CN114774559B - SNP molecular marker related to chicken growth traits and egg laying traits and application - Google Patents
SNP molecular marker related to chicken growth traits and egg laying traits and application Download PDFInfo
- Publication number
- CN114774559B CN114774559B CN202210387687.3A CN202210387687A CN114774559B CN 114774559 B CN114774559 B CN 114774559B CN 202210387687 A CN202210387687 A CN 202210387687A CN 114774559 B CN114774559 B CN 114774559B
- Authority
- CN
- China
- Prior art keywords
- traits
- chicken
- egg laying
- genotype
- days
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP molecular marker related to chicken growth traits and egg laying traits and application thereof, and belongs to the technical field of biology. The SNP molecular markers comprise SNP1 (NC-052532.1 g.25052822A >) and/or SNP2 (NC-052532.1 g.25052876G > -C. Tests prove that TT or TA genotype individuals at SNP1 mutation sites show the largest egg laying number at 300 days of age, and CC genotype individuals at SNP2 mutation sites show the largest weight at 84 days of age; the CC genotype individual has the largest weight at the age of 91 days; GC genotype individuals showed the most eggs at 300 days of age. Therefore, the SNP molecular marker disclosed by the invention can be applied to early screening of the growth traits and the egg laying traits of chickens, and can accurately identify the growth traits and the egg laying traits of the chickens so as to provide scientific data for breeding the chickens.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an SNP molecular marker related to chicken growth traits and egg laying traits and application thereof.
Background
As one of the most important agricultural livestock and poultry animals, the egg laying characteristics of the chicken are always important characteristics of poultry breeding, including egg laying number, egg laying rate, egg weight and the like. The egg laying number as the most important egg laying character is greatly improved in the breeding practice of laying hens, and for local Chinese varieties, the improvement of the egg laying number still has a huge space. Meanwhile, the meat production performance of the chicken directly influences the economic benefit of the market. The three-yellow chicken has strong wild performance, can adapt to the environment quickly, grows quickly, has high disease resistance, has good quality of chicken products and eggs, is widely praised in the market, and keeps the breeding quantity and the breeding scale at a high level all the year round. From the breeding perspective, the bred Sanhuang chicken with high meat yield and egg yield can greatly drive the economic benefit of the Sanhuang chicken industry, is beneficial to the effective utilization of resources, and has great significance for promoting the development of the Sanhuang chicken breeding industry.
Molecular marker-assisted Selection (MAS) is a common Molecular breeding technology and has the advantages of wide existence range, stable heredity, intuition, accuracy and the like. Single Nucleotide Polymorphism (SNP) refers to a polymorphism of a DNA sequence caused by variation of Single nucleotide insertion, deletion, transversion, and transition at the genome level. The SNP is the most common animal genetic variation and widely exists in animal genomes, and as a DNA molecular marker, the SNP has the characteristics of stable inheritance, easy detection and the like, has obvious effects on improving the seed selection accuracy and the breeding efficiency, and can be widely applied to large-group large-scale breeding and screening of chickens. SNPs have been widely used as genetic markers in the research fields of gene mapping, cloning, genetic breeding, genetic diversity, and the like. Candidate genes related to the growth traits and the egg laying traits of the chickens on the molecular level are further mined, and related molecular genetic markers are established through the research on polymorphism of the candidate genes, so that favorable technical support can be provided for the molecular marker-assisted selective breeding of the growth traits and the egg laying traits of the chickens, and the breeding work of the egg and meat dual-purpose chickens is effectively promoted.
