CN114774430B - Liriodendron amboinense adventitious root promoting factor LhWRKY1 gene and application thereof - Google Patents

Abstract

The invention discloses an unlined-root-promoting factor LhWRKY1 gene of an liriodendron, wherein the full-length nucleotide sequence of the LhWRKY1 gene is shown as SEQ ID NO.1, and the CDS sequence is shown as SEQ ID NO. 2; a WRKY gene is separated and cloned by an RACE method, and the function of the WRKY gene is verified by constructing an expression vector and simultaneously transforming the expression vector into arabidopsis, so that the growth advantage of the main root of the transgenic arabidopsis is weakened, the number of lateral roots is increased and the root length is increased. Therefore, the gene LhWRKY1 of the liriodendron has good application prospect in promoting the growth and development of root systems and improving the rooting rate and survival rate of cuttage. The invention provides a foundation for the application of the liriodendron LhWRKY1 gene in molecular breeding.

Description

Liriodendron amboinense adventitious root promoting factor LhWRKY1 gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an liriodendron manicure adventitious root promoting factor LhWRKY1 gene and application thereof.

Background

The Liriodendron L.species is a fast-growing fallen leaf arbor, the trunk is straight, the material is excellent, the flowers and leaves are beautiful, the pest and disease damage is reduced, the pollution resistance is strong, and the ornamental value is high. The species of this genus exhibits a typical east Asia-North American discontinuous distribution pattern, with only Liriodendron tulipifera in east Asia and Liriodendron tulipifera in North America. By means of artificial hybridization, chinese scientists successfully perform interspecific hybridization of the two species for the first time, and obtain the filial generation of liriodenron sino-Liriodendron (old called hybrid Liriodendron or hybrid Liriodendron). The liriodendron has obvious hybrid vigor, has stronger growth performance and stress resistance compared with parents, is determined as a tree species for garden greening and afforestation by a plurality of cities in China, and has extremely strong development and utilization prospects. In order to maintain good characters, the hybrid Chinese tulip tree can realize the large-scale production of hybrid nursery stocks by asexual propagation technologies such as cuttage, tissue culture, grafting, somatic embryogenesis and the like. However, because the tissue culture breeding technology of the liriodendron is complicated and the cost is high, cuttage is the simplest and most effective mode for quickly obtaining a large number of liriodendron seedlings at present, and clone progeny with stable inheritance can be quickly obtained.

The research of the adventitious root occurrence mechanism becomes an important frontier field of forest breeding research. However, the asexual propagation of the hybrid liriodendron has a rooting problem, which hinders the clonal breeding and popularization and application steps. By continuously screening the subject group, the clone improved variety of the south American liriope (GanS-SC-LC-001-2019) with high rooting rate is obtained. The clone with high rooting rate has been popularized and applied in more than 20 counties and cities in China, and remarkable economic, social and ecological benefits are obtained, but the mechanism of high rooting rate in cuttage is still unclear.

Transcription Factors (TF) are trans-acting factors that can regulate gene expression, and a single Transcription factor can often regulate the expression of multiple functional genes simultaneously, thereby realizing different functions. WRKY is a transcription factor found in plants at first, and has a highly conserved domain composed of 60 amino acids, the N-terminal of the domain contains 1 to 2 conserved amino acid sequences composed of WRK YGQK, and the C-terminal of the domain contains a zinc finger structure, so that the transcription factor is named as WRKY transcription factor. The WRKY transcription regulation factor can be combined with a specific DNA sequence of a target gene promoter region so as to regulate the expression of a target gene, and can be combined with various target gene promoter regions, so that the WRKY transcription regulation factor plays an important role in pathogen defense, abiotic stress and plant hormone signal transduction, and has important significance on multiple aspects of plant growth and development, metabolic regulation, physiological response and the like.

Therefore, the problem to be solved by those skilled in the art is how to clone and apply a gene of an adventitious root promoting factor of an liriodendron.

Disclosure of Invention

In view of the above, the invention provides an liriodendron adventitious root promoting factor LhWRKY1 gene and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

an adventitious root promoting factor LhWRKY1 gene of an liriodendron liriodenum, the full-length nucleotide sequence of the gene is shown as SEQ ID NO. 1; the CDS nucleotide sequence is shown as SEQ ID NO.2.

As the same inventive concept as the technical scheme, the invention also claims the application of the gene of the liriodendron amboinense adventitious root promoting factor LhWRKY1 in promoting the rooting of plants.

