
<210> 2
<211> 1758
<212> DNA
<213> Oryza sativa
<400> 2
atggccggcg acgaaatggc ctcgccgtcg ccgccggtgg cggcgctcac caacgacctc 60
atcgcggaga tcttcctccg cctacccacc ccggaggacc tcgtccgcgc ctccgcggca 120
tgcgtctcct tccgccgtct cgtcaccacc gaccgctcct tcctccgccg cttccgctcc 180
ctccacgccc cgcccttcgt cggcttcctc gaccacaggg gcttccaccc ggcgctccct 240
ccccacccct ccgctcccgt cgccagggcg gtggccgacg ccgcggactt cgccctctcc 300
ttcctcccct ccccagccgg cagctggatg gtccgcgacg tccgcggcgg ccgcgtcctc 360
gtcgaccgag ataccaaggc cgagaccgga ggcagcgaga agccgttggt cttcacggag 420
atcgccgtgt gcgaccccct gcgccggcga ttcctcctcc ttcccccgat ccccgacgac 480
ctcgccgctt cggtggaccg ccctgtccgc gtccacctgg accgctggtg cgagcccttc 540
ctcgctcccc acatcgaaga ggaggaggac gatacctcat tcaaggtgat ctggatggcg 600
cagtgcaagg ccaagattat cgccttcgtc ttcaattcga gcaccggtca atggctagcc 660
ggtgcctccc cgagcaccac cgatctgttc aatggcgccg gtctgtcgcc gccgccgtcg 720
tcgtcgtcac cgagcctagt gttttcgtca ccgggtcgag tgttctccag ccgccgatac 780
gcgtgcggct gcttctgctg ggggattttg aggaccatgt tgctggtgct cgacacacga 840
ctgatgaaat tctccattgc tgaaccccca ccagtctgcc ttgggggacc gaccgccatt 900
gttgaggcag gggaaggcat gactgggatc tttgctctcc gggggagcgt tggtggcacg 960
tttgatctcc actacagcat ttggggaaaa gaaggggcga ctcgtcgcga gcagatggag 1020
aagataatcc cactggatca tggctaccgg tattacatta gaggtgcgat ggagaagcac 1080
ttgctgttag ccaggtcgcg aggggaaggc gaagaagata caccagagga gccagatttg 1140
gaatgctttt cactggatgt caagaccttg cagcttgagc cggatttgac ctatcctgga 1200
acaacaattc tggacaagcc cttccgagct aggttatatc ctactctaga tggagtatct 1260
gttatggtta ttgttatggt tattgaaact ttgtatgact tggatattta tgtgcacaag 1320
atattaagca aacaattgtg caagagattt tcttatacga cttcttttgt agttccaaaa 1380
gcaaacgagc ttaaaatcca actcaaacac agatatgtat ttccaaaagc gaacaatctt 1440
aaaaacgtgg gcttcggagc ggtggggagc tggcttcgga gcggtgggga agtcggcagc 1500
ggcggcgaga gcgcgagcga tgggagcgga ggggtgcggc ggctgggcgg gctcgaagcc 1560
gccgaggtgg acgaacccga ggaggagagg cgggtggtag acggagcggt agcagcggag 1620
gaagtggcgg ccggcgatga gtcggcggaa ggagacgtag gcggaggagg cgcgggcgag 1680
gtccgcggga gagccgatac agaagaagat ctcctccaag agctcgtcag tgagggcggg 1740
aagctgacgc ggccatga 1758
<210> 3
<211> 2415
<212> DNA
<213> Oryza sativa
<400> 3
gaagaagcgg ggaaatagaa gggaggaaga acaaggagaa gtggagttga taagtgggct 60
ccaccatatt ttcattttta ctgctgtccc ttacatgtgg gacccacttc tatttttaat 120
ttctttgatg actaggctga cagcactttt ggaccaagac aattacaaca ttagcaaaaa 180
cgcttctcaa accgctaaaa gagttaattt gcaccggtct ttaaagttac gagaggcatt 240
atactcgatt ttgcggttga gacaagcaat tcaaactagg gacggcaatg ggtcaggtcg 300
ggcacgagta gagcaaaatc atgcccgact cggcacccga ccttgcccgc ccgaaccctg 360
cccaacagga ttaatgggca aaactccgtg cccataccca tgcccgacag gcacgggtat 420