Actin (Actin) is a highly conserved multifunctional protein forming microfilaments, and three main Actin subtypes, α, β and γ, have been identified, among which α -Actin is present in muscle cells and is a major component of the contraction apparatus of muscle tissue, and β and γ -Actin are present in most cells and serve as a component of cytoskeleton and a medium for movement inside cells. Actin exists in cells in two forms, one being a monomeric globular molecule called globular Actin (G-Actin) and the other being a polymer of globular Actin called fibrillar Actin (F-Actin), i.e. microfilaments. Only F-actin has physiological activity, G-actin is converted into F-actin by combining ATP, and the 2 forms can be mutually converted under certain physiological conditions, so that the F-actin keeps the dynamic balance of polymerization and depolymerization and participates in a series of physiological functions of cells. Actin participates in many important cellular processes, including establishment and maintenance of cell connection and cell shape, cell movement, cell division, vesicle and organelle movement, cell signal transduction, etc., however, actin plays a role in eukaryotic cells, is not limited to the above, and mediates formation of phagocytic cups and regulates phagocytic function of cells, and in addition, research in recent years shows that actin also has an important influence on biological functions of apoptosis, proliferation and migration of cells.
The protein alpha subunit 2 of the muscle Z line of actin-binding protein (Capping actin protein of muscle Z-line alpha. Subbunit 2, CAPZA2) is a member of the alpha subunit family of F-actin spike, and this gene encodes a subunit of the actin spike protein complex (CapZ) and regulates the growth of actin filaments. However, the specific role of the gene in birds has been rarely reported, and the gene has been much less studied in chickens in particular.
Disclosure of Invention
The invention aims to provide an SNP molecular marker related to chicken growth traits and egg laying traits and application thereof, which are used for solving the problems in the prior art.
In order to achieve the purpose, the invention provides the following scheme:
the invention provides SNP molecular markers related to chicken growth traits and egg laying traits, which comprise SNP1 and/or SNP2; wherein, the SNP1 is located at the NC-052532.1; the SNP2 is located at the position NC-052532.1.
Further, the genotype of the SNP1 mutation site comprises AA, TA and TT, and the genotype of the SNP2 mutation site comprises GG, GC and CC.
The invention also provides a primer pair for amplifying the SNP molecular markers related to the chicken growth traits and the egg laying traits, the primer sequence is as follows:
CAPZA2-F：GTTTGACACGGCCAGAGGTA；
CAPZA2-R：AAGGCTGACGTAGACAACGG。
the invention also provides a detection kit containing the primer pair.
The invention also provides an application of the SNP molecular marker or a primer pair for amplifying the SNP molecular marker and a detection kit containing the primer pair in chicken genetic breeding.
The invention also provides a method for early screening chicken production traits according to the SNP molecular markers related to the chicken growth traits and the egg laying traits, which comprises the process of early screening the body weight and the egg laying quantity by using the SNP molecular markers.
Further, the method comprises the following steps:
(1) Extracting blood DNA of the chicken to be detected;
(2) And (2) amplifying a partial sequence (NC-052532.1 25052646-25053691) of the CAPZA2 gene as shown in SEQ ID NO:1 is shown in the specification;
(3) Genotyping mutation sites g.25052822 and g.25052876 on the gene sequence obtained in the step (2);
(4) Early selecting the growth traits and egg laying traits of the chickens based on the genotyping in the step (3), wherein individuals with TT or TA genotypes at the g.25052822 locus show the most egg laying number at 300 days of age; g.25052876 locus CC genotype individual shows 84 days old maximal body weight; the CC genotype individual has the largest weight at 91 days old; GC genotype individuals showed the most eggs at 300 days of age.
Further, the amplification system comprises: 2 × Rapid Taq Master Mix 25 μ L, ddH 2 O19. Mu.L, CAPZA 2-F2. Mu.L, CAPZA 2-R2. Mu.L and DNA template 2. Mu.L; the amplification procedure comprises: pre-denaturation at 95 ℃ for 3min; denaturation at 95 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 15s,35 cycles; completely extending for 5min at 72 ℃; storing at 4 ℃.
The invention discloses the following technical effects:
(1) According to the invention, by analyzing a partial sequence (NC-052532.1.