As the same inventive concept as the above technical scheme, the invention also claims a method for promoting the growth and development of plant roots and improving the rooting rate and survival rate of cuttage, which comprises the following steps: firstly, constructing a pBWA (V) BS-LhWRKY1 plant expression vector, then transforming the pBWA (V) BS-LhWRKY1 plant expression vector into agrobacterium, and infecting plant leaves with the agrobacterium.

As the same inventive concept as the technical scheme, the invention also claims a protein expressed by an adventitious root promoting factor LhWRKY1 gene of an American gown, and the amino acid sequence of the protein is shown as SEQ ID NO. 3.

As the same inventive concept as the technical scheme, the invention also claims a plant expression vector containing the gene LhWRKY1, wherein the plant expression vector is formed by connecting a pBWA (V) BS vector and the gene LhWRKY1.

As the same inventive concept as the above technical scheme, the invention also claims a construction method of a plant expression vector containing the gene of the liriodendron adventitious root promoting factor LhWRKY1, which comprises the following steps: firstly, synthesizing a cDNA sequence of the LhWRKY1 gene, and then amplifying a coding region sequence to obtain a target sequence; and finally, connecting the target sequence with a vector to obtain a plant expression vector.

As the preferable technical scheme of the technical scheme, the primers used for amplifying the coding region sequence are as follows:

LhWRKY1-F1: cagt CACCTGCAaaacacatggcgttgatggg as shown in SEQ ID NO. 4;

LhWRKY1-R1: the sequence is cagtCACCTGCAaaatatacagctggccttctggg shown as SEQ ID NO. 5.

According to the technical scheme, compared with the prior art, the method provided by the invention has the advantages that the transcriptome difference of different periods in the root development process of the clone of the liriodendron aristata with high rooting rate is analyzed, the expressed EST expression sequence of the liriodendron aristata with the difference is excavated, and the full-length cDNA nucleotide sequence is obtained by separation and cloning by utilizing RACE technology and is named as LhWRKY1. Through constructing an expression vector and simultaneously transforming the expression vector into arabidopsis thaliana to verify the function of the arabidopsis thaliana, the growth advantage of the main root of a transgenic arabidopsis thaliana plant is weakened, the number of lateral roots is increased, and the length of the lateral roots is increased. The gene LhWRKY1 of the liriodendron can inhibit the top advantages of the main root and promote the increase of the number of lateral roots in the early growth and development stage of the root system, and has good application prospects in promoting the growth and development of the root, improving the cuttage rooting rate of the plant which is difficult to root and improving the cuttage survival rate.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a drawing of a 1% agarose gel electrophoresis of total RNA of an American gown;

FIG. 2 is a 1% agarose gel electrophoresis of the full-length PCR product of LhWRKY1 gene cDNA of the present invention;

FIG. 3 is a drawing showing the construction of the pBWA (V) BS LhWRKY1 expression vector of the present invention;

FIG. 4 is a diagram showing an agarose gel electrophoresis of the Escherichia coli liquid PCR of the LhWRKY1 gene of the present invention;

FIG. 5 is a PCR positive verification diagram of LhWRKY1 gene-transferred Arabidopsis thaliana of the present invention;

FIG. 6 is a comparison of root systems of LhWRKY1 transgenic Arabidopsis thaliana and wild type seedlings transplanted for 4 days;

FIG. 7 is a comparison of the root system of LhWRKY1 transgenic Arabidopsis thaliana and wild type seedlings transplanted for 8 days.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.

The plant material used in the embodiment is the American liriodendron which is obtained from an experiment base of the American liriodendron in yellow Ma county of Nanchang city in Jiangxi province, the new adventitious roots generated during cutting propagation of the American liriodendron are taken in 2017 months, and the medicinal materials are frozen and stored at the temperature of 80 ℃ below zero for later use.

Example 1: mining and cloning of LhWRKY1 gene

1) Sequence mining and alignment

Selecting four different growth periods of cutting rooting of the liriodendron with high rooting rate, extracting RNA, constructing transcriptome sequencing data of an adventitious root cDNA library, finding a section of EST sequence (LH-SXY-1962) differentially expressed at different development time by a bioinformatics method, finding the highest similarity of the EST sequence and WRKY genes of other species in an NCBI database Blast, and speculating that the EST sequence may be the WRKY transcription factor gene of the liriodendron.

