CN114317780A

CN114317780A - SNP molecular marker related to chicken prematurity and application

Info

Publication number: CN114317780A
Application number: CN202210201394.1A
Authority: CN
Inventors: 聂庆华; 蔡丹凤; 王芷筠; 周震; 徐海平
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2022-03-03
Filing date: 2022-03-03
Publication date: 2022-04-12
Anticipated expiration: 2042-03-03
Also published as: CN114317780B

Abstract

The invention discloses an SNP molecular marker related to chicken prematurity and application thereof, relating to the technical field of biology; the SNP molecular marker is derived from chicken BPGM gene, the nucleotide sequence is shown as SEQ ID NO:1, the NC-052532.1: g.62246179 site in the nucleotide sequence shown as SEQ ID NO:1 has point mutation, and the SNP mutation site g.62246179: G > A. The invention discovers that the BPGM gene exon area has a plurality of SNP loci which are obviously related to the early maturity of chicken, provides a new SNP molecular marker for molecular marker assisted selection, and tests prove that the molecular marker NC-052532.1: g.62246179G > A loci are obviously related to the open-producing age, wherein the open-producing age of the GA heterozygous genotype individual is obviously earlier than the AA homozygous genotype and the GG homozygous genotype.

Description

SNP molecular marker related to chicken prematurity and application

Technical Field

The invention relates to the technical field of biology, in particular to an SNP molecular marker related to chicken prematurity and application thereof.

Background

Single Nucleotide Polymorphism (SNP) refers to a Polymorphism of a DNA sequence caused by variation of Single Nucleotide insertion, deletion, transversion, and transition at the genome level. The SNP is the most common animal genetic variation, widely exists in animal genomes, and has the characteristics of stable inheritance, easy detection and the like. In animal production practice, SNP can be used for Molecular marker-assisted selection (MAS), and the seed selection accuracy and the breeding effect are improved. Finding out effective molecular markers related to sexual maturity can provide favorable technical support for molecular marker-assisted selective breeding of chicken with sexual precocity characters.

Bisphosphoglycomutase (BPGM) is a red blood cell specific enzyme that catalyzes a series of intermolecular phospho-transfer reactions. Its main function is to synthesize 2, 3-diphosphoglyceride, which is considered an allosteric effector of hemoglobin.

Disclosure of Invention

The invention aims to provide an SNP molecular marker related to chicken prematurity and application thereof, and aims to solve the problems in the prior art.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides an SNP molecular marker related to chicken prematurity, which is derived from a chicken BPGM gene, the nucleotide sequence is shown as SEQ ID NO. 1, the NC-052532.1: g.62246179 site in the nucleotide sequence shown as SEQ ID NO. 1 has point mutation, and the SNP mutation site g.62246179: G > A.

Further, the genotypes of the SNP mutation sites include AA, GA, and GG.

The invention also provides a method for identifying the premature character of the chicken by utilizing the SNP molecular marker, which comprises the following steps:

(1) extracting the genome DNA of the chicken to be detected, and carrying out PCR amplification to obtain an amplification product with a nucleotide sequence shown as SEQ ID NO. 1;

(2) sequencing the amplification product, detecting the genotype of NC-052532.1: g.62246179 locus, and when the locus is the GA genotype, the chicken is early in birth date.

Further, in the step (1), the sequence of the primer pair amplified by the PCR is the sequence shown in SEQ ID NO. 2-3.

Further, in step (1), the amplification system is: 2 mu L of template DNA, 2 xRapid Taq Master Mix25 mu L, 2 mu L of upstream primer and 2 mu L, ddH of downstream primer₂O 19μL。

Further, in step (1), the amplification reaction procedure is: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 15s, and 35 cycles; completely extending for 3min at 72 ℃; storing at 4 ℃.

The invention also provides a kit for identifying the premature character of the chicken, which comprises the primer pair.

The invention also provides application of the SNP molecular marker or the kit related to the chicken early-maturing character in chicken genetic breeding.

Further, the chicken genetic breeding is a selective breeding early-maturing chicken variety.

The invention discloses the following technical effects:

according to the invention, BPGM gene is analyzed, a plurality of SNP loci which are obviously related to the early maturing performance of chickens are found in an exon region of the gene, a new SNP molecular marker is provided for molecular marker assisted selection, and the molecular marker NC-052532.1: g.62246179G & gt A locus is obviously related to the age at birth date (p <0.05), wherein the age at birth date of a GA heterozygous genotype individual is obviously earlier than that of an AA mutant homozygous genotype individual and a GG wild homozygous genotype individual (p <0.05), but the age at birth date of the AA mutant homozygous genotype individual and the GG wild homozygous genotype individual has no obvious difference (p > 0.05). The association of other SNP loci with the chicken precocity trait does not reach a significant level (p > 0.05). Therefore, the molecular marker provided by the application can accurately identify the early-maturing character of the chicken, and provide scientific data for breeding the chicken.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a schematic representation of the BPGM primer pairing position and product length;

FIG. 2 is a SNP site genotyping map of exon region of BPGM gene.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every intervening value, to the extent any stated value or intervening value in a stated range, and any other stated or intervening value in a stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Example 1

1 materials and methods

1.1 animal samples

319 female Ningdu Sanhuang chickens were selected, which were 300 days old. 2mL of subcutaneous venous blood was collected and stored at-80 ℃ and used as a DNA extraction sample. Meanwhile, family information, the date of birth and other premature traits of the selected population are recorded.

1.2 Primary reagents

Blood sample DNA extraction kit (brand: OMEGA; cat # D3392; Feiyang bioengineering, Guangzhou), 2 × Rapid Taq Master Mix (brand: Novozan; cat # P222-01; Nevozan Biotech, Inc., Jiangsu), DNAmarker (brand: Novozan; cat # MD 101; Nevozan Biotech, Inc., Jiangsu), high purity low electro-osmosis agarose (brand: cat # TSJ 001; Beijing Ovogaku Biotech, Inc.).

1.3 Experimental methods

1.3.1 primer design

According to the sequence of the red raw chicken (Gallus) BPGM gene (GeneID:418172) published by NCBI (national Center for Biotechnology Information Search database), primers were designed using NCBI's Primer-BLAST tool, and Primer synthesis services were provided by Guangzhou Tianyihui distance Gene technology, Inc. The information on the primer sequences is shown in Table 1, and the positions of the primers on the BPGM gene are shown in FIG. 1.

TABLE 1 PCR amplification primer sequences

1.3.2 blood sample DNA extraction

And (4) extracting the DNA of the blood sample by referring to an operation manual of the blood sample DNA extraction kit.

1.3.3 PCR amplification of exon sequences of the BPGM Gene

The above genomic DNA of a blood sample of 319 individuals was used as a template, and the following reaction system was followed: template DNA 2. mu.L, 2 × Rapidtaq Master Mix 25. mu.L, upstream primer 2. mu.L, downstream primer 2. mu. L, ddH₂O 19μL。

Reaction procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 15s, and 35 cycles; completely extending for 3min at 72 ℃; storing at 4 ℃. PCR products were subjected to Sanger sequencing by Gene technology, Inc., Tianyihui, Guangzhou.

1.3.4 SNPs determination and genotyping

Analysis of the sequence peak map was performed on the Sanger sequencing results of the PCR products using the SeqMan tool of DNAstar software to determine potential SNP sites, and sequencing data for each sample was aligned by this tool for genotyping.

1.3.5 genotype and precocity trait Association analysis

The SNPs sites and the premature character data of the individuals corresponding to the genotypes are subjected to correlation analysis by adopting an SAS 9.4GLM program package.

2. Results

2.1 PCR amplification and SNP screening of exon sequences of BPGM Gene

319 individuals are selected, PCR amplification is carried out by taking blood sample DNA of each individual as a template, the obtained PCR product (the nucleotide sequence is shown as SEQ ID NO: 1) is subjected to Sanger sequencing, the peak images after sequencing are compared and analyzed, 6 SNP sites are detected in total, wherein only 1 site is obviously related to the date of birth, and the sites are NC-052532.1: g.62246179G > A shown as figure 2.

SEQ ID NO:1：

TAATGGAAGCTTGCAGGGCAGTCTCACTCAGATCTAGGTTTGATGGTGGCCCAGGAGGGGAAATAAAGGGGTATGTTATTGCCATCTACCATCTACTAGACCTGATATTTTAGTGGGGGAAAAAAAGCACTGTACAGCACCATCCTACTGGACTACTAAGTCCAGGTTACAGGTACTAACACTGTTTTTCACTGACAGAATGACATGATTTTTCTATCAATTGCCATGCCAACTTTTTTTCTGTATAAATTCCTTCAGTCTTTCCAAACACTTTCTATTGTACATTCTTTCTCTTATTTAAAGGTTCCCCAAGGCCAGTTCATGGTCCAGAGGTGAATTTTATAAGAGATGCTTGGACTGTTAGACTACTGCAATCTTTTGTTACACTATCATTCAATTTTTAAGGAATTTAGAAGGTATCCCTCTTCCTGCACTGTCTTTGCAAAACATTGCACAACTGTGTTTTGTTGGTTTACAATAATGGGCTTTAACTCAAACTTCAACTGCAAACTAAGCACAGGTTTTCCTGCTCAGTGTTTAAATTACAACTTAGCTCCAGTGAACAACCTTAACAGCTCCAGGACATAAATAACATGTACTAGAGATTTGAGAAACTTGTTAGAATTCTTTCTCTTTTAACCTCAGTGAAACTGGAATTATGAAGCCCCTCTCTAAGCTTTTGAGTTGCAAAGAACAGACAAATCTAATCTACAGTGATAGTGCTGTGGTACTGTTTGTTGACCTCTCTGGTGGGCAGAAATGCTGCATAGGATGCATAAGGT。

2.2 correlation analysis of SNP sites of exon sequences of BPGM gene and premature traits

And (3) performing association analysis on the 6 SNP loci and the premature character.

As shown in Table 2, NC _052532.1: g.62246179G > A locus has a significant correlation with the open-producing age of days (p <0.05), wherein the open-producing age of days of GA heterozygous genotype individuals is significantly earlier than that of AA mutant homozygous genotype individuals and GG wild homozygous genotype individuals (p <0.05), but there is no significant difference in open-producing age of days between AA mutant homozygous genotype individuals and GG wild homozygous genotype individuals (p > 0.05). The association of other SNP loci with the premature trait did not reach a significant level (p > 0.05).

TABLE 2 NC-052532.1 g.62246179G > A site associated with State of prematurity

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> southern China university of agriculture

<120> SNP molecular marker related to chicken prematurity and application

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 782

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

taatggaagc ttgcagggca gtctcactca gatctaggtt tgatggtggc ccaggagggg 60

aaataaaggg gtatgttatt gccatctacc atctactaga cctgatattt tagtggggga 120

aaaaaagcac tgtacagcac catcctactg gactactaag tccaggttac aggtactaac 180

actgtttttc actgacagaa tgacatgatt tttctatcaa ttgccatgcc aacttttttt 240

ctgtataaat tccttcagtc tttccaaaca ctttctattg tacattcttt ctcttattta 300

aaggttcccc aaggccagtt catggtccag aggtgaattt tataagagat gcttggactg 360

ttagactact gcaatctttt gttacactat cattcaattt ttaaggaatt tagaaggtat 420

ccctcttcct gcactgtctt tgcaaaacat tgcacaactg tgttttgttg gtttacaata 480

atgggcttta actcaaactt caactgcaaa ctaagcacag gttttcctgc tcagtgttta 540

aattacaact tagctccagt gaacaacctt aacagctcca ggacataaat aacatgtact 600

agagatttga gaaacttgtt agaattcttt ctcttttaac ctcagtgaaa ctggaattat 660

gaagcccctc tctaagcttt tgagttgcaa agaacagaca aatctaatct acagtgatag 720

tgctgtggta ctgtttgttg acctctctgg tgggcagaaa tgctgcatag gatgcataag 780

gt 782

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

taatggaagc ttgcagggca 20

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

accttatgtg tcctatgcag c 21

Claims

1. An SNP molecular marker related to chicken prematurity is characterized in that the SNP molecular marker is derived from a chicken BPGM gene, the nucleotide sequence is shown as SEQ ID NO. 1, the NC-052532.1: g.62246179 site in the nucleotide sequence shown as SEQ ID NO. 1 has point mutation, and the SNP mutation site g.62246179: G > A.

2. The SNP molecular marker related to the chicken prematurity trait according to claim 1, wherein the genotype of the SNP mutation site comprises AA, GA and GG.

3. The method for identifying the premature character of the chicken by using the SNP molecular marker of claim 1 or 2, which is characterized by comprising the following steps:

4. The method for identifying the premature character of the chicken as claimed in claim 3, wherein in the step (1), the sequence of the primer pair amplified by the PCR is the sequence shown in SEQ ID NO. 2-3.

5. The method for identifying the precocity trait of chicken as claimed in claim 3, wherein in the step (1), the amplification system is as follows: 2 mu L of template DNA, 25 mu L of 2 xRapid Taq Master Mix, 2 mu L of upstream primer and 2 mu L, ddH of downstream primer₂O 19μL。

6. The method for identifying the precocious chicken trait according to claim 3, wherein in the step (1), the amplification reaction program comprises the following steps: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 15s, and 35 cycles; completely extending for 3min at 72 ℃; storing at 4 ℃.

7. A kit for identifying a chicken precocity trait, which comprises the primer pair described in claim 4.

8. Use of the SNP molecular marker related to chicken prematurity traits according to claim 1 or 2 or the kit according to claim 7 in chicken genetic breeding.

9. The use of claim 8, wherein the chicken is genetically bred to a selectively precocious chicken variety.