CN114805515B

CN114805515B - Application of F-box protein coding gene OsFBX250 in rice breeding

Info

Publication number: CN114805515B
Application number: CN202210510818.2A
Authority: CN
Inventors: 汪杰; 黎钟懋; 吕凯; 张筱琳; 郑雯仙
Original assignee: Wuhan Bioengineering Institute
Current assignee: Wuhan Bioengineering Institute
Priority date: 2022-05-11
Filing date: 2022-05-11
Publication date: 2023-05-02
Anticipated expiration: 2042-05-11
Also published as: CN114805515A

Abstract

The invention discloses application of an F-box protein coding gene OsFBX250 in rice breeding, belonging to the fields of genetic engineering and plant genetic breeding. According to the invention, a novel regulatory rice grain type gene OsFBX250 is cloned for the first time, and grain length, width and thickness of grains in the function-obtained mutant lg7 are prolonged, and grain weight is increased. Transgenic rice with increased grain size and grain weight can be obtained by over-expressing the OsFBX250 gene; meanwhile, the OsFBX250 gene expression is knocked out or reduced, so that the rice grains are reduced and the grain weight is reduced. Therefore, the OsFBX250 gene can be used for rice breeding to make rice grains become larger and rice yield is improved. The invention lays a foundation for cultivating grain-type changed transgenic plants in rice.

Description

Application of F-box protein coding gene OsFBX250 in rice breeding

Technical Field

The invention relates to the fields of genetic engineering and plant genetic breeding, in particular to application of an F-box protein coding gene OsFBX250 in rice breeding.

Background

F-box proteins are widely found in eukaryotes, and have a highly conserved F-box motif at the N-terminus, which mediates protein-protein interactions, and which is involved in various vital activities such as cell cycle regulation, cell signaling, apoptosis, transcriptional regulation, immune response, male sterility, plant leaf development, etc., due to the specific recognition of related substrate proteins in the ubiquitin-proteasome pathway. The C-terminus of most F-box proteins often contains a related domain, and F-box proteins are classified into 3 classes according to their C-termini: leucine rich repeat (FBL), WD-40 rich repeat (FBW) and sequences with some undetermined or no apparent structural Features (FBX).

In Arabidopsis and rice there are 779 and 687F-box proteins, respectively, which play a role in many signaling pathways. In arabidopsis, the F-box protein binds to ASK protein to form SCF complex specifically recognizing substrate protein, and participates in degradation of protein through ubiquitin proteasome pathway, thereby exerting corresponding biological function. UFO (unusual floral organs) is the first F-box gene identified in plants, which after mutation can lead to a series of flower dysplasia in Arabidopsis thaliana, and UFO and ATCUL1 have direct interactions, the form of the SCF-UFO complex is involved in the multifaceted regulation of plant flower organ development. SLEEPY1 (SLY 1) is a 151 amino acid F-box protein that also plays an important role in the Gibberellin (GA) signaling pathway: in the presence of GA, SLY1 recognizes RGA and GAI and mediates ubiquitination degradation of both DELLA proteins. The Arabidopsis F-box protein TIR1, acting as an auxin receptor, mediates a series of auxin reactions by direct interactions with auxin. F-box proteins have also been found to be involved in ABA, drought, and high salt stress responses.

Most of F-box proteins in rice belong to the FBX subfamily and play an important role in the growth and development process of rice. OsFBK12 further recognizes the substrate OsSAMS1 through interaction with OSK1 to degrade it, thereby altering ethylene levels to regulate senescence in leaves. The expression level of OsFBX352 is induced by abscisic acid (ABA), and the in-vivo ABA level is maintained by affecting the synthesis and metabolism of ABA, so that the germination of rice seeds is regulated. APO1 is an F-box protein which codes 429 amino acids and is homologous to Arabidopsis UFO, and the improvement of the expression quantity of the gene leads to the increase of inflorescence branches and spikelets, thereby leading to the increase of rice grain number and yield. DDF1 (Dwarf and deformed flower 1), an F-box protein coding gene, is critical to the nutrition and flower development of rice. OsFBK12 encodes an F-box protein containing a Kelch repeat motif that interacts with SAMS1 to regulate leaf senescence, seed size, and grain number in rice.

The F-box protein coding gene plays an important role in the growth and development process of rice, but few reports are provided in the aspect of rice grain development, and the influence of the rice OsFBX250 gene on the growth and development of rice is not studied at present. The invention discovers that the OsFBX250 gene has extremely important regulation and control effect on the development of rice kernels, and can be applied to genetic improvement of plant kernel traits.

Disclosure of Invention

The invention aims to provide an application of an F-box protein coding gene OsFBX250 in rice breeding.

The aim of the invention is achieved by the following technical scheme:

the invention discovers that the grain length, grain width and grain thickness of a T-DNA insertion mutant material lg7 are obviously increased compared with thousand grain weight and flower 11 (ZH 11) in a control variety. By identifying the insertion site of the T-DNA, a novel gene OsFBX250 for regulating the grain type is successfully cloned, and the expression level of the gene in young ears of the T-DNA insertion mutant is obviously higher than that of a control ZH11, so that the gene OsFBX250 is presumed to positively regulate the grain type of rice. Further through genetic transformation experiments, the gene is found that the grain length is shortened, the grain width is narrowed and the thousand grain weight is reduced after being knocked out by CRISPR technology; whereas overexpression of OsFBX250 resulted in longer grain length, wider grain width, thicker grain thickness and increased grain weight. The results show that the OsFBX250 gene has important breeding application potential and can be used for deeply researching the molecular mechanism of the F-box protein for regulating rice grain types.

Based on the discovered function of the OsFBX250 gene, the gene can be used for rice breeding. The rice seed selection is to make rice grains become larger, and comprises the steps of increasing the grain length, the grain width, the grain thickness and the grain weight of rice grains, and increasing the rice yield by making the rice grains become larger. The rice grain type is enlarged by improving the expression of the OsFBX250 gene, and the expression of the OsFBX250 gene can be improved by transgenic or changing the promoter sequence of the OsFBX250 gene.

The amino acid sequence of the protein coded by the OsFBX250 gene is shown as SEQ ID NO. 1; the cDNA sequence of the OsFBX250 gene is preferably shown in SEQ ID NO. 2; the promoter sequence of the OsFBX250 gene is shown as SEQ ID NO. 3.

The OsFBX250 gene has the application of plant variety improvement or transgenic plant preparation.

The invention has the advantages and effects that:

(1) Experiments prove that transgenic rice with large grain size can be obtained by transferring an OsFBX250 gene into a wild rice variety ZH 11; knocking out the gene in ZH11 can obtain rice material with reduced grain size. Compared with the control ZH11, the grain width is obviously increased, the grain length is obviously prolonged and the grain weight is obviously increased in the overexpression transgenic rice line of the OsFBX 250. Therefore, the OsFBX250 gene is related to rice grain types, and lays a foundation for cultivating transgenic plants with changed grain types.

(2) Successful cloning of the OsFBX250 gene further proves the important role of the F-box gene family in the growth and development process of rice, and has important significance for elucidating the biological functions of the F-box gene family.

(3) Although some genes regulating rice grain types have been cloned at present, it is still unclear how the F-box gene family affects the molecular mechanisms of plant growth and development through key genes. The cloned OsFBX250 gene can improve the rice grain size, and has important theoretical significance and practical significance for further elucidating the molecular mechanism of plant grain development and cultivating new varieties of crops with high quality and high yield by a genetic engineering means.

Drawings

FIG. 1 is a grain phenotype map of control ZH11 and lg7 mutants. The scale is 1cm.

FIG. 2 is a statistical histogram of the properties of kernels of control ZH11 and lg7 mutants. Data were analyzed for significance using GraphPad software (t-test), A, B, C, D refers to statistical plots of grain length, grain width, grain thickness and thousand grain weight, respectively, where "×" and "×" represent p <0.01 and p <0.001, respectively.

FIG. 3 is a sequence alignment of the lg7 mutant after three generations of sequencing. A is sequence data generated by sequencing, and B is a result of Blast comparison of the sequence data. Wherein the blue mark sequence is rice Japanese eye reference sequence, and the green mark sequence is pCR1301 vector sequence.

FIG. 4 is a graph identifying the insertion site of T-DNA in the lg7 mutant. A is a T-DNA insertion site pattern; b and C are identification diagrams of the insertion sites by PCR; d and E are graphs of differences in expression levels of OsFBX250 identified by RT-PCR and RT-qPCR, respectively, "×" represents p <0.001.

FIG. 5 is a statistical plot of seed character of control ZH11 and OsFBX250 gene overexpression, osFBX250 gene interference lines. A and B are seed patterns of OsFBX250 gene overexpression and interference lines respectively; C. d, E, F is a statistical plot of grain length, grain thickness, thousand grain weight and grain width, respectively, of the transgenic lines. Wherein OE-1, OE-2 and OE-3 refer to three strains overexpressing the OsFBX250 gene, and Ri-1, ri-2 and Ri-3 refer to three strains interfering with the OsFBX250 gene. "," and "," respectively represent p <0.05, p <0.01 and p <0.001.

Fig. 6 is a phenotypic map after knockout of OsFBX250 gene using CRISPR technique in ZH11 background. A is a sequencing verification diagram of a knockout strain of the OsFBX250 gene; b is a grain phenotype map of the knockout strain; C. d, E, F and G are statistical graphs of grain length, grain width, grain thickness, thousand grain weight and seed setting rate, respectively, of the seed grains of the knockout line. C10, C12, C14 and C15 refer to knockout lines of OsFBX250 genes. "," and "," respectively represent p <0.05, p <0.01 and p <0.001.

Detailed Description

The present invention will be described in further detail with reference to examples, but embodiments of the present invention are not limited thereto. The technical means used in the following examples are conventional means well known to those skilled in the art unless otherwise indicated; the experimental methods used are all conventional and can be carried out according to the described recombinant techniques (see molecular cloning, laboratory manual, 2 nd edition, cold spring harbor laboratory Press, cold spring harbor, N.Y.); the materials, reagents, and the like used are all commercially available.

EXAMPLE 1 cloning of LG7 Gene

The present invention identified an increased grain size T-DNA mutant lg7 (FIG. 1), with a significant increase in grain length, grain width, grain thickness and grain weight of the lg7 mutant grain relative to the control ZH11 (FIG. 2). The genomic DNA of the lg7 mutant was extracted and re-sequenced in Beijing Baimai Biotechnology Co. Sequence alignment was performed using the partial sequence of T-DNA and the DNA sequence generated by resequencing, and the insertion site of T-DNA in the mutant was analyzed to preliminarily determine the 22066392bp position of T-DNA inserted into chromosome 7 of rice genome (FIG. 3).

According to the resequencing result, primers are respectively designed on both sides of 22066392bp of rice chromosome 7 and T-DNA, so as to further verify the insertion site of the T-DNA. The relevant primer sequences are as follows:

GSP-F：5'-GGTCTCGGCCTTGGTAT-3'；

GSP-R：5'-GCGACAGGGTTCGTTCT-3'；

TSP-F：5'-GGCGGTAACAAGAAAGGGA-3'。

DNA of ZH11 and lg7 mutants was amplified with GSP-F/R and TSP-F/GSP-R primer pairs, and the amplified fragments were sequenced and identified to determine the insertion position of T-DNA, and it can be seen from FIG. 4 that T-DNA was inserted at-21 bp before the initiation codon of OsFBX250 gene, and that the expression level of OsFBX250 gene in young ears of mutant lg7 was significantly higher than that of control ZH11.

Example 2 functional analysis of LG7 Gene

Extracting RNA of rice ZH11, reversely transcribing the RNA into cDNA, and utilizing a primer pair:

F1：5'-AGAGGATCCGGCAGCGAGAAGCCG-3'(BamH I)，

R1：5'-GAGGGTACCCCAGCAGAAGCAGCC-3'(Kpn I)；

F2：5'-GATACTAGTCCAGCAGAAGCAGCC-3'(SpeI)，

R2：5'-TTCGAGCTCGGCAGCGAGAAGCCG-3'(Sac I)；

cDNA fragments of the OsFBX250 gene are respectively amplified, and are connected into a pTCK303 vector after being subjected to enzyme digestion by the corresponding restriction enzymes, so that an interference expression vector OsFBX250-pTCK303 of the OsFBX250 gene is constructed. The agrobacterium EHA105 mediated genetic transformation method is adopted to introduce the interference expression vector into the normal japonica rice variety ZH11.

Using KOD high-fidelity DNA polymerase with ZH11 cDNA as template, using primer pair:

5'-ACGGGGGACGAGCTCGGTACCATGGCCGGCGACGAAATGGCCTCGC-3'，

5'-TCGTCGACTCTAGAGGATCCTCATGGCCGCGTCAGCTTCCCGCCC-3'；

the cDNA sequence of the OsFBX250 gene is amplified, and the cDNA of the OsFBX250 gene is inserted between 5'KpnI/BamHI 3' of the multiple cloning sites of the pCAMBIA1301-35S-NOS vector by homologous recombination technology, so as to construct the overexpression vector pCAMBIA1301-35S-OsFBX250-NOS of the OsFBX250 gene. The agrobacterium EHA105 mediated genetic transformation method is adopted to introduce the interference expression vector into the normal japonica rice variety ZH11.

And (3) transplanting all transgenic seedlings obtained by screening the hygromycin solution for 48 hours into a greenhouse for planting, and collecting single positive plants until a homozygous transgenic plant is identified in the T2 generation, thus obtaining an interference strain and an overexpression strain of the OsFBX250 gene respectively.

The grain length, grain width, grain thickness and grain weight of the OsFBX250 gene over-expressed plant grain are all significantly higher than those of the control ZH11, and the grain length, grain width and grain weight of the OsFBX250 gene interference plant grain are all significantly lower than those of the control ZH11 (fig. 5), which indicates that the OsFBX250 gene positively regulates the size of the rice grain.

EXAMPLE 3 knock-out analysis of LG7 Gene

Based on the cDNA sequence of OsFBX250 gene, CRISPR knockdown was performed with 2 targets selected as follows:

Target 1：GATACCAAGGCCGAGACCGGAGG，

Target 2：GGAGGACGATACCTCATTCAAGG。

and constructing and genetically transforming a CRISPR knockout vector in Wuhan Bo Yuan biotechnology Co Ltd to obtain a knockout strain of the OsFBX250 gene in a ZH11 background. Taking out leaves of the knocked-out strain, extracting DNA, and carrying out PCR amplification on a target sequence by adopting the following primers:

5'-GCCCTTCGTCGGCTTCCTCG-3'，

5'-CCGGTGACGAAAACACTAGGCTC-3'。

after the amplified product is cut into gel and recovered, sequencing analysis is carried out, the result shows that 4 lines are knocked out successfully, namely C10, C12, C14 and C15, and the grain length, grain width and grain weight of the knocked-out lines are all obviously lower than those of a control ZH11 (figure 6), so that the influence of an OsFBX250 gene on the rice grain development is further proved.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Sequence listing

<110> university of Wuhan bioengineering

Application of <120> F-box protein coding gene OsFBX250 in rice breeding

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 585

<212> PRT

<213> Oryza sativa

<400> 1

Met Ala Gly Asp Glu Met Ala Ser Pro Ser Pro Pro Val Ala Ala Leu

1 5 10 15

Thr Asn Asp Leu Ile Ala Glu Ile Phe Leu Arg Leu Pro Thr Pro Glu

20 25 30

Asp Leu Val Arg Ala Ser Ala Ala Cys Val Ser Phe Arg Arg Leu Val

35 40 45

Thr Thr Asp Arg Ser Phe Leu Arg Arg Phe Arg Ser Leu His Ala Pro

50 55 60

Pro Phe Val Gly Phe Leu Asp His Arg Gly Phe His Pro Ala Leu Pro

65 70 75 80

Pro His Pro Ser Ala Pro Val Ala Arg Ala Val Ala Asp Ala Ala Asp

85 90 95

Phe Ala Leu Ser Phe Leu Pro Ser Pro Ala Gly Ser Trp Met Val Arg

100 105 110

Asp Val Arg Gly Gly Arg Val Leu Val Asp Arg Asp Thr Lys Ala Glu

115 120 125

Thr Gly Gly Ser Glu Lys Pro Leu Val Phe Thr Glu Ile Ala Val Cys

130 135 140

Asp Pro Leu Arg Arg Arg Phe Leu Leu Leu Pro Pro Ile Pro Asp Asp

145 150 155 160

Leu Ala Ala Ser Val Asp Arg Pro Val Arg Val His Leu Asp Arg Trp

165 170 175

Cys Glu Pro Phe Leu Ala Pro His Ile Glu Glu Glu Glu Asp Asp Thr

180 185 190

Ser Phe Lys Val Ile Trp Met Ala Gln Cys Lys Ala Lys Ile Ile Ala

195 200 205

Phe Val Phe Asn Ser Ser Thr Gly Gln Trp Leu Ala Gly Ala Ser Pro

210 215 220

Ser Thr Thr Asp Leu Phe Asn Gly Ala Gly Leu Ser Pro Pro Pro Ser

225 230 235 240

Ser Ser Ser Pro Ser Leu Val Phe Ser Ser Pro Gly Arg Val Phe Ser

245 250 255

Ser Arg Arg Tyr Ala Cys Gly Cys Phe Cys Trp Gly Ile Leu Arg Thr

260 265 270

Met Leu Leu Val Leu Asp Thr Arg Leu Met Lys Phe Ser Ile Ala Glu

275 280 285

Pro Pro Pro Val Cys Leu Gly Gly Pro Thr Ala Ile Val Glu Ala Gly

290 295 300

Glu Gly Met Thr Gly Ile Phe Ala Leu Arg Gly Ser Val Gly Gly Thr

305 310 315 320

Phe Asp Leu His Tyr Ser Ile Trp Gly Lys Glu Gly Ala Thr Arg Arg

325 330 335

Glu Gln Met Glu Lys Ile Ile Pro Leu Asp His Gly Tyr Arg Tyr Tyr

340 345 350

Ile Arg Gly Ala Met Glu Lys His Leu Leu Leu Ala Arg Ser Arg Gly

355 360 365

Glu Gly Glu Glu Asp Thr Pro Glu Glu Pro Asp Leu Glu Cys Phe Ser

370 375 380

Leu Asp Val Lys Thr Leu Gln Leu Glu Pro Asp Leu Thr Tyr Pro Gly

385 390 395 400

Thr Thr Ile Leu Asp Lys Pro Phe Arg Ala Arg Leu Tyr Pro Thr Leu

405 410 415

Asp Gly Val Ser Val Met Val Ile Val Met Val Ile Glu Thr Leu Tyr

420 425 430

Asp Leu Asp Ile Tyr Val His Lys Ile Leu Ser Lys Gln Leu Cys Lys

435 440 445

Arg Phe Ser Tyr Thr Thr Ser Phe Val Val Pro Lys Ala Asn Glu Leu

450 455 460

Lys Ile Gln Leu Lys His Arg Tyr Val Phe Pro Lys Ala Asn Asn Leu

465 470 475 480

Lys Asn Val Gly Phe Gly Ala Val Gly Ser Trp Leu Arg Ser Gly Gly

485 490 495

Glu Val Gly Ser Gly Gly Glu Ser Ala Ser Asp Gly Ser Gly Gly Val

500 505 510

Arg Arg Leu Gly Gly Leu Glu Ala Ala Glu Val Asp Glu Pro Glu Glu

515 520 525

Glu Arg Arg Val Val Asp Gly Ala Val Ala Ala Glu Glu Val Ala Ala

530 535 540

Gly Asp Glu Ser Ala Glu Gly Asp Val Gly Gly Gly Gly Ala Gly Glu

545 550 555 560

Val Arg Gly Arg Ala Asp Thr Glu Glu Asp Leu Leu Gln Glu Leu Val

565 570 575

Ser Glu Gly Gly Lys Leu Thr Arg Pro

580 585

<210> 2

<211> 1758

<212> DNA

<213> Oryza sativa

<400> 2

atggccggcg acgaaatggc ctcgccgtcg ccgccggtgg cggcgctcac caacgacctc 60

atcgcggaga tcttcctccg cctacccacc ccggaggacc tcgtccgcgc ctccgcggca 120

tgcgtctcct tccgccgtct cgtcaccacc gaccgctcct tcctccgccg cttccgctcc 180

ctccacgccc cgcccttcgt cggcttcctc gaccacaggg gcttccaccc ggcgctccct 240

ccccacccct ccgctcccgt cgccagggcg gtggccgacg ccgcggactt cgccctctcc 300

ttcctcccct ccccagccgg cagctggatg gtccgcgacg tccgcggcgg ccgcgtcctc 360

gtcgaccgag ataccaaggc cgagaccgga ggcagcgaga agccgttggt cttcacggag 420

atcgccgtgt gcgaccccct gcgccggcga ttcctcctcc ttcccccgat ccccgacgac 480

ctcgccgctt cggtggaccg ccctgtccgc gtccacctgg accgctggtg cgagcccttc 540

ctcgctcccc acatcgaaga ggaggaggac gatacctcat tcaaggtgat ctggatggcg 600

cagtgcaagg ccaagattat cgccttcgtc ttcaattcga gcaccggtca atggctagcc 660

ggtgcctccc cgagcaccac cgatctgttc aatggcgccg gtctgtcgcc gccgccgtcg 720

tcgtcgtcac cgagcctagt gttttcgtca ccgggtcgag tgttctccag ccgccgatac 780

gcgtgcggct gcttctgctg ggggattttg aggaccatgt tgctggtgct cgacacacga 840

ctgatgaaat tctccattgc tgaaccccca ccagtctgcc ttgggggacc gaccgccatt 900

gttgaggcag gggaaggcat gactgggatc tttgctctcc gggggagcgt tggtggcacg 960

tttgatctcc actacagcat ttggggaaaa gaaggggcga ctcgtcgcga gcagatggag 1020

aagataatcc cactggatca tggctaccgg tattacatta gaggtgcgat ggagaagcac 1080

ttgctgttag ccaggtcgcg aggggaaggc gaagaagata caccagagga gccagatttg 1140

gaatgctttt cactggatgt caagaccttg cagcttgagc cggatttgac ctatcctgga 1200

acaacaattc tggacaagcc cttccgagct aggttatatc ctactctaga tggagtatct 1260

gttatggtta ttgttatggt tattgaaact ttgtatgact tggatattta tgtgcacaag 1320

atattaagca aacaattgtg caagagattt tcttatacga cttcttttgt agttccaaaa 1380

gcaaacgagc ttaaaatcca actcaaacac agatatgtat ttccaaaagc gaacaatctt 1440

aaaaacgtgg gcttcggagc ggtggggagc tggcttcgga gcggtgggga agtcggcagc 1500

ggcggcgaga gcgcgagcga tgggagcgga ggggtgcggc ggctgggcgg gctcgaagcc 1560

gccgaggtgg acgaacccga ggaggagagg cgggtggtag acggagcggt agcagcggag 1620

gaagtggcgg ccggcgatga gtcggcggaa ggagacgtag gcggaggagg cgcgggcgag 1680

gtccgcggga gagccgatac agaagaagat ctcctccaag agctcgtcag tgagggcggg 1740

aagctgacgc ggccatga 1758

<210> 3

<211> 2415

<212> DNA

<213> Oryza sativa

<400> 3

gaagaagcgg ggaaatagaa gggaggaaga acaaggagaa gtggagttga taagtgggct 60

ccaccatatt ttcattttta ctgctgtccc ttacatgtgg gacccacttc tatttttaat 120

ttctttgatg actaggctga cagcactttt ggaccaagac aattacaaca ttagcaaaaa 180

cgcttctcaa accgctaaaa gagttaattt gcaccggtct ttaaagttac gagaggcatt 240

atactcgatt ttgcggttga gacaagcaat tcaaactagg gacggcaatg ggtcaggtcg 300

ggcacgagta gagcaaaatc atgcccgact cggcacccga ccttgcccgc ccgaaccctg 360

cccaacagga ttaatgggca aaactccgtg cccataccca tgcccgacag gcacgggtat 420

gcccggtgga tatccattgg gtatgccttc cgccttccgc ctcccgtcgc cggttcgccg 480