gcccggtgga tatccattgg gtatgccttc cgccttccgc ctcccgtcgc cggttcgccg 480
ccctcgatcg tcgtcattgt cgcctgctgc cgccggctcg tcgccctcgg tcgctgtcac 540
cggctcgtca ttgtcgccct gagccgccgt cgccggctca ccgccctcgt catcgaggcc 600
ctaagctgtc accgccgcca tcgtggccct gaggagccgc cgccgccgtc gccctgcgag 660
gttacgacgc catctcgcgc cgccgctccc tgccgtcgcc tgcccgcgcc gccactgcgc 720
tgtctcttgc ttgggtcgcc gctgtcgttg ctaatccgtg ccgtcatcgc tagcctgcgc 780
cgccgccgcc gccataggga ttagaatagg agaggggagt ggggaatacc ggaataggag 840
aggggattgg aataggttag ggtttctatt agttgagtat atatatgtcc atagttagtg 900
ggccaaatgg gccaaataaa tggatataag gaataagaga taggccaaaa ttaggtcata 960
tatatgtatg agtcgggtat ggactatccg cggacaaaaa acaataccca attattgccc 1020
acgatgttct cgggtttcgg acgggcgtgc ccaccgacaa aatattacac ccatgtccat 1080
accaatcggg ctgggtatcc gtggatatct ggactcgcgg gcaaaattgc catctctaat 1140
tcaaacaagg gcaagatatg tgtgaaccaa atagactttt tttttacttg gtcagtgact 1200
cagtcccatg gagcaaaggt tagctttgag tcaagagtgt gttcggatgc cccttttctc 1260
aacccctctg cctcgttttc tgcgcgtaca tttttcaaac cgctaaacaa tgcgtttttg 1320
gtttttttgc gaaaaaattc tatacgaaag ttgtttaaaa aaatcaaatt aattcttttt 1380
ttaaaaaaat tagctaatac ttaattaatc acgcgctaat aaacctctct atttttcgtg 1440
cgttactgtt ccggttggga tatgagatag cgaacacaaa gcctttttac tccacaaacc 1500
aaaccaacca ccctccctgg gactgggatc cataagtcct aaaccgaatt tcctattgcg 1560
cgcgtctgcg ccagcgaacg aagtcgcgcg cggttccggc ccagcccact acacgattgc 1620
gcagtgtcgc agtgcaggaa ggtcagtagg tggggacacg cacacgttca catgcgcaga 1680
taagattgga ttagcgtaat caggttttga ctaatcacga tctgaattat ggtgaccatt 1740
ctttttttct tttcgcataa aggttgtttt ctttttatta ctacaaattt caaaaactta 1800
tacataatat ttaaattttc aaataaaatt taaaaccttc taaaaaaagt catatccaaa 1860
atttaaaact tttaacttga aagttgaaaa ttttcaactt aaaatttaaa tgctttcttc 1920
tcaaaatttg aaactctcca ctcaaaattg gaaaacttcc aacataaaat tcaaaatttt 1980
catctcaaaa tcaaaaactt tcatattgaa attcaaaact ttcaactcaa attttaaaaa 2040
cttttaactc aaaattcaaa gttttcatct caaaatttaa atactttcaa cttaaatttg 2100
aaaactttca agtcaatatt taaaaaattt taaattagat tttgaaaact ttcaaatcaa 2160
ttttgaaaac tttcaaatta gattttgaaa actttcgact cgaattttta ttgttgtatt 2220
gtgaaattac tgtagcgtgt gattaaatct aattaccgtg attaacgcta atctccgtga 2280
ttaacgatgg gatcgcgaca gggttcgttc tgcagctgaa cacgtggaag tgcgcgcgag 2340
taactgaacc ggcgcgtacg cgcgaattag taatccccgt cctaaacctc cttcccccgg 2400
ctggcggctg caccg 2415
Claims (7)
- The application of OsFBX250 gene in rice breeding is characterized in that: the rice breeding is to enlarge the rice grain type and improve the rice yield; the grain type comprises the grain length, the grain width, the grain thickness and the grain weight of rice grains.