2) Total RNA extraction of leaves of liriodendron

Taking 1g of fresh young leaves of liriodendron, quickly grinding into powder in liquid nitrogen, extracting total RNA of liriodendron according to the instruction by using a TRizol kit, dissolving in sterilized ultrapure water, detecting by using 1% agarose gel electrophoresis (figure 1), and storing in an ultra-low temperature refrigerator at-80 ℃ for later use.

3) Full-length amplification of LhWRKY1 gene

Amplification of the full length of the LhWRKY1 gene comprises amplification of a gene core sequence, amplification of a 3 'end sequence and amplification of a 5' end sequence. Wherein, we carry out gene core primer and 3'RACE and 5' RACE primer design according to EST conserved sequence, and the primers are respectively:

gene core sequence amplification primers:

ATGGACGACCAGATCGCG as shown in SEQ ID NO. 6;

LhWRKY1-CR, ACGTGCTTCTCGCAGGGC, shown in SEQ ID NO. 7;

3' RACE amplification primer:

LhWRKY1-31: GAATCGGACGGACGGTCACGCTCG as shown in SEQ ID No. 8;

LhWRKY1-32: TTGATTTCACGAAGCCGAGCC as shown in SEQ ID NO. 9;

5' RACE amplification primer:

LhWRKY1-51: GATTCATCGTCCATCCGTGATAGGG as shown in SEQ ID No. 10;

LhWRKY1-52: CGGACTCGCCCCATTCTGATTCGGT as shown in SEQ ID NO. 11;

LhWRKY1-53: TGGGGCTGGTTCTGGTGGGACATCA as shown in SEQ ID NO. 12.

The specific operation steps are carried out according to the instruction of a kit corresponding to TaKaRa. And after the amplification is finished, performing agarose electrophoresis on the PCR product obtained by amplification, and performing product recovery by using a gel recovery kit. And carrying out vector connection on the recovered product, transforming escherichia coli competent cells, picking positive monoclonals and sending the positive monoclonals to Shanghai workers for Sanger double-end sequencing. Finally, obtaining a core sequence 701bp,3' RACE of the LhWRKY1 gene, sequencing to obtain a sequence 703bp, and sequencing to obtain a sequence 292bp. Finally, the 3 partial sequences are compared and spliced by utilizing a SeqMan program under a lasergene software package to finally obtain 1142bp of the cDNA full length of the LhWRKY1 gene, as shown in SEQ ID No.1, the open reading frame CDS nucleotide sequence is SEQ ID No.2, and the amino acid sequence of the encoded protein is shown in SEQ ID No. 3.

Example 2: construction of liriodendron ohWRKY 1 gene plant expression vector

1) Total RNA extraction of leaves of liriodendron

Same as example 1, step 2);

2) Synthesis of first Strand cDNA

Synthesis of the first Strand cDNA of the Abelia Adinandra by means of TaKaRa PrimeScript ^TM II 1st Strand cDNA Synthesis Kit. The reaction system is as follows: 2 μ L of total RNA (containing 2 μ g of RNA), 1 μ L of Oligo dT Primer, 1 μ L of dNTP mix, RNase free dH ₂ O6. Mu.L, and the total volume of the system is 10. Mu.L. The reaction conditions were 65 ℃ for 5 minutes and then quickly placed on ice. Then, according to the kit use instruction, the following reaction liquid is added: 5 Xbuffer 4. Mu.L, 200U/. Mu.L RTase 1. Mu.L, 40U/. Mu.L RNase Inhibitor 0.5. Mu.L and RNase free dH ₂ O4.5. Mu.L, and slowly mixing. The reaction conditions are as follows: cooling at 42 deg.C for 45 min and 95 deg.C for 5 min, cooling on ice, and storing in-80 deg.C ultra-low temperature refrigerator.

3) Amplification of Gene coding region (CDS) sequences

Designing a primer containing a coding region sequence for high-fidelity RT-PCR amplification, introducing enzyme cutting sites and protective bases at two ends of the primer, and designing the primer as follows:

an upstream primer LhWRKY1-F1: cagt CACCTGCAaaacacatggcgttgatggg as shown in SEQ ID NO. 4;

a downstream primer LhWRKY1-R1: cagt CACCTGCAaaatatacagctggccttctgggg as shown in SEQ ID NO. 5;

and (3) carrying out PCR amplification by taking the cDNA subjected to reverse transcription in the step 2) as a template. The 25. Mu.L amplification system contained PfuPCRMix 12.5. Mu.L, the above upstream and downstream primers 0.8. Mu.L (100. Mu.M), cDNA 2. Mu.L, ddH ₂ O8.9. Mu.L. The amplification conditions were: pre-denaturation at 94 ℃ for 3min, then denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 1min, 33 cycles, final denaturation at 72 ℃ for 8min, and retention at 4 ℃. The PCR product was electrophoresed on 1% agarose gel (FIG. 2), the target product was excised under an ultraviolet lamp,and recovering the target fragment by using a TaKaRa kit.

4) Ligation of the enzyme to the vector

Carrying out enzyme digestion on the target fragment recovery product obtained in the step 3), wherein an enzyme digestion reaction system is as follows: mu.L of the target product, 1. Mu.L of AarI enzyme, 2. Mu.L of 10 XBuffer, plus ddH ₂ O to the system reaches 20. Mu.L. The reaction conditions were 37 ℃ for 1h.

Selecting expression vector pBWA (V) BS vector, and carrying out enzyme digestion reaction on the vector. The reaction system contained 2. Mu.L of 10 Xbuffer, 1. Mu.L of BsaI/Eco31I enzyme, 4. Mu.L of pBWA (V) BS-ccdB vector, ddH ₂ O13. Mu.L, for a total of 20. Mu.L. The reaction conditions were 37 ℃ for 1h.

And combining the recovered fragment enzyme digestion product with the vector enzyme digestion product, and purifying by using a PCR purification kit for the next ligation reaction. And carrying out vector and target fragment linkage by using T4 DNA ligase. The reaction system and the operation steps are as follows: vector and target fragment digestion mixture 2.5. Mu.L, 10 Xbuffer 1. Mu.L, T4 ligase 1. Mu.L, ddH ₂ O5.5. Mu.L, ligation at 20 ℃ for 1h.

5) Transformation competence and positive identification of ligation products

10 mu L of the ligation product is taken to transform the competence of the escherichia coli, the operation steps are carried out according to the conventional transformation steps, after the completion, the bacterial liquid is smeared on an LB solid culture medium containing the kanamycin, the culture is carried out for 12 hours at 37 ℃, and the monoclonal is picked for carrying out the bacterial plaque PCR identification. Selecting 3 bacterial solutions corresponding to the positive bands, taking 100 mu L of the bacterial solutions, feeding the samples for sequencing, inoculating the rest bacterial solutions into 10mL of LB culture medium with kanamycin resistance, and shaking the bacteria in a test tube. Finally, taking a bacterial liquid with correct corresponding sequencing, taking one tube to extract plasmids, obtaining a pBWA (V) BS (LhWRKY expression vector (figure 3) containing a target fragment, and storing for later use.

Example 3: agrobacterium-mediated genetic transformation of Arabidopsis thaliana and functional analysis

1) Wild type arabidopsis seeds (columbia Col-0) were sown in nutrient soil previously watered with water (organic matter: vermiculite: 1), covering a preservative film for 3 days, removing the film after seeds germinate, culturing in an artificial climate chamber at 25 ℃ for 14h under illumination until the flowering period.

2) Adding 1 mu L of positive plasmid containing target fragment pBWA (V) BS LhWRKY1 expression vector detected by PCR into 50 mu L of EHA105 agrobacterium-infected cells stored at the temperature of 80 ℃, fully and uniformly mixing, then carrying out electric conversion, adding 1mL of LB liquid culture medium after electric conversion, carrying out shake culture at the temperature of 30 ℃ and the rpm of 180 for 30min, and placing the activated agrobacterium on an LB solid culture medium for culture. Picking single colony from the plate culture medium, inoculating into liquid culture medium containing Basta antibiotic, culturing in a shaking incubator at 28 deg.C for 16h, performing PCR identification of bacteria liquid with CDS sequence primers (LhWRKY 1-F and LhWRKY 1-R), and obtaining electrophoresis picture shown in FIG. 4; and (3) sending the positive bacteria liquid detected by the PCR to Shanghai workers for Sanger sequencing confirmation, and storing the confirmed positive clone at 4 ℃ for later use.

An upstream primer LhWRKY1-F: ATGGCCGTTGATCTGATGGGA as shown in SEQ ID NO. 13;

a downstream primer LhWRKY1-R: TTACAGCTGTGCCTTCCTGGGG as shown in SEQ ID NO. 14;

selecting the positive agrobacterium with completely correct sequencing, preparing resuspension, and culturing to OD ₆₀₀ =0.8. The inflorescence of the full-bloom arabidopsis is infected for 2-3s by using the suspension solution, covered by a preservative film, sealed and protected from light for 24h, and then the operation is repeated for 3 times in total, wherein the interval is 7 days. After infection is completed, the seeds are cultured to the mature stage under normal conditions, and arabidopsis T0 generation seeds are harvested.

3) Screening of transgenic plants

Randomly placing about 30T 0 generation seeds into a 1.5ml centrifuge tube, adding 75% alcohol for disinfection for 5 minutes, then rinsing and washing for 2 times by sterile water, dibbling the seeds on a 1/2MS culture medium containing hygromycin (40 mu g/ml) by using disinfected toothpicks, placing the seeds in a 4 ℃ refrigerator for vernalization for 3 days, then moving the seeds to an illumination incubator 22 ℃, culturing for 16h in illumination/8 h in darkness, screening out survival arabidopsis thaliana after about 2 weeks, and transplanting the survival arabidopsis thaliana into a mixed nutrient of a substrate and vermiculite for normal culture.

4) PCR identification of transgenic plants

Selecting young leaves of transgenic arabidopsis, extracting DNA by using a CTAB method as a template, and performing PCR detection by using LhWRKY1-F and LhWRKY1-R as primers. Wild type Arabidopsis DNA was used as a negative control (-). Detection of PCR products was performed in 1.5% strength agarose. Detecting 10 transgenic arabidopsis thaliana in total, wherein negative control shows no band, the transgenic plant amplifies a product segment with a target length, and the detected positive rate is 100%; the results are shown in FIG. 5;

example 4 phenotypic observation of transgenic Arabidopsis thaliana of LhWRKY1 Gene

And continuously culturing the transgenic arabidopsis thaliana with positive T1 generation PCR detection to a mature stage, and harvesting seeds to obtain a T2 generation. The T2 generation of wild type and LhWRKY1 gene over-expression transgenic positive plant seeds is sterilized and cleaned by 75% ethanol, dibbled to 1/2MS culture medium containing herbicide (BASTA 15 mug/ml) for growth, placed in a refrigerator at 4 ℃ for vernalization for 2 days, and cultured under the conditions of 26 ℃ and 16h light/8 h dark. After 5 days of growth, wild arabidopsis thaliana and transgenic arabidopsis thaliana seedlings which grow consistently are selected and transferred to a common 1/2MS culture medium, the culture dish is sealed by a sealing film, the culture dish is vertically placed on a culture frame and is continuously cultured under the conditions of 26 ℃ and 16h illumination/8 h darkness, and the difference of the root system phenotype of the transgenic plant compared with the wild type is observed, as shown in fig. 6 and fig. 7.

As shown in FIGS. 6 and 7, the transgenic Arabidopsis has a weak growth advantage of the main root, developed lateral roots, a long length and a large number. The character plays an important role in increasing the number of adventitious roots of the tulip tree after cuttage and increasing the cuttage survival rate.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other. The device disclosed by the embodiment corresponds to the method disclosed by the embodiment, so that the description is simple, and the relevant points can be referred to the method part for description.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> institute of biological resources of academy of sciences of Jiangxi province

<120> liriodendron adventitious root promoting factor LhWRKY1 gene and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1142

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcccccattc tgttctctct catctcagag ctggcgtctg actttaatgg ccgtctgatc 60