(2) According to the invention, through experimental verification, NC-052532.1 site in CAPZA2 gene has point mutation at g.25052822 site, SNP1 mutation site g.25052822A > T, genotype comprises AA, TA and TT, wherein TT or TA genotype individuals show the most egg laying number at 300 days old; NC-052532.1, g.25052876 site with point mutation, SNP2 mutation site g.25052876G > C, genotype including CC, CG and GG, wherein CC genotype individuals show 84 days old with maximal body weight; the CC genotype individual has the largest weight at 91 days old; GC genotype individuals showed the most eggs at 300 days of age. The SNP mutation site can be used as a new SNP molecular marker, is applied to early screening of chicken growth traits and egg laying traits, and accurately identifies the chicken growth traits and the egg laying traits, so as to provide scientific data for chicken breeding.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 is a diagram showing the pairing positions and product lengths of CAPZA2 primers;
FIG. 2 is a diagram showing the genotyping of SNP sites in an amplified fragment region of the CAPZA2 gene.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the documents are cited. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.
The following examples used major reagents including: blood sample DNA extraction kit (brand: OMEGA; cat number: D3392; feiyang Biotechnology Co., ltd., guangzhou), 2 × Rapid Taq Master Mix (brand: novozan; cat number: P222-01; nevoking Biotechnology Co., ltd., jiangsu), DNA marker (brand: novozan; cat number: MD101; nevozan Biotechnology Co., ltd., jiangsu), high purity low purity agarose (brand: tokyo; cat Biotechnology Co., ltd., cat: TSJ001; beijing Strykyo Biotechnology Co., ltd.).
Example 1
1. Animal material
The same batch of 336 female Ningdu Sanhuang chickens (Guangdong Wen food Co., ltd.) were reared under the same rearing conditions. Each chicken has a unique identification (individual number).
2. Test method
2.1 blood Collection and production traits
When the seedlings are raised to 300 days old under the same conditions, 2mL of subcutaneous venous blood is collected by using a vacuum anticoagulation tube, temporarily stored on ice, transported back to a laboratory, and stored in a refrigerator at the temperature of 80 ℃ below zero for subsequent DNA extraction.
2.2DNA extraction
DNA extraction operation of all individuals is carried out according to the specification of a blood sample DNA extraction kit, sample concentration and OD value detection are carried out after DNA extraction, and samples with DNA nucleic acid concentration of more than 50 ng/mu L, ultraviolet absorption peak A260/A280 OD value of 1.8-2.0 and A260/A230 OD value of more than 2.0 are screened out.
2.3 primer design
Primer design was performed using NCBI's Primer-BLAST tool based on the sequence of the Red Chicken (Gallus) CAPZA2 gene (GeneID: 417771) provided by the NCBI's official website (National Center for Biotechnology Information Search database). The sequence information of the primers is shown in Table 1, and the pairing positions of the primers on the CAPZA2 gene are shown in FIG. 1, and the primers were synthesized by Gene technology, inc., yihui-Haiyuan, guangzhou.
TABLE 1 PCR amplification primer information for CAPZA2 Gene
2.4 PCR amplification of CAPZA2 Gene
PCR amplification of a partial sequence of CAPZA2 gene (NC-052532.1, 25052646-25053691) was carried out using 336 individual blood sample DNAs as templates and 2 × Rapid Taq Master Mix reagent in the PCR system shown in Table 2. The PCR program was performed according to the 2 × Rapid Taq MasterMix protocol, and the specific program was: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 15s (denaturation-annealing-extension, 35 cycles), complete extension at 72 ℃ for 5min. The product was stored at 4 ℃ until use. The PCR products were sent to Guangzhou Tianyihui Gene technology, inc. for Sanger sequencing. Wherein, the nucleotide sequence of the PCR product is shown as SEQ ID NO:1 is shown.
TABLE 2 PCR amplification System
PCR product sequence (SEQ ID NO: 1):
AAGGCTGACGTAGACAACGGTACTGCTATAGGAAATTTTGATAGAGGTGTAGTACAGTAAGGGATCAAGTGATATCACAAGTTTTGAACTTGGTTTGTGTCTTCCTCTGTGTGTAAACAGGAACTGGAAGTGCTGCAAAGGCATTAAAAAGTGCTTAGTTCAGGTAAAGGAGCTCTAAAACCAAGGAAGGAGAAGAGCAACTGTGAGAAAACATCATTTCAATGTGCAGGATGGTGTATCGTAGAATCATTTGAGTTGGAAGGGACCTTTAAAGGTCATCTAGTCCAACTCCCCTGCAGTGAACAGGGACACCTACAGCTAGATCAGGTTGCTCAGAGCCCTGTCCAGCCTGGCCTTGAGTGTCTCCAGGGATGGGGCACCCAGCACCTCTCTTGGCAGCCTCCTGCAGTGCTTCACCACCCTCATCATAAAAAACCTGTTCTTATATCCAGTCCAAATGTCACATTTTTTAGCTTGAAACCATTTCCAGTTGTTTTGTCACAACAGACCCTTCTAAAGAGTCTGTCCCTTTCTTTCTTACAGCCCCTTTTCAGACACTGAAAGAAAGGCCACACTCAGGTCTTCCCAGAGCCTTCTTTTCTCTAGTCTGAGCAGCCCCAGCTCTCTCAGCCTGTCCTCAAAGGGGAGCTGTTCCATCCCTTGGATCACCAGGGACTGTCCAGTACTAAAGACAGCTTCTTTGAGACACAGTGGTTTGTGGTGTTCTGTAGGTCACTGAAAGTTAAGAATGTTTCAGTTAGGTGGAAAAAGAAAATATTATGTTGATGTTTCAGTCTATAAGTAAAAATTAGATGCGAGAGGTGGAAATATTGAAGTCCAGAACTTCTAAGGGAGACAGCAATGGAAAATCATCACTTTCCTTCACTTCAGAGGTGATTTATCCTCTGAATAAGTCTTGAATACAAAACCTATTTATTTATCCAACGGATTTGAAGTAGTATTTTTTGAAGCTTAATAGCCATTTTATGCAGTGCAGTTATGTTTCAGTTCCTGTACGAATTGTTCTACCTCTGGCCGTGTCAAAC
the sequencing result is correct, which indicates that the CAPZA2 gene sequence has been successfully amplified.
2.5 determination and genotyping of SNPs sites
The sequence peak map alignment analysis was performed on the Sanger sequencing results of PCR products using the SeqMan tool of DNAstar software to determine potential SNP sites, 3 SNP sites were detected in total, of which 2 sites were significantly associated with growth traits and egg laying traits, NC _052532.1, g.25052822a >, t and NC _052532.1, g.25052876g >, c as shown in fig. 2, and the genotyping results were subjected to gene frequency calculation and Hardy wenberg (Hardy-Weinberg) equilibrium coefficient detection, the formula calculated as follows:
F i indicating the frequency of alleles of the SNP site, A ii And A ij The number of individuals homozygous (ii) and heterozygous (ij) at the SNP locus is shown, and n is the total number of the groups. The hardy weinberg balance test uses excel software for chi-square test. The genotype frequencies, gene frequencies and balance coefficient calculation results of the traits corresponding to the two loci are shown in tables 3-6.
TABLE 3 SNP1300 day-old egg production genotype frequencies, gene frequencies, and balance coefficients
TABLE 4 SNP284 day-old body weight genotype frequencies, gene frequencies, and balance coefficients
TABLE 5 SNP291 day-old body weight genotype frequency, gene frequency, and balance coefficient
TABLE 6 SNP2300 day-old egg number genotype frequency, gene frequency, and balance coefficient
The results show that the HW coefficient P is >0.05, indicating that the population number is large enough, no mutation, artificial selection, population migration, etc., consistent with genetic balance.
2.6 genotype and growth traits and egg laying traits correlation analysis
The SAS 9.4GLM program package is used for carrying out association analysis on growth traits and egg laying trait data of individuals corresponding to SNPs loci and genotypes, and the association analysis results of NC-052532.1.
Table 7 nc _052532.1 g.25052822a > -t site was associated with egg laying trait analysis
Note: different letters indicate significant differences between groups.
The results show that: NC-052532.1 g.25052822A >.
The results of the analysis of the association of NC-052532.1 g.25052876G > -C site with growth traits are shown in tables 8-9.
TABLE 8 NC _w052532.1 g.25052876G > -C site was analyzed in association with 84-day-old body weights
TABLE 9 NC _/052532.1 g.25052876G > C site was associated with 91-day-old body weight for analysis
Note: different letters indicate significant differences between groups.
The results show that: NC-052532.1, g.25052876G > -C locus has significant correlation with the presence of chicken 84-day-old and 91-day-old body weights (p < 0.05), wherein the 84-day-old body weight of CC homozygous genotype individuals is significantly greater than that of GC heterozygous genotype individuals (p < 0.05), and the GG homozygous genotype has no significant difference with the CC homozygous genotype and GC heterozygous genotype individuals (p > 0.05); the weight of the CC homozygous genotype individual at 91 days old is obviously larger than that of the GC heterozygous genotype and the GG homozygous genotype individual (p is less than 0.05), and the GC heterozygous genotype and the GG homozygous genotype individual have no obvious difference (p is more than 0.05).
The results of the analysis of the association of NC-052532.1.
Table 10 NC _052532.1 g.25052876G > -C site was associated with egg laying traits for analysis
Note: different letters indicate significant differences between groups.
The results show that: NC-052532.1 g.25052876G > -C locus has significant correlation (p < 0.05) with chicken 300-day-old egg production, wherein the egg production of a GC heterozygous genotype individual at 300 days-old is significantly more than that of a CC homozygous genotype individual (p < 0.05), and the GG homozygous genotype has no significant difference with the GC heterozygous genotype and the CC homozygous genotype individuals (p > 0.05). The association of other SNP sites with growth traits and egg production traits did not reach a significant level (p > 0.05).
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> southern China university of agriculture
<120> SNP molecular marker related to chicken growth traits and egg laying traits and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1046
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aaggctgacg tagacaacgg tactgctata ggaaattttg atagaggtgt agtacagtaa 60
gggatcaagt gatatcacaa gttttgaact tggtttgtgt cttcctctgt gtgtaaacag 120
gaactggaag tgctgcaaag gcattaaaaa gtgcttagtt caggtaaagg agctctaaaa 180
ccaaggaagg agaagagcaa ctgtgagaaa acatcatttc aatgtgcagg atggtgtatc 240
gtagaatcat ttgagttgga agggaccttt aaaggtcatc tagtccaact cccctgcagt 300
gaacagggac acctacagct agatcaggtt gctcagagcc ctgtccagcc tggccttgag 360
tgtctccagg gatggggcac ccagcacctc tcttggcagc ctcctgcagt gcttcaccac 420
cctcatcata aaaaacctgt tcttatatcc agtccaaatg tcacattttt tagcttgaaa 480
ccatttccag ttgttttgtc acaacagacc cttctaaaga gtctgtccct ttctttctta 540
cagccccttt tcagacactg aaagaaaggc cacactcagg tcttcccaga gccttctttt 600
ctctagtctg agcagcccca gctctctcag cctgtcctca aaggggagct gttccatccc 660
ttggatcacc agggactgtc cagtactaaa gacagcttct ttgagacaca gtggtttgtg 720
gtgttctgta ggtcactgaa agttaagaat gtttcagtta ggtggaaaaa gaaaatatta 780
tgttgatgtt tcagtctata agtaaaaatt agatgcgaga ggtggaaata ttgaagtcca 840
gaacttctaa gggagacagc aatggaaaat catcactttc cttcacttca gaggtgattt 900
atcctctgaa taagtcttga atacaaaacc tatttattta tccaacggat ttgaagtagt 960
attttttgaa gcttaatagc cattttatgc agtgcagtta tgtttcagtt cctgtacgaa 1020
ttgttctacc tctggccgtg tcaaac 1046
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtttgacacg gccagaggta 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aaggctgacg tagacaacgg 20
Claims (4)
1. The application of the SNP molecular marker in chicken genetic breeding is characterized in that the SNP molecular marker is SNP1 and SNP2; wherein the SNP1 is positioned at a g.25052822 locus of a CAPZA2 gene sequence with the number of NC-052532.1, and an A/T mutation exists at the locus; the SNP2 is positioned at the g.25052876 site of a CAPZA2 gene sequence with the number of NC-052532.1, and a G/C mutation exists at the site; the chicken is Ningdu Sanhuang chicken; the genetic breeding is to breed the weight and egg laying traits of the chicken.
2. A method for early screening of chicken growth traits and egg laying traits, which comprises the process of early screening of body weight and egg laying number using the SNP molecular marker of claim 1; the chicken is Ningdu Sanhuang chicken.
3. The method according to claim 2, characterized in that it comprises the following steps:
(1) Extracting blood DNA of the chicken to be detected;
(2) Performing PCR amplification by using the DNA obtained in the step (1) as a template and using a primer pair to obtain an amplification product; the sequence of the primer pair is shown as SEQ ID NO. 2-3;
(3) Genotyping the mutation sites g.25052822 and g.25052876 on the amplification product obtained in the step (2); the genotype of the mutation site g.25052822 comprises AA, TA and TT; the genotype of the mutation as a point g.25052876 comprises GG, GC and CC;
(4) Early selecting the growth traits and egg laying traits of the chickens based on the genotyping in the step (3), wherein individuals with TT or TA genotypes at the g.25052822 locus show the most egg laying number at 300 days of age; g.25052876 locus CC genotype individual showed 84 days of age maximal body weight; the CC genotype individual has the largest weight at the age of 91 days; GC genotype individuals showed the most eggs at 300 days of age.
4. The method of claim 3, wherein the amplification system comprises: 2 × Rapid Taq Master Mix 25 μ L, ddH 2 O19. Mu.L, CAPZA 2-F2. Mu.L, CAPZA 2-R2. Mu.L and DNA template 2. Mu.L; the amplification procedure comprises: pre-denaturation at 95 ℃ for 3min; denaturation at 95 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 15s,35 cycles; completely extending for 5min at 72 ℃; storing at 4 deg.C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210387687.3A CN114774559B (en) | 2022-04-13 | 2022-04-13 | SNP molecular marker related to chicken growth traits and egg laying traits and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210387687.3A CN114774559B (en) | 2022-04-13 | 2022-04-13 | SNP molecular marker related to chicken growth traits and egg laying traits and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114774559A CN114774559A (en) | 2022-07-22 |
| CN114774559B true CN114774559B (en) | 2023-01-24 |
Family
ID=82429415
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210387687.3A Active CN114774559B (en) | 2022-04-13 | 2022-04-13 | SNP molecular marker related to chicken growth traits and egg laying traits and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114774559B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101213296A (en) * | 2005-05-02 | 2008-07-02 | 东丽株式会社 | Composition and method for diagnosing esophageal cancer and metastasis of esophageal cancer |
| CN107475412A (en) * | 2017-09-20 | 2017-12-15 | 山东农业大学 | A kind of molecular labeling related to chicken egg-laying deseription and its application in chicken breeding |
| CN110592238A (en) * | 2019-10-16 | 2019-12-20 | 西北农林科技大学 | SNP (Single nucleotide polymorphism) marker related to growth traits of black-bone chickens and application thereof |
| CN114317780A (en) * | 2022-03-03 | 2022-04-12 | 华南农业大学 | SNP molecular marker related to chicken prematurity and application |
-
2022
- 2022-04-13 CN CN202210387687.3A patent/CN114774559B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101213296A (en) * | 2005-05-02 | 2008-07-02 | 东丽株式会社 | Composition and method for diagnosing esophageal cancer and metastasis of esophageal cancer |
| CN107475412A (en) * | 2017-09-20 | 2017-12-15 | 山东农业大学 | A kind of molecular labeling related to chicken egg-laying deseription and its application in chicken breeding |