- 2. Use according to claim 1, characterized in that: the rice grain type is enlarged by increasing the expression of OsFBX250 gene.
- 3. Use according to claim 2, characterized in that: the expression of the OsFBX250 gene is improved by transgenosis or changing the promoter sequence of the OsFBX250 gene.
- 4. Use according to any one of claims 1 to 3, characterized in that: the amino acid sequence of the OsFBX250 protein coded by the OsFBX250 gene is shown in SEQ ID NO. 1.
- 5. Use according to any one of claims 1 to 3, characterized in that: the cDNA sequence of the OsFBX250 gene is shown as SEQ ID NO. 2.
- 6. Use according to any one of claims 1 to 3, characterized in that: the promoter sequence of the OsFBX250 gene is shown in SEQ ID NO. 3.
- 7. Use of the OsFBX250 gene of claim 3, 4 or 5 for plant variety improvement or for the production of transgenic plants.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210510818.2A CN114805515B (en) | 2022-05-11 | 2022-05-11 | Application of F-box protein coding gene OsFBX250 in rice breeding |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210510818.2A CN114805515B (en) | 2022-05-11 | 2022-05-11 | Application of F-box protein coding gene OsFBX250 in rice breeding |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114805515A true CN114805515A (en) | 2022-07-29 |
| CN114805515B CN114805515B (en) | 2023-05-02 |
Family
ID=82513862
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210510818.2A Active CN114805515B (en) | 2022-05-11 | 2022-05-11 | Application of F-box protein coding gene OsFBX250 in rice breeding |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114805515B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110265221A1 (en) * | 2007-07-10 | 2011-10-27 | Monsanto Technology Llc | Transgenic plants with enhanced agronomic traits |
| CN106434666A (en) * | 2016-10-20 | 2017-02-22 | 武汉生物工程学院 | Application of promoter achieving specific expression in rice tiller bud base and panicle |
| CN108034661A (en) * | 2017-12-19 | 2018-05-15 | 武汉生物工程学院 | Application of the OsNPF8.8b genes in rice yield and nutritional quality is improved |
| CN108727479A (en) * | 2017-04-18 | 2018-11-02 | 中国科学院上海生命科学研究院 | Regulate and control F-BOX albumen and its application of Leaf inclination |
| CN109486823A (en) * | 2018-12-28 | 2019-03-19 | 武汉生物工程学院 | A kind of application of highly expressed long-grained nonglutinous rice type promoter in japonica rice |
| CN111848765A (en) * | 2020-07-22 | 2020-10-30 | 中国水稻研究所 | Rice gene OsFBK4 and mutant and application thereof |
| CN112574288A (en) * | 2020-12-30 | 2021-03-30 | 中国农业科学院作物科学研究所 | Application of wheat TaFBX113 gene in regulation of grain thickness development |
-
2022
- 2022-05-11 CN CN202210510818.2A patent/CN114805515B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110265221A1 (en) * | 2007-07-10 | 2011-10-27 | Monsanto Technology Llc | Transgenic plants with enhanced agronomic traits |
| CN106434666A (en) * | 2016-10-20 | 2017-02-22 | 武汉生物工程学院 | Application of promoter achieving specific expression in rice tiller bud base and panicle |
| CN108727479A (en) * | 2017-04-18 | 2018-11-02 | 中国科学院上海生命科学研究院 | Regulate and control F-BOX albumen and its application of Leaf inclination |
| CN108034661A (en) * | 2017-12-19 | 2018-05-15 | 武汉生物工程学院 | Application of the OsNPF8.8b genes in rice yield and nutritional quality is improved |
| CN109486823A (en) * | 2018-12-28 | 2019-03-19 | 武汉生物工程学院 | A kind of application of highly expressed long-grained nonglutinous rice type promoter in japonica rice |