agatcttcct cccccttccg ttcttctcct tcgatggccg ttgatctgat gggacttgcg 120

aaaatggacg accagatcgc gatccaagag gcagcgtctg cgggtctgag gaacatggag 180

cgtctgatct ttctgatgtc ccaccagaac cagccccaaa accattttga ctgccgagaa 240

atcactgata ccacggtctc caagttcaag aaggtgatct cgatcctgaa tcggacgggt 300

cacgctcgat tccgacgcgg accgaatcag aatggggcga gtccggcccc agcaacagca 360

gcgcctccga cccaaaccct aacctttgat ttcacgaagc cgagccctaa ccctaaccct 420

atcacggaga tgacgatgaa tcgctacccg ccgccagcga acgagcactt cggcatctcg 480

ccgccgatgt catccaccaa ctcctctttc atgtcgtcca tcacgggaga cggcagcgtt 540

tccaacggca agcagggatc gtctctcctg ctcgccgccg ttccggccgt ctcagccgga 600

aaaccgccgc tctcttcttc ttacaggaag aagtgccaag gccacggcca ctccgatgac 660

ctttccggca aatccgccgc ttccggccgc tgccattgcc ccaaaagaag aaaatctcga 720

gtcaagaacg tgataagagt ccccgcgata agttccaaaa ttgcagatat acccccagac 780

gagcactcct ggaggaaata cggccagaaa cctatcaaag gatcgcctta tccaaggggc 840

tattacaagt gcagcagcgt acgtggctgc cctgcgagga agcacgtgga gagggacccg 900

gatgatccga cgatgctgat cgtcacctac gaaggcgagc accgccattc ccaaactacc 960

cctccggatg cggcagctat aggcttcgat ccccaggaag gccagctgta aaaatcaaga 1020

gaatcgaggg gcattactgt aaatttaaac aagcggagcg tgtgtgaacc gaaaccctct 1080

cacctacgtt ataaaatata tgatttaaat ggatttgatt ctttgtttgg aaaaaaaaaa 1140

aa 1142

<210> 2

<211> 918

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggccgttg atctgatggg acttgcgaaa atggacgacc agatcgcgat ccaagaggca 60

gcgtctgcgg gtctgaggaa catggagcgt ctgatctttc tgatgtccca ccagaaccag 120

ccccaaaacc attttgactg ccgagaaatc actgatacca cggtctccaa gttcaagaag 180

gtgatctcga tcctgaatcg gacgggtcac gctcgattcc gacgcggacc gaatcagaat 240

ggggcgagtc cggccccagc aacagcagcg cctccgaccc aaaccctaac ctttgatttc 300

acgaagccga gccctaaccc taaccctatc acggagatga cgatgaatcg ctacccgccg 360

ccagcgaacg agcacttcgg catctcgccg ccgatgtcat ccaccaactc ctctttcatg 420

tcgtccatca cgggagacgg cagcgtttcc aacggcaagc agggatcgtc tctcctgctc 480

gccgccgttc cggccgtctc agccggaaaa ccgccgctct cttcttctta caggaagaag 540

tgccaaggcc acggccactc cgatgacctt tccggcaaat ccgccgcttc cggccgctgc 600

cattgcccca aaagaagaaa atctcgagtc aagaacgtga taagagtccc cgcgataagt 660

tccaaaattg cagatatacc cccagacgag cactcctgga ggaaatacgg ccagaaacct 720

atcaaaggat cgccttatcc aaggggctat tacaagtgca gcagcgtacg tggctgccct 780

gcgaggaagc acgtggagag ggacccggat gatccgacga tgctgatcgt cacctacgaa 840

ggcgagcacc gccattccca aactacccct ccggatgcgg cagctatagg cttcgatccc 900

caggaaggcc agctgtaa 918

<210> 3

<211> 305

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Ala Val Asp Leu Met Gly Leu Ala Lys Met Asp Asp Gln Ile Ala

1 5 10 15

Ile Gln Glu Ala Ala Ser Ala Gly Leu Arg Asn Met Glu Arg Leu Ile

20 25 30

Phe Leu Met Ser His Gln Asn Gln Pro Gln Asn His Phe Asp Cys Arg

35 40 45

Glu Ile Thr Asp Thr Thr Val Ser Lys Phe Lys Lys Val Ile Ser Ile

50 55 60

Leu Asn Arg Thr Gly His Ala Arg Phe Arg Arg Gly Pro Asn Gln Asn

65 70 75 80

Gly Ala Ser Pro Ala Pro Ala Thr Ala Ala Pro Pro Thr Gln Thr Leu

85 90 95

Thr Phe Asp Phe Thr Lys Pro Ser Pro Asn Pro Asn Pro Ile Thr Glu

100 105 110

Met Thr Met Asn Arg Tyr Pro Pro Pro Ala Asn Glu His Phe Gly Ile

115 120 125

Ser Pro Pro Met Ser Ser Thr Asn Ser Ser Phe Met Ser Ser Ile Thr

130 135 140

Gly Asp Gly Ser Val Ser Asn Gly Lys Gln Gly Ser Ser Leu Leu Leu

145 150 155 160

Ala Ala Val Pro Ala Val Ser Ala Gly Lys Pro Pro Leu Ser Ser Ser

165 170 175

Tyr Arg Lys Lys Cys Gln Gly His Gly His Ser Asp Asp Leu Ser Gly

180 185 190

Lys Ser Ala Ala Ser Gly Arg Cys His Cys Pro Lys Arg Arg Lys Ser

195 200 205

Arg Val Lys Asn Val Ile Arg Val Pro Ala Ile Ser Ser Lys Ile Ala

210 215 220

Asp Ile Pro Pro Asp Glu His Ser Trp Arg Lys Tyr Gly Gln Lys Pro

225 230 235 240

Ile Lys Gly Ser Pro Tyr Pro Arg Gly Tyr Tyr Lys Cys Ser Ser Val

245 250 255

Arg Gly Cys Pro Ala Arg Lys His Val Glu Arg Asp Pro Asp Asp Pro

260 265 270

Thr Met Leu Ile Val Thr Tyr Glu Gly Glu His Arg His Ser Gln Thr

275 280 285

Thr Pro Pro Asp Ala Ala Ala Ile Gly Phe Asp Pro Gln Glu Gly Gln

290 295 300

Leu

305

<210> 4

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cagtcacctg caaaacaaca tggccgttga tctgatggg 39

<210> 5

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cagtcacctg caaaatacat tacagctggc cttcctggg 39

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atggacgacc agatcgcg 18

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acgtgcttct cgcagggc 18

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaatcggacg ggtcacgctc g 21

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttgatttcac gaagccgagc c 21

<210> 10

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gattcatcgt catctccgtg ataggg 26

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cggactcgcc ccattctgat tcggt 25

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tggggctggt tctggtggga catca 25

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atggccgttg atctgatggg a 21

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ttacagctgg ccttcctggg g 21

Claims (7)

1. An adventitious root promoting factor of liriodendronLhWRKY1A gene characterized in thatLhWRKY1The full-length nucleotide sequence of the gene is shown as SEQ ID NO. 1; the nucleotide sequence of ORF is shown in SEQ ID NO.2.

2. Chinese gownAdventitious root promoting factorLhWRKY1The application of the gene in promoting the rooting of arabidopsis thaliana is characterized in thatLhWRKY1The full-length nucleotide sequence of the gene is shown as SEQ ID NO. 1; the nucleotide sequence of ORF is shown in SEQ ID NO.2.

3. A method for promoting rooting of Arabidopsis thaliana is characterized by comprising the following steps: firstly, the adventitious root promoting factor of the liriodendron maniiLhWRKY1The gene is ligated with pBWA (V) BS vector to obtain pBWA (V) BS-LhWRKY1A plant expression vector, followed by the introduction of pBWA (V) BS-LhWRKY1Transforming the plant expression vector into agrobacterium, and infecting arabidopsis leaves with agrobacterium; the above-mentionedLhWRKY1The full-length nucleotide sequence of the gene is shown as SEQ ID NO. 1; the nucleotide sequence of ORF is shown in SEQ ID NO.2.

4. An adventitious root promoting factor prepared from liriodendronLhWRKY1The gene expressed protein is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 3.

5. A factor containing radix AdenophoraeLhWRKY1The plant expression vector of the gene is characterized in that the plant expression vector consists of a pBWA (V) BS vector andLhWRKY1the genes are connected; the above-mentionedLhWRKY1The full-length nucleotide sequence of the gene is shown as SEQ ID NO. 1; the nucleotide sequence of ORF is shown in SEQ ID NO.2.

6. A factor containing radix AdenophoraeLhWRKY1A method for constructing a plant expression vector of a gene, characterized by comprising the steps of: first synthesisLhWRKY1cDNA sequence of the gene, and then amplifying the sequence of the coding region to obtain a target sequence; finally, connecting the target sequence with a pBWA (V) BS vector to obtain a plant expression vector; the above-mentionedLhWRKY1The full-length nucleotide sequence of the gene is shown as SEQ ID NO. 1; the nucleotide sequence of ORF is shown in SEQ ID NO.2.

7. An illipe-containing adventitious root promoting agent according to claim 6Factor(s)LhWRKY1The construction method of the plant expression vector of the gene is characterized in that the primers used for amplifying the sequence of the coding region are as follows:

LhWRKY1-f1: cagt CACCTGCAaaacacatggcgttgatggg as shown in SEQ ID NO. 4;

LhWRKY1-r1: the sequence is cagtCACCTGCAaaatatacagctggccttctggg shown as SEQ ID NO. 5.

Images