ccctcgatcg tcgtcattgt cgcctgctgc cgccggctcg tcgccctcgg tcgctgtcac 540

cggctcgtca ttgtcgccct gagccgccgt cgccggctca ccgccctcgt catcgaggcc 600

ctaagctgtc accgccgcca tcgtggccct gaggagccgc cgccgccgtc gccctgcgag 660

gttacgacgc catctcgcgc cgccgctccc tgccgtcgcc tgcccgcgcc gccactgcgc 720

tgtctcttgc ttgggtcgcc gctgtcgttg ctaatccgtg ccgtcatcgc tagcctgcgc 780

cgccgccgcc gccataggga ttagaatagg agaggggagt ggggaatacc ggaataggag 840

aggggattgg aataggttag ggtttctatt agttgagtat atatatgtcc atagttagtg 900

ggccaaatgg gccaaataaa tggatataag gaataagaga taggccaaaa ttaggtcata 960

tatatgtatg agtcgggtat ggactatccg cggacaaaaa acaataccca attattgccc 1020

acgatgttct cgggtttcgg acgggcgtgc ccaccgacaa aatattacac ccatgtccat 1080

accaatcggg ctgggtatcc gtggatatct ggactcgcgg gcaaaattgc catctctaat 1140

tcaaacaagg gcaagatatg tgtgaaccaa atagactttt tttttacttg gtcagtgact 1200

cagtcccatg gagcaaaggt tagctttgag tcaagagtgt gttcggatgc cccttttctc 1260

aacccctctg cctcgttttc tgcgcgtaca tttttcaaac cgctaaacaa tgcgtttttg 1320

gtttttttgc gaaaaaattc tatacgaaag ttgtttaaaa aaatcaaatt aattcttttt 1380

ttaaaaaaat tagctaatac ttaattaatc acgcgctaat aaacctctct atttttcgtg 1440

cgttactgtt ccggttggga tatgagatag cgaacacaaa gcctttttac tccacaaacc 1500

aaaccaacca ccctccctgg gactgggatc cataagtcct aaaccgaatt tcctattgcg 1560

cgcgtctgcg ccagcgaacg aagtcgcgcg cggttccggc ccagcccact acacgattgc 1620

gcagtgtcgc agtgcaggaa ggtcagtagg tggggacacg cacacgttca catgcgcaga 1680

taagattgga ttagcgtaat caggttttga ctaatcacga tctgaattat ggtgaccatt 1740

ctttttttct tttcgcataa aggttgtttt ctttttatta ctacaaattt caaaaactta 1800

tacataatat ttaaattttc aaataaaatt taaaaccttc taaaaaaagt catatccaaa 1860

atttaaaact tttaacttga aagttgaaaa ttttcaactt aaaatttaaa tgctttcttc 1920

tcaaaatttg aaactctcca ctcaaaattg gaaaacttcc aacataaaat tcaaaatttt 1980

catctcaaaa tcaaaaactt tcatattgaa attcaaaact ttcaactcaa attttaaaaa 2040

cttttaactc aaaattcaaa gttttcatct caaaatttaa atactttcaa cttaaatttg 2100

aaaactttca agtcaatatt taaaaaattt taaattagat tttgaaaact ttcaaatcaa 2160

ttttgaaaac tttcaaatta gattttgaaa actttcgact cgaattttta ttgttgtatt 2220

gtgaaattac tgtagcgtgt gattaaatct aattaccgtg attaacgcta atctccgtga 2280

ttaacgatgg gatcgcgaca gggttcgttc tgcagctgaa cacgtggaag tgcgcgcgag 2340

taactgaacc ggcgcgtacg cgcgaattag taatccccgt cctaaacctc cttcccccgg 2400

ctggcggctg caccg 2415

Claims

1.OsFBX250The application of the gene in rice breeding is characterized in that: the rice breeding is to make rice grains become larger and increase the rice yield; the grain type comprises grain length, grain width, grain thickness and grain weight of rice grains;

by improvingOsFBX250The expression of the gene enlarges the rice grains;

the said processOsFBX250The amino acid sequence of the OsFBX250 protein coded by the gene is shown as SEQ ID NO. 1.

2. The use according to claim 1, characterized in that: the said processOsFBX250The cDNA sequence of the gene is shown as SEQ ID NO. 2.