| CN111848765A (en) * | 2020-07-22 | 2020-10-30 | 中国水稻研究所 | Rice gene OsFBK4 and mutant and application thereof |
| CN112574288A (en) * | 2020-12-30 | 2021-03-30 | 中国农业科学院作物科学研究所 | Application of wheat TaFBX113 gene in regulation of grain thickness development |
Non-Patent Citations (4)
| Title |
|---|
| GENBANK: "Accession No.： XM_015790539.2，PREDICTED: Oryza sativa Japonica Group uncharacterized LOC107277001 (LOC107277001), mRNA" * |
| GENBANK: "Accession No.:BAC83329.1，hypothetical protein [Oryza sativa Japonica Group]" * |
| MING LI: "Mutations in the F-box gene LARGER PANICLE improve the panicle architecture and enhance the grain yield in rice" * |
| 赵黎明: "水稻2个F-box基因的生物信息学分析" * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114805515B (en) | 2023-05-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107164347B (en) | Ideal plant type gene NPT1 for controlling rice stem thickness, tillering number, spike grain number, thousand grain weight and yield and its application | |
| CN111206041B (en) | Application of OsBAK1P gene in controlling drought resistance of rice | |
| CN110317249B (en) | Chimonanthus praecox CpAP1 gene and coded protein and application thereof | |
| CN107746846B (en) | IbABF4 gene for coding sweet potato bZIP transcription factor and application thereof | |
| CN110643589B (en) | Protein for improving drought resistance of plants and application thereof | |
| CN112250742B (en) | Use of proteins and their related biomaterials for modulating mechanical strength in plants | |
| CN113372423B (en) | Application of wild soybean Bet _ v _1 family gene GsMLP328 | |
| CN112342236B (en) | Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield | |
| CN109504687B (en) | Soybean lipid transporter gene GmABCA9 and application thereof | |
| CN110684088B (en) | Protein ZmbZIPa3 and application of coding gene thereof in regulating and controlling plant growth and development and stress tolerance | |
| CN110093353B (en) | Cold-resistant related coding gene of ordinary wild rice in bud stage and application thereof | |
| CN110777150B (en) | Application of protein GmPLATZ in regulation and control of plant seed yield | |
| CN108341857B (en) | Rice yield related protein and coding gene and application thereof | |
| CN113999858B (en) | SiPLATZ12 gene for regulating and controlling growth and development of foxtail millet and application thereof | |
| CN112239761A (en) | Genetic engineering application of rice grain length gene | |
| CN109097367B (en) | Rubber tree HbWRKY82 gene and application thereof | |
| CN114805515B (en) | Application of F-box protein coding gene OsFBX250 in rice breeding | |
| CN110904146B (en) | Application of arabidopsis GIF1 gene in regulation of seed size | |
| CN114574520A (en) | Application of TaSR45a gene in cultivating anti-gibberellic disease plants | |
| CN110468138B (en) | Gene TSG2 for controlling cold resistance of rice and application thereof | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN107903312B (en) | Rice zinc finger protein and coding gene and application thereof | |
| WO2001070987A2 (en) | Novel inflorescence meristem development gene, promoter, and methods of use for same | |
| CN114634560B (en) | Cotton GhIQD21 gene sequence, cloning and application thereof | |
| CN114230648B (en) | Application of rice gene PANDA in improving plant yield |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |