CN109295073B - Separation clone and application of liriodendron ohFB 1 gene - Google Patents

Abstract

The invention discloses a separation clone and application of an liriodendron ohFB 1 gene, belonging to the technical field of plant genetic engineering. In particular to the separation and cloning, the vector construction and the application of an liriodendron F-box protein gene LhFB1, wherein the nucleotide sequence of the gene is shown as a sequence table SEQ ID: 1 is shown in the specification; the corresponding amino acid sequence is shown in a sequence table SEQ ID: 2, it contains 1719bp open reading frame, codes 572 amino acids, predicts the molecular weight of 64.54KD, the theoretical isoelectric point is 8.33. The LhFB1 gene is genetically transformed into wild type arabidopsis, and the phenotype of the obtained transgenic arabidopsis is observed, so that the number of lateral roots of the transgenic arabidopsis is increased, the leaf area of a plant is obviously reduced, the floral organ is developed earlier, and the flowering phase is advanced. Therefore, the LhFB1 gene can be widely applied to molecular breeding of liriodendrons.

Description

Separation clone and application of liriodendron ohFB 1 gene

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to an liriodendron ohFB 1 gene isolation clone and application.

Background

Plants of the genus Liriodendron (Liriodendron) belong to the family Magnoliaceae (Magnoliaceae) and are mainly distributed in southeast asia and southeast north america, and are important ornamental and timber tree species for gardens. The liriodendron is in the basal group of angiosperms, is a genus with the most obvious differentiation in magnoliaceae (Nie et al, 2008), and is a good material for researching the evolution of angiosperms flowers (Liang et al, 2010). The Asia American unlined long-gown, also called hybrid unlined long-gown or hybrid liriodendron, is a new tree species which is bred by artificially hybridizing liriodendron tulipifera and Chinese unlined long-gown wood introduced in Mingxing Xiaoxiaoling of China for the first time in 1963 by the professor of leaf banking who has been the cause of famous forest breeders and Nanjing forestry university. In the past, hybrid unlined long gowns or hybrid tulip trees (Liriodenron chinense (Hemsl.) Sarg. times.L. tulipifera L.). The tree species is an independent species due to its unique morphological and biological characteristics, and is renamed as Liriodendron sino-american p.c. yieh ex Shang et z.r. wang according to the naming rule of international plant naming convention on hybrid names. The liriodendron has the advantages of fast growth, strong resistance, good material quality and the like, and the liriodendron is beautiful in tree shape and bright in color, and is a multipurpose excellent tree species suitable for yard cultivation, road greening, mountain afforestation and the like.

F-box proteins are members of a family of proteins containing 40-50 conserved amino acid F-box domains, widely found in eukaryotes, distributed in both the cytoplasm and nucleus (Zhao Li Ming, 2016; Kipreos and Pagano, 2000). The F-box protein is an important regulatory protein with F-box motif (motif) and plays an important role in multiple regulatory processes of organisms, wherein the degradation process of the SCF (Skp1-Cullin 1-F-box protein) protein complex mediated by E3 ubiquitin ligase is most clearly studied (Yang et al, 2008). As a responsive transcription receptor for growth hormone, the F-box protein, there are several types of protein genes in the genome of eukaryotes, including TIRI, AFB, MAX2, SKP2, SLY1, etc., each of which is involved in a different biochemical process (Kepinski and Leyser, 2005; Lechner et al, 2006). The F-box protein family is the largest protein family currently found in plants. The F-box protein family is the largest protein family currently found in plants. In plants, up to 692 and 779F-box protein genes are reported in the Arabidopsis and rice genomes, respectively. Therefore, the F-box protein gene LhFB1 of the liriodendron has important significance for regulating and controlling the growth and development.

The degradation process of proteins involves various aspects of cellular regulation and is closely related to plant growth and development. The plant realizes dynamic balance of life activities by degrading rate-limiting enzyme and other regulating factors, influences growth and development and can adapt to new environmental factors. Regulation of protein degradation is mainly accomplished by ubiquitin-protease degradation systems. The F-box protein is an important component of ubiquitin ligase E3. The F-box protein is involved in regulating and controlling various physiological and biochemical pathways such as phytohormone signal transduction, growth of lateral and adventitious roots, light signal transduction, biotic and abiotic stresses and the like (Lechner et al, 2006). Analysis of gene function and regulatory mechanisms is a hot area for the study of genes of interest and potential in plants, and is particularly important in perennial forest trees that rely on vegetative propagation to obtain superior clones (Busov et al, 2005 a). The function of the F-box protein gene family has been extensively studied in model plants such as Arabidopsis, rice, etc. (Wang et al, 2016; Xia et al, 2016). The use of modern molecular biology techniques in perennial forest trees has been increased by long growth cycles and complex mating patterns (Busov et al, 2005 b). Therefore, the function of the F-box protein gene is very lack of research in woody plants, and particularly, no relevant report is found in the endangered plant of the trembling poplar.

Disclosure of Invention

The invention aims to provide a technical method for separating and cloning LhFB1 gene of liriodendron mairei and application thereof, aiming at the defect that F-box protein gene function is very lack in woody plants, particularly in the blank of the research of endangered plants, namely liriodendron tulipifera, and an F-box protein gene is separated and cloned by an RACE method and named as LhFB1 by the applicant. The invention also aims to provide the application of the liriodendron ohFB 1 gene in molecular breeding.

The technical scheme of the invention is as follows, the full-length cDNA nucleotide sequence of the liriodendron ohFB 1 gene is shown as SEQ ID NO. 1. The gene clones the cDNA full-length sequence of the LhFB1 gene by using RACE technology on the basis of early-stage unlined long gown cuttage adventitious root transcriptome sequencing.

The coding sequence of the liriodendron ohFB 1 gene is shown as SEQ ID.2.

The amino acid sequence of the expression protein of the liriodendron ohFB 1 gene is shown in SEQ ID.3.

The application of the liriodendron ohFB 1 gene in liriodendron ohliriodendron breeding.

A plant expression vector containing the liriodendron ohfb 1 gene.

The beneficial results of the invention are: the invention utilizes RACE technology to separate and clone to obtain the full length of the gene LhFB1 of the liriodendron, combines bioinformatics analysis, analyzes the base sequence, the coded amino acid sequence, the homologous gene sequence comparison and the phylogenetic tree, verifies the function through genetically transforming arabidopsis thaliana, finds that the number of lateral roots of the plant root system of the gene LhFB1 is increased, the leaf is reduced, the flowering phase is advanced, and shows that the gene can be applied to the genetic breeding of plants and has good application prospect.

The features and experimental procedures of the present invention are explained in detail by examples with reference to the accompanying drawings.

Drawings

FIG. 1 is a 1% agarose gel electrophoresis of total RNA of the gown (R) of the present invention;

FIG. 2 is the 3' end RACE agarose gel electrophoresis picture of the LhFB1 gene of the invention;

FIG. 3 is the 5' end RACE agarose gel electrophoresis picture of the LhFB1 gene of the invention;

FIG. 4 is an analysis diagram of the functional domain of the LhFB1 protein of the present invention;

FIG. 5 is a diagram showing the prediction of the secondary structure of LhFB1 protein according to the present invention;

FIG. 6 is a diagram showing the prediction of the tertiary structure of LhFB1 protein according to the present invention;

FIG. 7 shows the amino acid sequence alignment analysis of the liriodendron ohFB 1 protein of the present invention and F-box protein of other species;

FIG. 8 is a phylogenetic analysis of the liriodendron ohFB 1 protein of the present invention and F-box homologous gene proteins of different species;

FIG. 9 is a 1% agarose gel electrophoresis of the full-length PCR product of LhFB1 gene cDNA of the present invention, wherein M: DL 2000 Marker; 1: PCR products;

FIG. 10 is a diagram of a double-enzyme cleavage of a target gene cloning vector of the present invention, M: DL 5000 Marker; 1: double enzyme digestion;

FIG. 11 is an enzymatic map of a plant expression vector of the present invention, M: DL15000 Marker; 1: double enzyme digestion;

FIG. 12 is an agarose gel electrophoresis of the PCR of the E.coli bacterial liquid of the LhFB1 gene of the present invention, wherein M: DL 2000 Marker; 1: PCR products;

FIG. 13 shows the double restriction enzyme digestion verification chart of the construction of pCAMBIA2301: LhFB1 overexpression vector of the present invention, M: DL15000 Marker; 1: plasmid vector double digestion, 2: carrying out double digestion on empty plasmids;

FIG. 14 shows a diagram of the construction of pCAMBIA2301: LhFB1 expression vector of the present invention;

FIG. 15 shows the positive validation of the LhFB1 transgenic Arabidopsis PCR of the present invention, +: recombinant vector plasmid, —: wild-type arabidopsis DNA;

FIG. 16 is a comparison of the flowering phenotype of transgenic Arabidopsis plants and wild type Arabidopsis plants of the present invention, a: transgene, b: a wild type;

FIG. 17 is a comparison of the root systems of transgenic Arabidopsis thaliana and wild-type plants of the present invention at the flowering stage, a: transgene, b: a wild type;

FIG. 18 is a comparison of leaves of transgenic Arabidopsis thaliana of the present invention and wild type at flowering stage, a: transgene, b: a wild type;

FIG. 19 is a comparison of the flowering organs of transgenic Arabidopsis thaliana and wild type in flowering phase, a: transgene, b: and (4) a wild type.

Detailed Description

Referring to fig. 1-19, the technical method for separating, cloning and applying the liriodendron LhFB1 gene comprises the following steps:

example 1: isolated clone of LhFB1 Gene

1) Sequence search and primer design

Based on transcriptome sequencing data of an adventitious root cDNA library constructed by RNA of four different growth periods of cutting and rooting of the liriodendron aristatus with high rooting rate in the early stage, an EST sequence which is assembled by bioinformatics is screened in an NCBI database blast to obtain an EST sequence with the highest similarity with F-box protein genes of other species, wherein the EST sequence is named as LH-SXY-0855, Genebank and numbered as JZ 877647. Designing a 3'RACE specific amplification primer and a 5' RACE specific amplification primer aiming at the EST conserved sequence:

3'RACE GSP1:GTTTCCGAGGGTTAGGGCTT

3'RACE GSP2:CGTTGTTTGTTGGCTGTTTATCCCATCTGCT

5'RACE GSP1:GCCATCATCCAGGCTCTCATCCATC

5'RACE GSP2:GGAGCGTGACGTCGCATGATGACATCCA

2) total RNA extraction of leaves of liriodendron

Taking 1g of fresh young leaves of liriodendron, quickly grinding into powder in liquid nitrogen, extracting total RNA of liriodendron according to the instruction by using a TRIzol kit, detecting by using 1% agarose gel electrophoresis (figure 1), dissolving in sterilized ultrapure water, and storing in a refrigerator at-80 ℃ and ultralow temperature for later use.

3) Amplification of the 3' end sequence of the LhFB1 gene: the specific steps refer to TaKaRa 3' -RACE kit instructions (Dalianbao biological company), and the specific process is as follows: the first round of PCR reactions was performed using the upstream Outer specific primers 3'RACE GSP1 and 3' RACE Outer Primer. The products were subjected to agarose gel electrophoresis using a second round of PCR reactions using the upstream Inner specific primers 3'RACE GSP2 and 3' RACE Inner Primer (FIG. 2).

4) Amplification of the sequence of the 5' end of the LhFB1 gene: the specific steps are carried out according to TaKaRa 5' -RACE kit instructions (Dalianbao biological company), and the specific process is as follows: removing the naked 5' phosphate group from the Total RNA using an Alkaline Phosphotase (Calf intestine); then, the 5' cap structure of mRNA was removed by Tobacco Acid Pyrophosphatase, and a phosphate group was retained. The 5' RACE Adaptor was then ligated to the uncapped mRNA using T4RNA Ligase. cDNA was synthesized by Reverse transcription using Reverse Transcriptase M-MLV (RNase H-), Random 9 mers. The Outer PCR reaction was performed using the downstream Outer specific primers 5'RACE GSP1 and 5' RACE Outer Primer, and the Inner PCR reaction was performed using the downstream Inner specific primers 5'RACE GSP2 and 5' RACE Inner Primer, and the products were subjected to agarose gel electrophoresis (FIG. 3).

5) DNA fragments obtained by agarose gel recovery of PCR products amplified by 3'RACE and 5' RACE were cloned and sequenced. The Gel recovery of the PCR product was performed using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 Gel recovery Kit. 1155bp sequence is obtained by 3'RACE sequencing, 1750bp sequence is obtained by 5' RACE sequencing. And splicing and comparing the sequencing result to obtain the full length of LhFB1 gene cDNA.

Example 2: bioinformatics analysis of LhFB1 Gene

1) Analysis of LhFB1 Gene cDNA sequence characteristics: the clone sequence length of the LhFB1 gene is 2177bp, ORF finder program on NCBI is used for searching, the length of ORF coding region is 1719bp, predicted coding is 572 amino acids, the length of 5 'non-coding region (UTR) is 204bp, and the length of 3' non-coding region (UTR) is 179 bp. The molecular weight of the protein is predicted to be 64.54KD by using Protparam (http:// web. expasy. org/Protparam /), the theoretical isoelectric point is 8.33, the protein is acidic protein, the total number of negative charge residues (Asp + Glu) is 65, the total number of positive charge residues (Arg + Lys) is 71, and the extinction coefficient is 280M^-1cm^-1The amino acid at the N terminal is Met, the estimated half-life period is 30h in vitro, the protein instability coefficient is 42.65, and the protein is classified as unstable protein and is easy to degrade. The SMART (http:// SMART. embl-heidelberg. de /) program was used to predict functional domains of proteins (FIG. 4), and the sequence was found to comprise 1F-box domain and 5 LRR domains, wherein 1F-box domain is located at amino acids 4-45 and 2 LRR domains are located at amino acids 99-149. The other 3 LRR domains are located at amino acids 283-449. The on-line software SOPMA (https:// npsa-prabi. ibcp. fr/cgi-bin/secpred _ SOPMA. pl) program was used to predict the secondary structure of a protein containing 54.20% Alpha-helix [ Alpha helix (Hh) (FIG. 5)]12.24% of an Extended strand [ Extended strand (Ee)]3.67% Beta-turn [ Beta turn (Tt)]And a Random coil (Cc) of 29.90%]。

The SWISS-MODEL (https:// swissmodule.expasy.org /) program is used for predicting the tertiary structure of the protein (figure 6), and the protein contains, and the sequence similarity of the gene protein of the liriodendron ohFB 1 and an arabidopsis thaliana auxin response factor (SMTL number: 3c6o.1.B) is 64.13 percent through template alignment analysis.

2) Sequence alignment and phylogenetic tree analysis of liriodendron ohFB 1 protein

The NCBI Protein BLAST program is utilized to carry out sequence comparison on the Protein LhFB1 of the American unlined long gown and F-BOX amino acid sequences of 20 species such as Chinese lotus, Chinese plum, cocoa, cotton, grape and the like (figure 7), and the results show that the amino acid sequences of the F-BOX family of the auxin response factor in auxin signal pathways of the American unlined long gown and a plurality of plants have higher similarity, the similarity with the Chinese lotus is up to 82 percent at most, and the similarity with the Chinese plum is 76 percent next. On the basis, a phylogenetic tree (figure 8) is constructed by utilizing a Neighbor Joining method (NJ) of MEGA 6.0 software, and the phylogenetic analysis is carried out on F-box amino acid sequences of different species to discover that 20 species are mainly divided into three categories, namely, liriodendron, Chinese lotus, grape, cocoa, Chinese plum, trifoliate orange, arabidopsis thaliana, rape, lupin, castor and hairy fruit poplar, the second category is the indica rice, corn and sorghum, the third category is the loblolly pine, Japanese larch, cotton, longan, rape and tomato, and the third category is the farthest from tomato. (LhFB1 (liriodendri, Liriodendron sino-americanum), XP _010249158 (Chinese lotus, Nelumbo nucifera), AIT18061 (Chinese plum, Prunus salicina), XP _007031984 (cacao, Theobroma cacao), ABG46343 (cotton, Gossypium hirsutum), XP _019080656 (grape, Vittis vinifera), XP _002300140 (Populus trichocarpa ), CDY34211 (rape, Brassica napus), NP _563915 (Arabidopsis thaliana ), EAY 933 (rice, Oryza sativa), XP _008669494 (corn, Zea mays), ACV87 (Dixon, Pistaphysa nucifera), AHW 93200 (AHP 93200, Hippon rosea), Hitachi-Indica (Sorghum vularia pinnata), Solanum tricornus pinnata 8131, Solanum nigrum roseum), Solanum tricornutum nigrum sibiricum, Acv # 3 (Acv _ 3611, Solanum tricornutum annuum pinnatum), Solanum tricornutum annuum sibirium sibiricum, Xanthorum sibiricum 002512866, Solanum sibiricum, Acronatum sibiricum purpurum sibiricum 002512866, Solanum sibiricum purpurum sibiricum, Solanum sibiricum lucidum, Acronatum sibiricum purpurum sibiricum 413 (Acronatum), and Solanum sibiricum), and Acronatum sibiricum 413 (Acronatum sibiricum), and Acronatum sibiricum 73268), Solanum sibiricum 413 (Solanum sibiricum) and Solanum sibiricum 413 (Solanum sibiricum).

Example 3: construction of pCAMBIA2301: LhFB1 genetic transformation vector

1) Total RNA extraction of leaves of liriodendron

Taking 1g of fresh young leaves of liriodendron, quickly grinding into powder in liquid nitrogen, extracting total RNA of liriodendron according to the instruction by using a TRIzol kit, dissolving in sterilized ultrapure water, and storing in an ultra-low temperature refrigerator at-80 ℃ for later use.

2) Synthesis of first Strand cDNA

Using TaKaRa PrimeScript^TMII 1st Strand cDNA Synthesis Kit first Strand cDNA was synthesized. The method comprises the following steps: 2ug of total RNA, 1ul of Oligo dT Primer and 1ul of dNTP mix were sequentially added to a 200ul microcentrifuge tube, supplemented to 10ul with RNase free dH2O, incubated at 65 ℃ for 5min and rapidly cooled on ice. Then the following reverse transcription reaction liquid is added in sequence: 5 XPrimeScript II Buffer 4ul, RNase Inhibitor 0.5ul 40U/. mu.l and PrimeScript II RTase 1ul 200U/. mu.l, adding RNase free dH2O to make up to 20ul, slowly mixing, reacting at 42 ℃ for 45min, inactivating at 95 ℃ for 5min, cooling on ice, and storing in an ultra-low temperature refrigerator at-80 ℃ for later use.

3) Amplification of Gene coding region (CDS) sequences

Primers containing the coding region sequence were designed for high fidelity RT-PCR amplification based on Oligo 7.0, with the upstream primer carrying a Kpn I cleavage site and the downstream primer carrying an Xba I cleavage site, plus a protective base GC:

the upstream primer LhFB 1-F: GCGGTACCATGATGTACTGCCAGATGA

The downstream primer LhFB 1-R: GCTCTAGAATCTGTCCCAACATCCCTAA

And performing PCR amplification by using the reverse transcribed cDNA as a template. 25ul amplification system: PrimeSTAR HS (Premix)12.5ul, upstream and downstream primers 1ul each, cDNA 2ul, ddH₂O8.5 ul. And (3) amplification procedure: 3min at 94 ℃,20 s at 94 ℃, 30s at 58 ℃, 2min at 72 ℃, 10min at 72 ℃, heat preservation at 4 ℃ and 35 cycles. The PCR product was electrophoresed on a 1% Agarose Gel (FIG. 9), and the desired fragment was recovered using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 Kit and stored in sterilized ddH₂And (4) in O.

4) Smooth-ended Gene fragment of interest plus "A" response

The 3' end of the target gene was reacted with "A" using TaKaRa "DNA A-labeling Kit" Kit. Reaction system: the following reaction solutions were added sequentially to 200ul centrifuge tubes: 10 Xa-labeling Buffer 5ul, dNTP mix 4ul, A-labeling Enzyme 0.5ul, target gene recovery productSubstance 4ug, sterile ddH₂O to 50ul, and reacting at 72 ℃ for 20 min. The reaction product was electrophoresed on a 1% Agarose Gel, and the desired fragment was recovered using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 Kit and stored in sterilized ddH₂And (4) in O.

5) Construction of LhFB1 gene genetic vector and agrobacterium transformation

And connecting the product recovered by gel after adding A with pMD-19Simple, screening by an ampicillin LB culture medium, performing monoclonal sequencing, selecting clone shake bacteria with completely correct sequence, performing amplification culture, and extracting plasmids. Carrying out double enzyme digestion and agarose gel electrophoresis on the extracted target fragment plasmid and the modified plant binary expression vector pCAMBIA2301 (figure 10, figure 11), recovering the target fragment, connecting the target fragment by using T4DNA ligase, transforming Escherichia coli E.coli DH5 alpha, screening recombinants by using a colony PCR method and a double enzyme digestion verification target fragment (figure 12, figure 13), obtaining the pCAMBIA2301: LhFB1 expression vector (figure 14) containing the target fragment, and storing for use.

The EHA105 agrobacterium infection state preserved at-80 ℃ is taken and inserted into ice for 5min, 2 mul plasmid DNA purified by gel is added, evenly mixed and immediately inserted into the ice, and the mixture is quickly transferred into an electric shock cup and covered with a cup cover. Starting the electrotransfer instrument, setting parameters: quickly placing an electric shock cup into an electric rotating tank, quickly placing the electric shock cup on ice after electric shock is finished, adding 700 mu l of LB culture medium without antibiotics, carrying out shaking culture at 28 ℃, culturing for 2-3 h at 120rpm, centrifuging at 5000rpm for one minute, pouring out a part of culture medium, reserving about 100 mu l of culture medium, blowing gently by using a pipette gun, fully and uniformly mixing, coating the mixture on a solid YEB culture medium added with 50 mu g/ml kanamycin and 20 mu g/ml rifampicin, and carrying out inversion culture at 28 ℃ for 2-3 days.

PCR identification of Agrobacterium recombinants: picking out single colony from plate culture medium, inoculating to liquid culture medium containing corresponding antibiotic, culturing at 28 deg.C and 200rpm for 16h, performing PCR identification of bacterial liquid with primers (LhFB1-F and LhFB1-R) for amplifying CDS sequence of gene, and storing positive clone at 4 deg.C for use.

Example 4: agrobacterium-mediated genetic transformation of Arabidopsis thaliana and functional analysis

1) Will be Ge LunSterilizing a Biya (Columbia) wild type arabidopsis seed (Col-0) with 75% alcohol for 1min, then sterilizing with 5% NaClO solution for about 10min, washing with sterile water, sowing in an MS solid culture medium, transferring to a light incubator for 2 weeks after spring bloom at 4 ℃ for 3d, and then transplanting to vermiculite: in the mixed nutrient of matrix (volume ratio is 3: 1), removing the film after 10d of film covering, pouring nutrient solution once every five days and water once every three days, controlling the culture temperature at 25 ℃, the illumination time at 14h and the illumination intensity at 200 mu molm^-2s^-1And culturing to the flowering phase.

2) Positive clones detected by PCR were added to YEB medium containing kanamycin (50. mu.g/ml) and rifampicin (20. mu.g/ml) and cultured to OD 0.6, centrifuged at 6000rpm for 8min, and the cells were fully suspended in 1/2MS medium. Infecting the inflorescence of the arabidopsis thaliana by the suspension solution for about 15sec, infecting the inflorescence once every 5-7d for 3-4 times, laying the impregnated arabidopsis thaliana in a tray, covering the tray with a preservative film, sealing the tinfoil paper from the sun for 24h, uncovering the tinfoil paper, culturing the arabidopsis thaliana to the mature period under normal conditions, and harvesting arabidopsis thaliana T0 generation seeds.

3) Screening of transgenic plants

Placing collected T0 generation seeds into a 1.5ml centrifuge tube, adding 75% alcohol for disinfection for 30s, washing with sterile water for 2-3 times, sterilizing with 0.1% mercuric chloride for 3min, washing with sterile water for 2-3 times, dibbling on 1/2MS culture medium containing kanamycin (50 microgram/ml), placing in a 4 ℃ refrigerator for 3d, moving to an illumination incubator 22 ℃, culturing in 16h illumination/8 h dark, screening out alive Arabidopsis after about 2 weeks, and transplanting into a mixed nutrient of a matrix and vermiculite for normal culture.

4) PCR identification of transgenic plants

Collecting young leaves of transgenic arabidopsis thaliana, extracting DNA (deoxyribonucleic acid) as a template by using a CTAB (cetyl trimethyl ammonium bromide) method, and performing PCR (polymerase chain reaction) detection by using LhFB1-F and LhFB1-R as primers. Wild type Arabidopsis DNA was used as a negative control (-), recombinant vector plasmid DNA was used as a positive control (+), and sterilized ultrapure Water was used as a blank control (Water). The detection result is shown in fig. 15, 12 transgenic arabidopsis thaliana plants are detected in total, no band is shown in the negative control, and the transgenic plant is determined to be a transgenic plant by amplifying a specific band which is the same as the positive control.

5) Phenotypic observation of transgenic plants

The transgenic arabidopsis thaliana which is positive in the T1 generation PCR detection is continuously cultured in a lighting incubator to the mature period, seeds are harvested to obtain T2 generation, the T2 generation is dibbled on 1/2MS culture medium containing kanamycins (50 mu g/ml) after being sterilized, the obtained product is placed in a 4 ℃ refrigerator for vernalization for 2d and then cultured in a 22 ℃ lighting incubator for two weeks, then the obtained product is transplanted into mixed nutrient of matrix and vermiculite for 22 ℃, and is cultured in 16h lighting/8 h dark, and the phenotypes of the transgenic plant and wild arabidopsis thaliana are observed, as shown in figure 16: transgenic and wild type arabidopsis did not differ in plant height, but the number of branches was more than that of the wild type, as shown in fig. 17: the leaf area of transgenic arabidopsis was small relative to wild type, as shown in fig. 18: the number of lateral roots of transgenic arabidopsis is more than that of wild type, as shown in fig. 19: the transgenic arabidopsis has earlier floral organ development and earlier flowering phase than the wild type.

The main references:

1、Busov VB,Brunner AM,Meilan R,Filichkin S,Ganio L,Gandhi S,Strauss SH.Genetic transformation:a powerful tool for dissection of adaptive traits in trees.New Phytol,2005a,167:9-18。

2、Busov VB,Fladung M,Groover A,Strauss SH.Insertional mutagenesis in Populus:relevance and feasibility.Tree Genet Genomes,2005b,1:13-142.

3、Kepinski S,Leyser O.The Arabidopsis F-box protein TIR1is an auxin receptor.Nature,2005,435(7041):446-451.

4、Kipreos ET,Pagano M.The F-box protein family.Genome biology,2000,1(5):REVIEWS3002.

5、Liang H,Barakat A,Schlarbaum SE,Mandoli,DF,Carlson,JE.Comparison of gene order of GIGANTEA loci in yellow-poplar,monocots,and eudicots.Genome,2010,53:533-544.

6、Lechner E,Achard P,Vansiri A,Potuschak T,Genschik P.F-box proteins everywhere.Current opinion in plant biology,2006,9(6):631-638.

7、Nie ZL,Wen J,Azuma H,Qiu YL,Sun H,Meng Y,Sun WB&Zimmer EA.Phylogenetic and biogeographic complexity of Magnoliaceae in the Northern Hemisphere inferred from three nuclear data sets.Molecular Phylogenetics and Evolution,2008,48,1027-1040.

8、Wang R,Zhang Y,Kieffer M,Yu H,Kepinski S,Estelle M.HSP90regulates temperature-dependent seedling growth in Arabidopsis by stabilizing the auxin co-receptor F-box protein TIR1.Nature communications,2016,7:10269.

9、Xia X,Xiao-bo Z,Yong-feng S,Hui-mei W,Bao-hua F,Xiao-hong L,Qi-na H,Li-xin S,Dan G,Yan H et al.A point mutation in an F-Box domain-containing protein is responsible for brown hull phenotype in rice.Rice Science,2016,23(1):1-8.

10、Yang X,Kalluri UC,Jawdy S,Gunter LE,Yin T,Tschaplinski TJ,Weston DJ,Ranjan P,Tuskan GA.The F-box gene family is expanded in herbaceous annual plants relative to woody perennial plants.Plant physiology,2008,148(3):1189-1200.

11. Zhaoweing.Rice 2F-box gene bioinformatics analysis Hubei agricultural science, 2016 (09): 2396-2399.

Sequence listing

<110> institute of biological resources of academy of sciences of Jiangxi province

<120> separation cloning and application of LHFB1 gene of liriodendron

<130> 2018

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2177

<212> DNA

<213> American gown (Liriodendron sino-amefollowing P.C. Yiehex Shang et Z.R.Wang)

<400> 1

gacttgtcca gcttcggttt acttacgaaa ctaagatccg aattgcagaa tctagccgaa 60

ctcctctagc aagtgtagtt cagatatcaa gaaaagatcg aagtgacaga tatgagaaac 120

aatcttcatt ttttttttaa cgacactagc gtactggctt gttttttgaa ttaaaataga 180

ccgaatctgg tctgtttgat caaaatgatg tactgtccag atgaagttct ggagcatatc 240

tttgatttcc tgtcttctca ccaagaccgg aattcggtgt ctttggtctg caagtcgtgg 300

ttcaaggtag agagatgcag tcggaatcgg gtttttatcg gaaattgcta tgcgatcggg 360

ccgaagaggc tgatcgagcg gtttccgagg gttagggctt tgagcttgaa gggaaagccg 420

cattttgccg atttcaatct cgtgccgcat gactggggcg ggttcgtgca tggctggatc 480

gttgccatgg cgaagagcta cccgtggctt gaggagctga ggctgaagag gatggtggtc 540

tcggatgaca gcttagagct gctgtcgcgg tcgttcccga acttcaaagc tctggttttg 600

gttagctgtg atggattcac tactgacggg ctcgcagcga tagctgcgaa ttgcagagtt 660

cttagagagc tagatttaca agaaagtgaa gtcgacgatc gaaggggcaa ctggcttagc 720

tgtttccccg attcattcac atcacttgtt tcactgaatt ttgcatgcct gaaaggagac 780

gtgaattttg gagctcttga gaggcttgtt gctaggtgcc caaacctcag gagtttgagg 840

ctaaaccgga ccgtgccctt tgaagtgctc tgtaggatcc ttgtgcgagc accccaattg 900

gaagacttgg gcacaggctc ctttgtacat gacatccgtt cccagtctta ccataaactt 960

gctaatgcct tacacaactg caagtccgtg aagatcttgt cggggttttg ggaggtcaat 1020

ccacgttgtt tgttggctgt ttatcccatc tgctcgaatc tgacttcgct gaacctgagc 1080

tacgcaccgt caattcaggg ggctgaactt atcaagctga ttcgccattg ccagaaactt 1140

caacgtctat gggtcttgga ttgcattgga gacaaagggt taggagttgt agcttccgct 1200

tgcaaagaac tgcaggaatt gagggtgttc ccatccgatc tctttggtgg aggaaatacc 1260

gtggtaacgg aagaaggctt gatttctgtc tccactggct gtccaaagct ccattcgctg 1320

ctgtacttct gccaccaaat gacaaatgcc gctcttatca ctgtcgccaa gagctgccct 1380

cgtttcaccc gcttccggtt atgtatcctt gaccccaaga agcctgacca tgtgacgcat 1440

cagccgttgg atgaaggctt cggggcgatt gtccagtcgt gcaaagatct gaagcgcctt 1500

tcactctctg gcctactcac agaccaggtc tttctataca ttggcatgta tgcggagcaa 1560

ctcgagatgt tatcggtggc atttgcaggg gagagcgata aggggatggt ctatgtactg 1620

aatggctgca agaagctccg gaagctagag atccgggaca gtccgtttgg cgatggcgcg 1680

atcctgacag acgtggggaa gtatgaaaca atgcgatccc tttggatgtc atcatgcgac 1740

gtcacgctcc ggggctgcaa gtcgctcgcg cagaagatgc cgaggctcaa tgttgagatt 1800

ataaatgaga gggatcagat ggatgagagc ctggatgatg gccatagggt ggaaaagatg 1860

tatgtgtatc gtacgttgga tgggccgagg aaagatgcgc ccgatttcgt ctggacggta 1920

taaggcaatt ggtccgcaac aagatacaat tatggttgta cctgtagcca aggtaaggta 1980

ctctgctctg caacattttc ttgttttgtg ttagactgat ctgtggattg aattagggat 2040

gttgggacag atctgtagtc agttttcttt agttatagag agattctagc tgtttgtaac 2100

tatgcttgga tcgactaatt ttattcgacg agtagttttt ttgttatcta tttgcatttt 2160

ttcccaaaaa aaaaaaa 2177

<210> 2

<211> 1719

<212> DNA

<213> American gown (Liriodendron sino-amefollowing P.C. Yiehex Shang et Z.R.Wang)

<400> 2

atgatgtact gtccagatga agttctggag catatctttg atttcctgtc ttctcaccaa 60

gaccggaatt cggtgtcttt ggtctgcaag tcgtggttca aggtagagag atgcagtcgg 120

aatcgggttt ttatcggaaa ttgctatgcg atcgggccga agaggctgat cgagcggttt 180

ccgagggtta gggctttgag cttgaaggga aagccgcatt ttgccgattt caatctcgtg 240

ccgcatgact ggggcgggtt cgtgcatggc tggatcgttg ccatggcgaa gagctacccg 300

tggcttgagg agctgaggct gaagaggatg gtggtctcgg atgacagctt agagctgctg 360

tcgcggtcgt tcccgaactt caaagctctg gttttggtta gctgtgatgg attcactact 420

gacgggctcg cagcgatagc tgcgaattgc agagttctta gagagctaga tttacaagaa 480

agtgaagtcg acgatcgaag gggcaactgg cttagctgtt tccccgattc attcacatca 540

cttgtttcac tgaattttgc atgcctgaaa ggagacgtga attttggagc tcttgagagg 600

cttgttgcta ggtgcccaaa cctcaggagt ttgaggctaa accggaccgt gccctttgaa 660

gtgctctgta ggatccttgt gcgagcaccc caattggaag acttgggcac aggctccttt 720

gtacatgaca tccgttccca gtcttaccat aaacttgcta atgccttaca caactgcaag 780

tccgtgaaga tcttgtcggg gttttgggag gtcaatccac gttgtttgtt ggctgtttat 840

cccatctgct cgaatctgac ttcgctgaac ctgagctacg caccgtcaat tcagggggct 900

gaacttatca agctgattcg ccattgccag aaacttcaac gtctatgggt cttggattgc 960

attggagaca aagggttagg agttgtagct tccgcttgca aagaactgca ggaattgagg 1020

gtgttcccat ccgatctctt tggtggagga aataccgtgg taacggaaga aggcttgatt 1080

tctgtctcca ctggctgtcc aaagctccat tcgctgctgt acttctgcca ccaaatgaca 1140

aatgccgctc ttatcactgt cgccaagagc tgccctcgtt tcacccgctt ccggttatgt 1200

atccttgacc ccaagaagcc tgaccatgtg acgcatcagc cgttggatga aggcttcggg 1260

gcgattgtcc agtcgtgcaa agatctgaag cgcctttcac tctctggcct actcacagac 1320

caggtctttc tatacattgg catgtatgcg gagcaactcg agatgttatc ggtggcattt 1380

gcaggggaga gcgataaggg gatggtctat gtactgaatg gctgcaagaa gctccggaag 1440

ctagagatcc gggacagtcc gtttggcgat ggcgcgatcc tgacagacgt ggggaagtat 1500

gaaacaatgc gatccctttg gatgtcatca tgcgacgtca cgctccgggg ctgcaagtcg 1560

ctcgcgcaga agatgccgag gctcaatgtt gagattataa atgagaggga tcagatggat 1620

gagagcctgg atgatggcca tagggtggaa aagatgtatg tgtatcgtac gttggatggg 1680

ccgaggaaag atgcgcccga tttcgtctgg acggtataa 1719

<210> 3

<211> 572

<212> PRT

<213> American gown (Liriodendron sino-amefollowing P.C. Yiehex Shang et Z.R.Wang)

<400> 3

Met Met Tyr Cys Pro Asp Glu Val Leu Glu His Ile Phe Asp Phe Leu

1 5 10 15

Ser Ser His Gln Asp Arg Asn Ser Val Ser Leu Val Cys Lys Ser Trp

20 25 30

Phe Lys Val Glu Arg Cys Ser Arg Asn Arg Val Phe Ile Gly Asn Cys

35 40 45

Tyr Ala Ile Gly Pro Lys Arg Leu Ile Glu Arg Phe Pro Arg Val Arg

50 55 60

Ala Leu Ser Leu Lys Gly Lys Pro His Phe Ala Asp Phe Asn Leu Val

65 70 75 80

Pro His Asp Trp Gly Gly Phe Val His Gly Trp Ile Val Ala Met Ala

85 90 95

Lys Ser Tyr Pro Trp Leu Glu Glu Leu Arg Leu Lys Arg Met Val Val

100 105 110

Ser Asp Asp Ser Leu Glu Leu Leu Ser Arg Ser Phe Pro Asn Phe Lys

115 120 125

Ala Leu Val Leu Val Ser Cys Asp Gly Phe Thr Thr Asp Gly Leu Ala

130 135 140

Ala Ile Ala Ala Asn Cys Arg Val Leu Arg Glu Leu Asp Leu Gln Glu

145 150 155 160

Ser Glu Val Asp Asp Arg Arg Gly Asn Trp Leu Ser Cys Phe Pro Asp

165 170 175

Ser Phe Thr Ser Leu Val Ser Leu Asn Phe Ala Cys Leu Lys Gly Asp

180 185 190

Val Asn Phe Gly Ala Leu Glu Arg Leu Val Ala Arg Cys Pro Asn Leu

195 200 205

Arg Ser Leu Arg Leu Asn Arg Thr Val Pro Phe Glu Val Leu Cys Arg

210 215 220

Ile Leu Val Arg Ala Pro Gln Leu Glu Asp Leu Gly Thr Gly Ser Phe

225 230 235 240

Val His Asp Ile Arg Ser Gln Ser Tyr His Lys Leu Ala Asn Ala Leu

245 250 255

His Asn Cys Lys Ser Val Lys Ile Leu Ser Gly Phe Trp Glu Val Asn

260 265 270

Pro Arg Cys Leu Leu Ala Val Tyr Pro Ile Cys Ser Asn Leu Thr Ser

275 280 285

Leu Asn Leu Ser Tyr Ala Pro Ser Ile Gln Gly Ala Glu Leu Ile Lys

290 295 300

Leu Ile Arg His Cys Gln Lys Leu Gln Arg Leu Trp Val Leu Asp Cys

305 310 315 320

Ile Gly Asp Lys Gly Leu Gly Val Val Ala Ser Ala Cys Lys Glu Leu

325 330 335

Gln Glu Leu Arg Val Phe Pro Ser Asp Leu Phe Gly Gly Gly Asn Thr

340 345 350

Val Val Thr Glu Glu Gly Leu Ile Ser Val Ser Thr Gly Cys Pro Lys

355 360 365

Leu His Ser Leu Leu Tyr Phe Cys His Gln Met Thr Asn Ala Ala Leu

370 375 380

Ile Thr Val Ala Lys Ser Cys Pro Arg Phe Thr Arg Phe Arg Leu Cys

385 390 395 400

Ile Leu Asp Pro Lys Lys Pro Asp His Val Thr His Gln Pro Leu Asp

405 410 415

Glu Gly Phe Gly Ala Ile Val Gln Ser Cys Lys Asp Leu Lys Arg Leu

420 425 430

Ser Leu Ser Gly Leu Leu Thr Asp Gln Val Phe Leu Tyr Ile Gly Met

435 440 445

Tyr Ala Glu Gln Leu Glu Met Leu Ser Val Ala Phe Ala Gly Glu Ser

450 455 460

Asp Lys Gly Met Val Tyr Val Leu Asn Gly Cys Lys Lys Leu Arg Lys

465 470 475 480

Leu Glu Ile Arg Asp Ser Pro Phe Gly Asp Gly Ala Ile Leu Thr Asp

485 490 495

Val Gly Lys Tyr Glu Thr Met Arg Ser Leu Trp Met Ser Ser Cys Asp

500 505 510

Val Thr Leu Arg Gly Cys Lys Ser Leu Ala Gln Lys Met Pro Arg Leu

515 520 525

Asn Val Glu Ile Ile Asn Glu Arg Asp Gln Met Asp Glu Ser Leu Asp

530 535 540

Asp Gly His Arg Val Glu Lys Met Tyr Val Tyr Arg Thr Leu Asp Gly

545 550 555 560

Pro Arg Lys Asp Ala Pro Asp Phe Val Trp Thr Val

565 570

Claims (1)

1. An application of an liriodendron ohFB 1 gene in transformation of arabidopsis thaliana is characterized in that the number of lateral roots of the arabidopsis thaliana transformed into the liriodendron ohFB 1 is increased, the leaf area is reduced, the flowering phase is advanced, and the nucleotide sequence of the LhFB1 gene is shown as SEQ ID No. 1.

Images