| CN110592238A (en) * | 2019-10-16 | 2019-12-20 | 西北农林科技大学 | SNP (Single nucleotide polymorphism) marker related to growth traits of black-bone chickens and application thereof |
| CN114317780A (en) * | 2022-03-03 | 2022-04-12 | 华南农业大学 | SNP molecular marker related to chicken prematurity and application |
Non-Patent Citations (2)
| Title |
|---|
| rs15212783;ensemble;《ensemble数据库》;20201130;第1-2页 * |
| rs15212784;ensemble;《ensemble数据库》;20200831;第1-2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114774559A (en) | 2022-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113913538B (en) | SNP molecular marker related to chicken carcass traits and application | |
| CN111518920B (en) | Screening method and application of SNP molecular marker associated with eggshell thickness, eggshell strength and egg shape index of Nandan Yao chicken | |
| CN107164463A (en) | It is a kind of to be used for the SNP marker of measure and/or genetic improvement pig growth traits | |
| KR101751932B1 (en) | A new dna marker and a detecting method of using the same | |
| CN112195253A (en) | SNP (Single nucleotide polymorphism) locus for increasing content of fatty acid C14:0 in chicken and method for breeding high-quality chicken strain by using SNP locus | |
| CN106755371B (en) | Method for detecting sheep PCNP gene single nucleotide polymorphism by PCR-RFLP and application thereof | |
| CN112430674B (en) | Primer for detecting 7 SNP molecular markers of goose egg qualification rate | |
| CN112501314B (en) | Reagent for detecting genotype of SNP (single nucleotide polymorphism) locus correlated with egg laying traits of Riezou black ducks | |
| CN115341035A (en) | SNP molecular marker for selecting laying weight of hens | |
| CN114921568B (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| CN114774559B (en) | SNP molecular marker related to chicken growth traits and egg laying traits and application | |
| CN114350818B (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN113699247B (en) | SNP molecular marker related to pig residual feed intake on pig chromosome 1 and application thereof | |
| CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
| CN111910009B (en) | Molecular marker influencing chicken bursal disease index and application thereof | |
| CN110438237B (en) | SNP (single nucleotide polymorphism) site related to posttendinosus and fashion head weight on chromosome 6 of meat Simmental cattle and application | |
| CN110760593B (en) | SNP (single nucleotide polymorphism) site related to spleen weight on chromosome 6 of meat Simmental cattle and application | |
| CN108220470B (en) | Kit and method for detecting highland barley seed protein | |
| CN115851962B (en) | Molecular marker related to abdominal fat weight character of chicken and application thereof | |
| CN105603099B (en) | Meat duck OTXR gene mononucleotide polymorphisms and its detection method and application | |
| CN109161601B (en) | Method for auxiliary rapid detection of cattle growth traits by using SNP marker of PLAGL1 gene and application thereof | |
| CN114250307B (en) | Molecular marker for evaluating age of pigs reaching 100kg body weight and application thereof | |
| CN113897443B (en) | SNP molecular marker related to milk fat percentage of southern Holstein cows, kit and application and breeding method thereof | |
| CN113430283B (en) | Application of chicken BMP15 gene as chicken testicular character molecular marker | |
| CN116837112B (en) | SNP molecular marker related to yak growth traits and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |