CN114736903B - Cloning and application of promoter of grass land early-maturing glutamine synthetase gene PpGGS1.1 - Google Patents
Cloning and application of promoter of grass land early-maturing glutamine synthetase gene PpGGS1.1 Download PDFInfo
- Publication number
- CN114736903B CN114736903B CN202210576013.8A CN202210576013A CN114736903B CN 114736903 B CN114736903 B CN 114736903B CN 202210576013 A CN202210576013 A CN 202210576013A CN 114736903 B CN114736903 B CN 114736903B
- Authority
- CN
- China
- Prior art keywords
- pcr amplification
- round
- gene promoter
- primers
- promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
- C12Y603/01—Acid-ammonia (or amine)ligases (amide synthases)(6.3.1)
- C12Y603/01002—Glutamate-ammonia ligase (6.3.1.2)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/20—Reduction of greenhouse gas [GHG] emissions in agriculture, e.g. CO2
- Y02P60/21—Dinitrogen oxide [N2O], e.g. using aquaponics, hydroponics or efficiency measures
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a clone of a promoter of a prairie grass prairie glutamine synthetase gene PpGGS1.1 and application thereof, relates to the field of genetic engineering, and aims to fill a gap in the research on the sequence of the promoter PpGGS1.1 of the prairie grass in the existing resources so as to lay a foundation for improving the absorption and utilization capacity of the nitrogen element of the prairie grass and improving the quality of lawn products of the prairie grass. The primer of the invention, SP1:5 'GCGGCCATGACAAGAATAAGAAG-3'; SP2:5 'GCGATGATCTTTCTCGGTGGTGT-3'; SP3:5' AGATCGGGTGAGGAGCGCCATAA-; SP4:5 'TCGAACCGATGTACGTATATGG-3'. The nucleotide sequence of the PpGGS1.1 gene promoter fragment is shown as SEQ ID NO. 1.
Description
Technical Field
The invention belongs to the field of biotechnology breeding, and particularly relates to cloning and application of a promoter of a grass land early-maturing glutamine synthetase gene PpGGS1.1.
Background
Poa pratensis (scientific name: poa pratensis L., english name: ken tuckybluegrass) is perennial cold season rhizome-sparse grass belonging to Poa of Gramineae (Graminae) and Poa, is excellent cold season lawn grass in cold and warm regions, and has good lawn properties and high ornamental value. Sufficient nitrogen nutrition is an important factor directly influencing the quality of lawn plants, and as lawn plants widely used in the three north areas (including northeast, northwest and north China), a large amount of nitrogen fertilizer is required to be applied for maintaining the ornamental quality of the meadow bluegrass lawn. The improvement of the utilization efficiency of the nitrogen of the pratense grass is beneficial to improving the quality and the ornamental value of the pratense grass, and has important significance for saving energy, reducing pollution and protecting the ecological environment.
Gene expression regulation at plant transcription level is mainly controlled by promoters and their contributing Cis-acting Regulatory Elements (CREs). The research on the functions of the promoter CREs plays an important role in the aspect of high-efficiency expression of exogenous genes in transgenic plants. The gene transcription is regulated and controlled at different growth stages of plants or in response to various abiotic stresses, the accurate and efficient regulation and control of target genes can be realized by further developing and utilizing the promoter, and the gene expression promoter has great application potential in gene function research and stress-resistant germplasm resource cultivation. Thus, analysis and study of specific gene promoter regions can provide a lot of valuable information about the regulation of its expression. Glutamine Synthetase (GS) catalyzes NH 4 + Reacting with glutamic acid (Glu) to form NH in the form of inorganic nitrogen 4 + Conversion to organic nitrogen form of glutamine (Gln), elimination of NH 4 + Damage to cells and improve the utilization efficiency of nitrogen nutrition of plants. GS isozymes are central in higher plant nitrogen metabolism. The GS gene promoter has been rarely studied, and there is no report on the effect of the GS gene promoter in Poa pratensis. Although China has abundant germplasm resources of the Poa pratensis, most of the current commercial Poa pratensis varieties in China depend on imports. The nitrogen fertilizer is of great importance to the growth of the grassland bluegrass and the quality of the greens, so that the method has important practical significance for improving the utilization efficiency of the nitrogen of the grassland bluegrass and the quality of the greens through genetic improvement and carrying out variety popularization and application.
The invention discloses a method for cloning a meadow early-maturing glutamine synthetase PpGS1 gene in patent publication No. CN 107904235B, which discloses: (1) A partial cDNA sequence of the PpGS1 gene was obtained by electronic cloning and had a length of 1065bp. (2) And (3) designing a specific primer by taking the cDNA sequence as a target sequence, and amplifying by using an RT-PCR technology. (3) recovering the PCR product by agarose gel electrophoresis. And connecting the recovered specific product to a pEasy cloningvector vector, transforming competent cells, and sequencing positive clones to obtain a partial cDNA sequence of the Poa pratensis PpGS1 gene, wherein the partial cDNA sequence is consistent with the electronic cloning length. (4) Specific primers were designed based on the cloned partial cDNA sequence, and the total length of the obtained PpGS1cDNA was 1451bp by cDNA end amplification using the SMARTTM RACE technology principle of Clontech. (5) The detection of a real-time fluorescent quantitative PCR technology indicates that the PpGS1 gene has tissue specific expression. However, the invention patent is to clone the cDNA sequence of the PpGS1 gene, and does not relate to the promoter of the PpGS1.1 gene.
Disclosure of Invention
The invention aims to fill the blank in the research of the promoter sequence of the Poa pratensis PpGGS1.1 in the prior art, and lays a foundation for improving the nitrogen absorption and utilization capacity of the Poa pratensis and improving the lawn quality of the Poa pratensis.
The invention relates to a primer for cloning promoter fragments of a meadow precocious glutamine synthetase PpGGS1.1 gene, which has the following sequences:
SP1：5'-GCGGCCATGACAAGAATAAGAAG-3'；
SP2：5'-GCGATGATCTTCTCGGTGGTGT-3'；
SP3：5'-AGATCGGTGAGGAGCGCCATAA-3'；
SP4：5'-TCGAACCGATGTACCGTATATGG-3'。
a kit comprising the primer.
The method for cloning the promoter fragment of the gene PpGGS1.1 of the poa annua glutamine synthetase by adopting the primer is carried out according to the following modes:
firstly, extracting genome DNA of the meadow bluegrass;
and step two, taking the genomic DNA of the Poa pratensis as a template, carrying out PCR amplification by using the primer of claim 1, and recovering a PCR product through agarose gel electrophoresis to obtain the PpGGS1.1 gene promoter fragment.
The invention relates to a primer for cloning a promoter of a meadow early-maturing glutamine synthetase PpGGS1.1 gene, which has the following sequence:
F1：5'-CCCAAGCTTTCCGATTAGTATTGCCGTGAT-3'；
R1：5'-TCCCCCGGGTGATCTTCTCGGTGGTGTCG-3'。
the PpGGS1.1 gene promoter obtained by the primer is adopted, and the nucleotide sequence of the PpGGS1.1 gene promoter is shown as SEQ ID NO. 2.
The invention adopts the primer to clone the promoter of the gene PpGGS1.1 of the prairie bluegrass glutamine synthetase, which is carried out according to the following mode:
and (2) taking the genomic DNA of the Poa pratensis as a template, carrying out PCR amplification by using the primers, and recovering a 1511bp PCR product through agarose gel electrophoresis to obtain the PpGGS1.1 gene promoter.
The invention has the beneficial effects that:
the method adopts the meadow bluegrass as a test material, clones the PpGS1.1 promoter sequence by a chromosome walking (GW) technology, utilizes tobacco transient dip-dyeing to prove that the PpGS1.1 gene promoter has the function of gene transcription, further transforms arabidopsis thaliana by an inflorescence dip-dyeing method to analyze the expression mode and the transcription activity of the PpGS1.1 gene promoter, explores the function of the PpGS1.1 gene promoter, lays a foundation for improving the nitrogen absorption and utilization capability of the meadow bluegrass and improving the lawn article quality of the meadow bluegrass, provides a certain theoretical basis for improving the resistance of meadow bluegrass varieties and the survival adaptive capability of the meadow bluegrass in adverse environments, and also provides a new insight for enhancing the transcription regulation and control of the genes.
Drawings
FIG. 1 is an electrophoretogram of genomic DNA of Poa pratensis; wherein, M: DL15000DNA Marker (bp); 1-3: poa pratensis total DNA;
FIG. 2 is a clone electrophoresis diagram of PpGS1.1 gene promoter; wherein, M: DL5000 DNA Marker (bp); 1-4: specific primers SP1, SP2, SP3 and SP4 and degenerate primers are subjected to PCR amplification in each step;
FIG. 3 is an analysis diagram of the restriction enzyme site of the promoter fragment of the PpGGS1.1 gene;
FIG. 4 is a clone electrophoretogram of a full-length promoter; wherein, M: DL5000 DNA Marker (bp); 1,2: ppGS1.1 gene promoter;
FIG. 5 is a recovered electrophoresis diagram of a cloning vector of PpGGS1.1 gene promoter and an expression vector pBI121 double-restriction enzyme target fragment gel; in the figure, M: DL5000 DNA Marker (bp); 1: carrying out enzyme digestion on pBI121 plasmid; 2: enzyme digestion of a promoter sequence;
FIG. 6 is a construction diagram of a cloning vector and an expression vector pBI12 of PpGGS1.1 gene promoter;
FIG. 7 is a diagram showing the expression of GUS gene in tobacco;
FIG. 8 is a photograph of 50mg/L kanamycin-screened resistant seedlings of Arabidopsis thaliana; in the figure, panel A: screening seeds (transgenic seedlings in circles); b, drawing: moving the seeds into nutrient soil for 7 days;
FIG. 9 is an electrophoresis chart of molecular identification of resistant seedlings of Arabidopsis thaliana; in the figure, panel A: 1,GUS-PCR product; 2, negative control; and B, drawing: 1, ppGS1.1-PCR product; 2, negative control;
FIG. 10 is a GUS staining map of transgenic Arabidopsis; in the drawings, A to D: the expression condition of GUS genes in the stems, roots and leaves of the seedlings of the transgenic arabidopsis thaliana after germination for 6 d;
FIG. 11 is a graph of a protein standard curve;
FIG. 12 is a graph of fluorescence standard curves;
FIG. 13 is a photograph of a 13-day-old transgenic Arabidopsis seedling;
FIG. 14 is a diagram for testing the influence of PpGS1.1 promoter activity under nitrogen stress by GUS gene fluorescence quantitative analysis; FIG. a is a nitrate nitrogen stress map; panel b is an ammonium nitrogen stress map.
Detailed Description
It will be understood by those of ordinary skill in the art that the foregoing embodiments are specific examples for carrying out the invention, and that various changes in form and details may be made therein without departing from the spirit and scope of the invention in practice.
For the purpose of promoting a clear understanding of the objects, aspects and advantages of the invention, reference will now be made in detail to the embodiments of the present disclosure, and it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope of the present disclosure.
The exemplary embodiments of the present invention and the description thereof are provided to explain the present invention and not to limit the present invention.
The first embodiment is as follows: the primer for cloning the promoter fragment of the meadow precocious glutamine synthetase PpGGS1.1 gene has the following sequence:
SP1：5'-GCGGCCATGACAAGAATAAGAAG-3'；
SP2：5'-GCGATGATCTTCTCGGTGGTGT-3'；
SP3：5'-AGATCGGTGAGGAGCGCCATAA-3'；
SP4：5'-TCGAACCGATGTACCGTATATGG-3'。
the second embodiment is as follows: the first difference between the present embodiment and the specific embodiment is: the nucleotide sequence of the PpGGS1.1 gene promoter fragment is shown as SEQ ID NO. 1. The rest is the same as the first embodiment.
The third concrete implementation mode: this embodiment includes a kit of primers as described in the first embodiment.
The fourth concrete implementation mode: the embodiment adopts the method for cloning the promoter fragment of the gene PpGGS1.1 of the glutamine synthetase from the bluegrass as the first embodiment, and is characterized in that: it is carried out as follows:
firstly, extracting genome DNA of Poa pratensis;
and step two, taking the genome DNA of the Poa pratensis as a template, carrying out PCR amplification by adopting the primer of claim 1, and recovering a PCR product through agarose gel electrophoresis to obtain the PpGGS1.1 gene promoter fragment.
The fifth concrete implementation mode: the fourth difference between this embodiment and the specific embodiment is that: the PCR amplification is completed by four rounds of PCR amplification, and specifically comprises the following steps:
first round PCR amplification: using genome DNA of Poa pratensis as a template, and adopting degenerate primers and SP1 as primers to amplify;
second round of PCR amplification: taking a first round of PCR amplification product as a template, and adopting degenerate primers and SP2 as primers for amplification;
third round of PCR amplification: taking a second round PCR amplification product diluted by 100 times as a template, and adopting degenerate primers and SP3 as primers for amplification;
fourth PCR amplification: taking a third PCR amplification product diluted by 100 times as a template, and carrying out amplification by adopting degenerate primers and SP3 as primers. The rest is the same as the fourth embodiment.
The sixth specific implementation mode: the fourth or fifth embodiment is different from the specific embodiment in that: the PCR amplification is completed by four rounds of PCR amplification, wherein the PCR amplification system of the first round is as follows:
the first round of PCR amplification conditions were as follows:
the second round of PCR amplification system was as follows:
the second round of PCR amplification conditions were as follows:
the third round of PCR amplification system was as follows:
the third round of PCR amplification conditions were as follows:
the fourth round of PCR amplification was as follows:
the fourth round of PCR amplification conditions were as follows:
the others are the same as the fourth or fifth embodiments.
The seventh embodiment: the primer for cloning the promoter of the early-maturing grass glutamine synthetase PpGGS1.1 gene of the embodiment has the following sequence:
F1：5'-CCCAAGCTTTCCGATTAGTATTGCCGTGAT-3'；
R1：5'-TCCCCCGGGTGATCTTCTCGGTGGTGTCG-3'。
the specific implementation mode eight: in the embodiment, the PpGGS1.1 gene promoter obtained by the primer is adopted, and the nucleotide sequence of the PpGGS1.1 gene promoter is shown as SEQ ID NO. 2.
The specific implementation method nine: the method for cloning the promoter of the gene PpGS1.1 of the glutamine synthetase from Poa annua by using the primer of the embodiment is carried out according to the following mode:
and (2) taking the genomic DNA of the Poa pratensis as a template, carrying out PCR amplification by using the primers, and recovering a 1511bp PCR product through agarose gel electrophoresis to obtain the PpGGS1.1 gene promoter.
The specific implementation mode is ten: the present embodiment differs from the ninth embodiment in that: the PCR amplification system is as follows:
the PCR amplification conditions were as follows:
the rest is the same as in the ninth embodiment.
The beneficial effects of the present invention are demonstrated by the following examples:
examples
1 test Material
1.1 plant Material
Test materials: poa pratensis and Nicotiana tabacum (Nicotiana tabacum) were purchased from Kyoto Keruo grass science, inc. and Wuhan Tian Biotech, inc., respectively. Arabidopsis thaliana (Arabidopsis thaliana) was purchased from The Arabidopsis germplasm Resource library, the Arabidopsis Information Resource (https:// www.
1.2 Primary reagents and instruments
1.2.1 Primary reagents
(1) Molecular biological reagent
Novel plant DNA extraction kit (TIANGEN-DP 320); DLmarker5000, DLmarkerr1000, DLmarker500 (Takara); 6 × loading buffer, 10 × loading buffer (Takara); 50 × TAE (Solarbio); agarose (Biowest); 2 × Taq Mastermix (CW Biotech); green ViewTM nucleic acid dye (CW Biotech); primer primers (Sangon Biotech); ddH 2 O (Sangon Biotech); genome Walking Kit promoter cloning Kit (Takara); hind III and SmaI restriction enzymes (Trans); t is a unit of 4 Ligase (Trans); liquid nitrogen; plasmid extraction kit (Trans); gel recovery kit (Trans).
(2) Bacterial strain and plasmid vector
The Escherichia coli is DH5 alpha, the cloning vector is Trans-T1, the expression vector is pBI121, and the Agrobacterium is LBA4404, all purchased from Trans company.
(3) Chemical reagent
Acetosyringone (AS), 2-morpholinoethanesulfonic acid (MES), sliwet-77;
kanamycin (Kan) (50 mg/ml): weighing 1g Kan to dissolve in H 2 O, fixing the volume to 20ml, subpackaging and storing at-20 ℃;
rifampicin (Rif) (50 mg/ml): weighing 1g of Rif, dissolving in a small amount of DMSO (dimethyl sulfoxide), fixing the volume to 20ml with distilled water, subpackaging, and storing at-20 ℃;
1% agarose gel: weighing 0.3g of agarose, 1 XTAE 30ml, 1 μ l of Green View TM nucleic acid dye;
10 × TAE electrophoresis buffer: weighing 108g of Tris, 55g of boric acid and 40ml of 0.5mol/L EDTA (pH = 8.0), adding a proper amount of deionized water for full dissolution, metering the volume to 1L, sterilizing at 121 ℃ for 20min, and storing at room temperature for later use;
30% of glycerin: measure 30ml of glycerol to 70ml of ddH 2 Sterilizing at 121 deg.C for 20min in O, and storing at room temperature;
LB solid Medium: weighing 10g of NaCl, 10g of peptone, 5g of yeast powder and 15g of agar, and dissolving in H 2 Adjusting pH to 7.0, diluting to 1L, sterilizing at 121 deg.C for 20min, and storing at room temperature (if liquid culture medium is prepared, agar is not added);
MS solid culture medium: weighing MS culture medium (not containing agar and sucrose) 4.74g, agar 9g, sucrose 30g dissolved in H 2 O, adjusting pH to 6.8, diluting to 1L, sterilizing at 121 deg.C for 20min, and storing at 4 deg.C (if liquid culture medium is prepared, the like)No agar added).
(4) GUS staining mother liquor
50mM potassium ferricyanide K 3 [Fe(CN) 6 ]: 0.823g of the resulting solution was weighed out and dissolved in H 2 O, fixing the volume to 50ml;
50mM potassium ferrocyanide K 4 [Fe(CN) 6 ]: weighing 01.056g of the solution in H 2 O, fixing the volume to 50ml;
1M disodium hydrogen phosphate Na 2 HPO 4 .12H 2 O: 17.907g of the crude product was dissolved in H 2 O, to 50ml (pH = 7.0);
1M Potassium dihydrogen phosphate KH 2 PO 4 : 6.805g of the solution was weighed out and dissolved in H 2 O, to 50ml (pH = 7.0);
0.5M Na 2 EDTA: 18.612g of the crude product is weighed out and dissolved in H 2 O, to 100ml (pH = 8.0);
10% Trition x-100: measuring 1ml of the solution in H 2 O, fixing the volume to 10ml;
x-gluc: 10mg was weighed and dissolved in a small amount of MDSO and the volume was adjusted to 1ml with distilled water.
(5) GUS fluorescence quantitative detection required solution
0.2M Na 2 CO 3 : 21.2g of this solution was dissolved in H 2 O, constant volume is 1L;
4-Methyleumbelliferone (4-MU) mother liquor (1 mM): 1.76mg of Na was dissolved in 10ml of 0.2M Na 2 CO 3 Storing at middle temperature and at 4 ℃ in dark;
BSA (2 mg/ml): weighing 20mg of the solution in H 2 O, fixing the volume to 10ml;
4-Methylumbelliferyl-beta-D-glucuronide (4-MUG) mother liquor (1 mM): weighing 10.56mg, dissolving in 30ml of GUS extraction buffer solution, and storing at 4 ℃ in a dark place;
Na 2 HPO 4 (1 mol/L): 71.628g of the solution is weighed out and dissolved in H 2 O, fixing the volume to 200ml;
NaH 2 PO 4 (1 mol/L): 31.202g of the product was weighed out and dissolved in H 2 O, fixing the volume to 200ml;
SDS solution (10%): weighing 10g of the mixture and dissolving in H 2 O, fixing the volume to 100ml;
0.5M Na 2 EDTA: weighing 18.612g by distillationWater to 100ml (pH = 8.0);
coomassie Brilliant blue G-250 solution: 10mg of Coomassie brilliant blue G-250 was weighed, dissolved in 5ml of 90% ethanol, 10ml of 85% phosphoric acid was added, and finally, a volume of 100ml was made with distilled water.
1.2.2 Main instrumentation
TABLE 1 apparatus used in the test
2 test method
2.1 plant Material cultivation
Culturing the grass of Poa pratensis in a greenhouse of a gardening station of northeast university of agriculture, and sowing in a flowerpot with a diameter of 25cm and a height of 20cm, wherein the sowing amount is 15g/m 2 The culture medium is formed by uniformly mixing vermiculite and turfy soil according to a ratio of 1. The greenhouse culture conditions are that the temperature is 20-25 ℃, the humidity is 60-75 percent, and the light intensity is 400 mu mol.m -2 ·s -1 And the illumination time is 12h. After 4 true leaves grow out of the seedling, 15 overground leaves are randomly taken from each pot, wrapped by tinfoil and numbered, and then quickly frozen by liquid nitrogen and stored in an ultra-low temperature refrigerator at minus 80 ℃ in time for extracting DNA. The arabidopsis and the tobacco are cultured in a tissue culture room of the garden institute of northeast university of agriculture under the same culture conditions.
2.2 extraction and quality detection of genomic DNA
The upper leaves of Poa pratensis are used as a material, and the genomic DNA of Poa pratensis is extracted by using a kit (TIANGEN, beijing). The extracted DNA was electrophoretically detected and photographed. Another 2 μ l of DNA stock was taken to detect OD260 on uv spectrophotometer: OD280, if the ratio is 1.7-1.9, indicates that the extracted DNA is of good quality. And (3) subpackaging the successfully detected DNA in sterilized centrifuge tubes, marking, uniformly diluting to a concentration of 100 ng/. Mu.l, and placing in a refrigerator at the temperature of-20 ℃ for later use.
2.3 cloning of promoter sequences
2.3.1 design of specific primers
On the basis of the obtained full length of the Poa pratensis PpGGS1.1 gene cDNA, a primer is designed to amplify the full length of the Poa pratensis PpG1.1 gene DNA. Through comparison of PpGGS1.1 gene DNA and PpGGS1.1 gene cDNA sequences, a part of DNA and cDNA sequences of the Poa pratensis PpGGS1.1 gene are used as templates, and 3 specific primers (Table 2) are designed by using Preimer5.0 software according to the requirements of primer design of chromosome walking technology. And detecting the primer on an NCBI website to determine whether the primer contains a primer dimer and other structures.
The specific primers were as follows:
TABLE 2 promoter sequence primer design
2.3.2 round 1 PCR reaction
TABLE 3PCR amplification reaction System
The 1 st round PCR reaction conditions were as follows:
2.3.3 round 2 PCR reaction
1. Mu.l of the 1 st round product was used as a template, and AP1 and SP2 were used as primers to carry out 2 nd round PCR.
The reaction system is shown in Table 4.
TABLE 4 PCR amplification reaction System
The 2 nd round PCR reaction conditions were as follows:
2.3.4 round 3PCR reactions
1 μ l of the 100-fold diluted product from round 2 was used as a template, and AP1 and SP3 were used as primers to carry out round 3PCR reactions. The reaction system is shown in Table 5.
TABLE 5 PCR amplification reaction System
The 3 rd round PCR reaction conditions were identical to the 2 nd round reaction conditions.
Taking 5 mul of products of the 1 st, 2 nd and 3 rd rounds for electrophoresis, carrying out gel recovery on bright electrophoresis bands, and carrying out DNA sequencing on PCR products by taking SP3 as a primer.
2.3.5 round 4 PCR reaction
And designing a specific primer SP4 according to a sequencing result. 1 μ l of the 100-fold diluted product from round 3 was used as a template, and AP1 and SP4 were used as primers to carry out round 4 PCR reactions. The reaction system is shown in Table 6.
TABLE 6 PCR amplification reaction System
The 4 th round PCR reaction conditions were identical to the 2 nd round reaction conditions.
And taking 5 mu l of PCR products of the 4 th round for electrophoresis, carrying out gel recovery on bright electrophoresis bands, and carrying out DNA sequencing on the PCR products by taking SP4 as a primer.
2.3.6 round 5 PCR reaction
Synthesizing the sequencing results of two PCR reactions, designing a specific primer of the PpGGS1.1 gene promoter sequence by using PrimerPreimer5.0, and selecting a proper enzyme cutting site through an online analysis website NEBcuter 2.0 and adding the enzyme cutting site to the primer. 5 th PCR reaction was performed. Specific primers are shown in Table 7 (enzyme sites underlined).
TABLE 7 promoter sequence primer design
The reaction system is shown in Table 8.
TABLE 8 PCR amplification reaction System
The 5 th round PCR reaction conditions were as follows:
5. Mu.l of the PCR product of round 5 was subjected to electrophoresis. The bright band of about 1.5kb was excised, gel recovered and sequenced using F1 and R1 as primers.
2.4 bioinformatics analysis
The prediction and analysis of promoter elements are carried out by using software such as PlantCare and PLACE.
2.5 transformation of Escherichia coli with recombinant vector
The fragment obtained from the 5 th round PCR reaction of part 2.3.6 was ligated to the Trans-T1 vector. The specific operation is as follows:
(1) The ligation reaction system is shown in Table 9.
TABLE 9 Carrier attachment System
(2) Mixing the reagents described in Table 9, standing at room temperature for 15min, and placing the centrifuge tube on ice for later use;
(3) Transformation plates were prepared in advance. Adding 25 mu l of Kan (50 mg/ml) into 25ml of LB solid culture medium completely melted at about 50 ℃, shaking gently and mixing uniformly, pouring into a culture dish (phi =9 cm) before cooling, and standing for 1-3 h at room temperature for later use (on a pre-sterilized ultra-clean bench);
(4) Adding the reaction solution into a centrifugal tube containing 100 mu l of DH5 alpha, and carrying out ice bath for 30min;
(5) Heat shock is carried out at 42 ℃ for 30sec, and then ice bath is carried out for 2min immediately;
(6) Adding 1ml of normal-temperature LB liquid culture medium (carried out on a super clean bench sterilized in advance) into the product, and performing shake culture at 200rpm and 37 ℃ for 1h;
(7) After centrifuging the product at 200rpm for 2min, 100. Mu.l of each of the supernatant and the precipitated product were added to the prepared LB solid medium (containing Kan), and the product was slowly spread on a sterilized spreading bar. After sealing, the sealing film is marked with the corresponding serial number and date, placed in the forward direction for 0.5h, and then the plate is inverted to culture at 37 ℃ overnight (on an ultra-clean bench sterilized in advance).
Positive clones were screened and sequenced. Dipping 3 white single colonies with the gun heads respectively, diluting the white single colonies into 50 mul of sterile water, marking serial numbers, taking 1 mul of diluent respectively as a template of colony PCR, wherein the system and conditions of the colony PCR are consistent with the conditions of the 5 th round PCR except that the diluent replaces genome DNA. Taking 5 mu l of colony PCR product for electrophoresis detection, adding corresponding diluent of a target strip into an LB liquid culture medium (containing Kan), culturing overnight at 37 ℃ and 200rpm, and sending turbid bacterial liquid to a company for sequencing after making a corresponding mark. The correctly sequenced bacterial solution was used to extract plasmids using a kit (Trans, beijing).
2.6 construction of expression vectors
2.6.1 cleavage and ligation
According to the promoter sequence of the Poa pratensis PpGGS1.1 gene and the characteristics of multiple cloning sites on a plasmid map of an expression vector pBI121, enzyme cutting sites HindIII and SmaI are introduced, and the expression vector and the cloning vector are subjected to double enzyme cutting.
The reaction system is shown in Table 10.
TABLE 10 double enzyme digestion System
Adding Hind III enzyme, incubating at 37 deg.C for 15min, heating at 80 deg.C for 20min for inactivation, adding Sma I enzyme, incubating at 25 deg.C for 15min, adding 10 XDNA Loading Buffer to reduce the final concentration to 1X, performing electrophoresis, and recovering target bands.
The obtained PpGGS1.1 promoter product is connected with a pBI121-35S linear fragment.
The reaction system is shown in Table 11.
TABLE 11 connection system
The reagents described in Table 11 were mixed and reacted at 25 ℃ for 2h. The expression vector pBI121 after the reaction was transformed into E.coli for selection and culture to obtain a binary expression vector in which PpGGS1.1 promoter was substituted for 35S promoter, which was named PpGGS1.1-GUS. The product was added to 100. Mu.l of E.coli competent cells, and the subsequent step was followed by 2.5 (4).
2.6.2 transformation of Agrobacterium
(1) Adding 10. Mu.l of PpGGS1.1-GUS plasmid DNA into a centrifuge tube containing 100. Mu.l of LBA4404, flicking and mixing evenly, and then carrying out ice bath for 30min;
(2) Quickly freezing with liquid nitrogen for 5min, water bathing at 37 deg.C for 5min, and ice bathing for 2min;
(3) Adding 0.5ml LB liquid culture medium, shaking and culturing at 28 deg.C and 180rpm for 3h;
(4) The product was centrifuged at 200rpm for 1min, 100. Mu.l of the supernatant and the precipitated product were added to LB solid medium (containing Kan), respectively, and the product was slowly smeared with a sterilized spreading bar. After the sealing film is sealed, the corresponding serial number and date are marked, the plate is placed in the forward direction for 0.5h, and then the plate is inverted and cultured at 37 ℃ for 2d (the culture is carried out on an ultra-clean workbench which is sterilized in advance).
2.7 transient Dip-dyeing of tobacco
(1) Marking the agrobacterium strain containing PpGS1.1-GUS expression vector on LB (containing corresponding antibody) solid culture medium prepared in advance by using a gun head, marking the corresponding serial number and date after a sealing film is sealed, and culturing for 2d at 28 ℃ (marking and picking the strain on a superclean bench sterilized in advance);
(2) Single colonies were picked up by a pipette tip in 1ml LB liquid medium and shake-cultured at 28 ℃ overnight at 200 rpm. Mu.l of 50mg/ml Kan (vector harboring resistance), 1. Mu.l of 50mg/ml Rif (Agrobacterium harboring resistance) were added to the medium;
(3) The product was added to 25ml of LB liquid medium (containing the corresponding antibiotic) and incubated at 28 ℃ for 8h with shaking at 200 rpm. In this case, the OD600 value is approximately 1.0;
(4) Transferring the obtained solution into a centrifuge tube (if bacterial liquid is excessively added for multiple times), centrifuging at 5000rpm for 5min, discarding supernatant, and adding appropriate amount of 10mM MgCl 2 + 10. Mu.M AS +10mM MES resuspension, and suspending the tube bottom sediment with a pipette tip, wherein the OD600 is about 0.8;
(5) Injecting the dip dyeing liquid into the lower surface of healthy tobacco leaves (cotyledons cannot be used) by using an injector, and treating for 2d;
(6) Placing the tobacco leaves subjected to injection treatment and untreated tobacco leaves into GUS staining solution (the staining solution is prepared in Table 12), extracting gas on the surface of plant tissue, fully immersing the staining solution, and standing overnight at 37 ℃;
(7) And (3) decoloring: absorbing the staining solution, washing with deionized water once, adding absolute ethyl alcohol for decoloring for 5-6 h until the negative contrast is white, absorbing the absolute ethyl alcohol, finally adding deionized water to completely immerse the tobacco leaves, and storing at normal temperature. The process needs to be gentle to prevent the blade from breaking.
TABLE 12 GUS staining solution preparation
2.8 transformation of Arabidopsis thaliana by inflorescence Dip staining method
2.8.1 Arabidopsis Disinfection and planting
(1) Placing a small amount of arabidopsis seeds in an Ep tube, and washing with sterile water for 3 times;
(2) Adding 1ml of 75% ethanol, and performing vortex oscillation for 30sec;
(3) Washing with sterile water for 3 times, adding 10% sodium hypochlorite 1ml, and vortex shaking for 30sec;
(4) Washing with sterile water for 5 times;
(5) Uniformly sowing the seeds on an MS solid culture medium (without antibiotics), absorbing excessive moisture, sealing by a sealing film, and marking corresponding serial numbers and dates;
(6) Vernalizing at 4 ℃ for 2d, and then transferring into a tissue culture room for culture;
(7) And 7d, taking the green seedlings, and transferring the green seedlings to culture soil for cultivation.
2.8.2 Arabidopsis transformation
(1) The agrobacterium liquid containing PpGGS1.1-GUS expression vector is added into 25ml LB liquid culture medium (containing corresponding antibiotic), and is shake cultured for about 24h at 28 ℃ and 200 rpm. Centrifuging at 5000rpm for 15min after the bacteria solution is turbid, discarding the supernatant, adding appropriate amount of staining solution (5% sucrose, 0.05% sliwet-77,1/2MS liquid medium) to dilute OD to 0.8;
(2) Watering the arabidopsis plant with a small amount of siliques one day in advance, and cutting the siliques and the opened flowers;
(3) Inversely inserting the inflorescence into the transformation liquid for 10min;
(4) And (4) wrapping the plants and the flower pots with black plastic bags, laterally placing and culturing for 24 hours, and removing the bags for normal culture. Covering the plant inflorescence with paper bag when the siliques turn yellow, fixing with stapler, collecting seeds after the siliques are mature completely, removing impurities, drying at room temperature for 10 days, and storing in refrigerator at 4 deg.C. A portion of the harvested seeds was sterilized and sown on 1/2MS solid medium for selection of the corresponding antibiotic (see 2.8.1 for seed sterilization method). After the sealing film is sealed, the corresponding serial number and date are marked, and the tea is vernalized at 4 ℃ for 2d. Taking out the culture dish, placing in a culture room for normal culture, after 10 days, selecting the seedling with green true leaf and cotyledon, transplanting to a nutrient soil culture room for normal culture;
(5) After the transgenic arabidopsis seedlings are transplanted for one month, mature and healthy leaves are selected to extract total DNA. And performing PCR detection on the PpGS1.1 gene promoter by taking the F1 and the R1 as upstream and downstream primers to determine whether the PpGS1.1 gene promoter is transferred into an arabidopsis plant.
2.9 transgenic Arabidopsis GUS Gene expression detection
2.9.1GUS fluorescent quantitation
The method is carried out according to Jefferson, and the reaction principle is that GUS catalyzes 4-MUG to hydrolyze and dissociate hydroxyl groups in 4-MU, and the fluorescence value of a product generated after the hydroxyl groups in 4-MU molecules are quantified by a fluorescence spectrophotometer.
2.9.2 extraction of GUS protein
Fully grinding plant materials treated in different stress conditions in liquid nitrogen into powder, then filling the powder into an Ep tube sterilized in advance, adding a proper amount of powder into 3 times of GUS extraction buffer solution, fully and uniformly mixing, preparing GUS protein extracting solution shown in Table 13, keeping the amount of the powder taken by each sample as consistent as possible, and facilitating subsequent tests. Centrifuging at 4 deg.C at 10000rpm for 10min, and collecting supernatant to obtain crude extract of total protein. Storing at 4 deg.C for a short period, and storing at-80 deg.C in refrigerator if long-term storage is required.
TABLE 13 GUS protein extract
2.9.3 Drawing of 4-MU standard curve
4-MU mother liquor is treated with 0.2M Na 2 CO 3 Diluting to 2-100 nm gradient liquid for making standard curve. The fluorescence values of 4-MU solutions with different concentrations were measured at an excitation wavelength of 365nm and an emission wavelength of 455 nm. And drawing a 4-MU standard curve by taking different concentrations of 4-MU as abscissa and fluorescence values measured by solutions of 4-MU with different concentrations as ordinate.
2.9.4GUS protein assay
BSA (2 mg/ml) solution was diluted with 0.9% physiological saline to prepare a gradient of 2-20. Mu.g/ml for preparing a calibration curve. Then, 5. Mu.l of each of the diluted BSA solutions with different concentrations, the protein sample to be detected and the blank control (GUS protein extract) was added to the wells of a 96-well plate (each concentration was determined for 3 times), and 200. Mu.l of Coomassie brilliant blue G-250 solution was added. After standing at room temperature for 10min, the absorbance at 595nm was measured with a microplate reader. The results of the measurement at 595nm of BSA solutions of different concentrations were plotted on the ordinate and the BSA solution concentration on the abscissa to prepare a BSA standard curve. And substituting the measurement result at 595nm of each sample into a BSA standard curve formula to calculate the protein concentration of the sample.
2.9.5GUS protease Activity assay
Mu.l of the protein sample to be tested were added to the wells of a 96-well plate (3 replicates for each concentration measurement), 1ml of GUS buffer extract containing 1mM4-MUG was added to each well (pre-heated at 37 ℃ C.), and 200. Mu.l of the protein sample was immediately added to 800. Mu.l of 0.2M Na 2 CO 3 The reaction was stopped by mixing with the sample (blank control) and incubated at 37 ℃. After 10, 30 and 60min, 200. Mu.l of each sample was taken and 800. Mu.l of 0.2M Na was added 2 CO 3 The reaction was stopped by mixing in the sample. And measuring the fluorescence value of each sample after different reaction time lengths, drawing a standard curve according to the fluorescence value, and calculating the protease activity of each sample according to a formula. GUS gene expression activity was expressed as the amount of enzyme producing 1. Mu.M or 1nM 4-MU per mg protein per min in units of 4-MU pmol/min/mg protein or 4-MU nmol/min/mg protein.
2.9.6GUS histochemical test
(1) The transgenic seeds were sterilized and sown on 1/2MS solid medium selected by the corresponding antibiotics (see 2.8.1 for method). After the sealing film is sealed, the corresponding serial number and date are marked, and the tea is vernalized at 4 ℃ for 2d. Taking out the culture dish, placing the culture dish in a culture chamber for normal culture,
(2) Soaking the transgenic arabidopsis seedlings cultured for 6d into GUS staining solution for staining (the GUS staining method is shown as 2.7);
(3) After decolorization, the image is observed under a microscope and photographed.
2.10 transgenic Arabidopsis stress treatment
2.10.1 Nitrogen stress treatment
To investigate the promoter activity of the PpGGS1.1 promoter under nitrogen stress conditions, transgenic Arabidopsis seeds were sterilized and seeded on a 1/2MS solid medium (containing Kan). And marking the corresponding serial number and date after the sealing film is sealed, performing normal culture after vernalization for 2d at 4 ℃, transferring the seedlings to 1/2MS solid culture media (without antibiotics) containing different nitrogen concentrations after 13d, and performing nitrate nitrogen and ammonium nitrogen stress treatment on the seedlings respectively. The treatment and sampling times are shown in table 14. After treatment, plants are collected, wrapped by tinfoil and labeled, and then stored at the temperature of minus 80 ℃ after being quickly frozen by liquid nitrogen, and are used for analyzing the stress activity of the PpGGS1.1 promoter.
TABLE 14 Nitrogen treatment
3 results and analysis
3.1 extraction of Total DNA of Poa pratensis
The electrophoresis result of the Poa pratensis genome DNA is shown in FIG. 1, and the bands are clear and have no obvious dispersion and tailing, which indicates that the Poa pratensis genome DNA has better quality. Detecting the absorbance OD260 on an ultraviolet spectrophotometer: the OD280 ratios are all around 1.8, which indicates that the mass is pure and can meet the basic requirements of subsequent tests. The concentration is between 100 ng/mul and 200 ng/mul, the label is marked and the date is recorded after the concentration is uniformly diluted to 100 ng/mul, and the mixture is placed in a refrigerator at the temperature of minus 20 ℃ for standby.
3.2 cloning and sequence analysis of the promoter
3.2.1 cloning of promoter sequences
In the test, SP1, SP2 and SP3 are used as downstream primers, a degenerate primer AP1 provided in a genome Walking Kit (Takara, beijing) is used as an upstream primer, a Poa pratensis genome DNA is used as a template, and 3 rounds of PCR are carried out to finally obtain a PpGS1.1 gene promoter sequence. Then, a primer SP4 is designed according to the sequence, 4-round PCR is carried out, and a target band is recovered by glue and is connected to a T carrier for sequencing. Finally, a PpGGS1.1 gene promoter fragment (shown in figure 2) is obtained.
3.2.2 restriction site selection
The PpGGS1.1 gene promoter sequence obtained by the chromosome walking technology is put into a NEBbutter 2.0 website for enzyme cutting site analysis (as shown in figure 3), multiple cloning sites at two ends of a CaMV35S promoter on a pBI121 expression vector are synthesized, and Hind III (AAGCTT) is selected as an upstream enzyme cutting site, and Sma I (CCCGGGG) is selected as a downstream enzyme cutting site. Is used for connecting the target segment with an expression vector.
3.2.3 full Length amplification of promoter
According to the sequencing result of the sequence obtained by the 4 th round of PCR, specific primers (F1 and R1) are designed through Primer preimer5.0 software, and corresponding enzyme cutting sites are respectively connected to the two ends of the upstream Primer and the downstream Primer. And performing conventional PCR amplification by using the genomic DNA of the Poa pratensis as a template. Finally, the promoter sequence of PpGGS1.1 with the size of 1511bp is obtained (as shown in FIG. 4).
3.3 expression vector construction
The cloning vector containing the PpGS1.1 gene promoter and the expression vector pBI121 were digested simultaneously with HindIII and SmaI, respectively (FIG. 5), and the two target fragments were subjected to T 4 Ligation was performed to replace the CaMV35S promoter of the expression vector itself with the PpGGS1.1 gene promoter (FIG. 6). Finally, obtaining a plant expression vector fused by the PpGGS1.1 gene promoter and the GUS gene, and naming the plant expression vector as PpGGS1.1-GUS.
3.4 transient Dip-dyeing of tobacco
To determine whether the promoter of the Poa pratensis PpGGS1.1 gene can drive GUS gene expression, an agrobacteria-mediated tobacco transient transformation system was used, and a dip-dye solution containing the PpGGS1.1-GUS expression vector was injected into the lower epidermis of healthy leaves of tobacco by a syringe, cultured for 2 days, and then subjected to tissue chemical staining, photographed and stored. The results are shown in the figure (fig. 7), and the leaves after the ppgs1.1 gene promoter fusion vector is impregnated show obvious blue spots (circled parts and arrow parts in the figure), which indicates that the ppgs1.1 gene promoter has transcriptional activity in tobacco leaves.
3.5 acquisition and validation of transgenic plants
3.5.1 obtaining transgenic plants
In order to explore the transcriptional activity of the promoter of the Poa pratensis PpGGS1.1 gene in transgenic plants, an expression vector containing PpGGS1.1-GUS was transformed into Arabidopsis thaliana. The harvested seeds were screened for primary resistant plants (FIG. 8).
3.5.2 validation of transgenic plants
The 1809bp GUS gene sequence was obtained using the transgenic shoot DNA as a template, while no band was obtained from the wild type DNA, indicating that the transformation of the plant expression vector containing PpGGS1.1-GUS was successful (FIG. 9A). The promoter sequence of the 1511bp PpGGS1.1 gene was obtained by using the transgenic seedling DNA as a template, and no band was obtained from the wild-type DNA, further indicating the success of the transformation of the plant expression vector containing PpGGS1.1-GUS (FIG. 9B). The transgenic arabidopsis plants were preliminarily verified.
3.6PpGS1.1 gene promoter tissue expression analysis
GUS histochemical staining results are shown in FIG. 10, GUS expression is obvious in the stem (FIG. 10A); expression was not uniform in roots, root apical meristematic region expression was significant (fig. 10B); expression was evident in the relatively mature leaves but not in the young cotyledons (FIG. 10C). The promoter of the Poa pratensis PpGGS1.1 gene has transcriptional activity in the whole Arabidopsis thaliana and has different spatio-temporal characteristics.
3.7 promoter function analysis
3.7.1 preparation of protein Standard Curve
The protein standard curve is shown in FIG. 11. The linear relationship was good between 2 and 20. Mu.g/ml (R2 = 0.9925). Equation is y =0.0236x +0.0124. And (4) carrying out an equation according to the light absorption value of the measured sample so as to calculate the protein concentration of the sample.
3.7.2 preparation of fluorescence Standard Curve
The fluorescence standard curve is shown in FIG. 12. The linear relationship was good between 2 and 100nm (R2 = 0.9993). The equation is y =0.0168x-0.011. And substituting the equation according to the fluorescence value of the measured sample so as to calculate the GUS expression quantity of the sample.
3.7.3 Effect of Nitrogen treatment on promoter Activity
To verify whether the promoter responds to exogenous nitrogen based on the predicted result for the cis-element in the promoter of Poa pratensis PpGGS1.1, transgenic Arabidopsis T3 seeds were sterilized and sown on 1/2MS solid medium (containing Kan), after 13d (FIG. 13) seedlings were transferred to 1/2MS solid medium (containing no antibiotics) containing 0mM, 1.5mM, 15mM, 30mM nitrate nitrogen and ammonium nitrogen, respectively, and GUS enzyme activity was measured after 2d greenhouse culture. The results show that: GUS activity increased with increasing nitrogen concentration. The GUS activity of PpGGS1.1 promoter containing 15mM nitrate nitrogen was 1.48 times higher than that of the control, and the activity of PpGGS1.1 promoter containing 30mM nitrate nitrogen was 1.85 times higher than that of the control (FIG. 14 a). The GUS activity of the ppgs1.1 promoter was 1.84 times higher than the control for 1.5mM ammonium nitrogen and 4.18 times higher for 30mM ammonium nitrogen (fig. 14 b). In conclusion, ammonium nitrogen has a greater influence on the activity of the ppgs1.1 promoter. These results demonstrate that nitrogen can induce the activity of the ppgs1.1 promoter.
Sequence listing
<110> northeast university of agriculture
<120> cloning and application of promoter of grass land early-maturing glutamine synthetase gene PpGGS1.1
<160> 1
<210> 1
<211> 1511
<212> DNA
<213> Poa pratensis L.
tccgattagt attgccgtga tcaaccttct acggatctag agagcgactc aatcgagtca 60
gccgcctaag attttcgtgt cgagggctac aagatataga gaggttcgcg gcacggtgga 120
atcctccttg taccccttct aaactcccaa accgagtccc gatcgatcgg gaaaaccagt 180
cacacatacg aaaggatgtc ctgacccagc gatcgatcgg ggataggaca cgacgtacga 240
aaccaaacca agaaacgcta gcgacgtatg acgtaccaca cacagacgaa ggaagaaaca 300
ctactcgtat tatatagtaa agattatttt tccttctttt cttgtaattt tttttatttt 360
gaatacccat tgacaagatg ctaggcccgc ccctgcgcat gcatgcaccg aatgcacggg 420
ctgcacattg ggtcacgtgt gcgctgacgg tgcaccgaat cacgcctcag cttttttccc 480
tgaaccgaca aaatctccac agcttttcgg tcctgttccg taccaagaaa cgtgcgctcc 540
acaccgagta gtagtttctc tcctcctgac tctccggttg tatacaaatc tttactggtc 600
tcgcgcatgg agctgcaatc ttgatcgtaa tcaacaattt gtatcattta tgaactccta 660
atcaaagcat tgtagttttg gtaggagaag atccctggcc tggactggcc gcgtgaagat 720
tccaggaatc tgcactccat gctggctggc gcatgaaaaa gcaggcagca tgggtgtggc 780
cagcattatt gatcgaatac gattaataaa taaatccagc gagttttcaa atcaatcaat 840
ttattccgct tcggagtcct ctggaaaagc ggatttaccc ctatgctcgg aactcataat 900
aaaatcggcg gagaaagctg ccgtccgcga gctcttcctc tcaacaaacc gcttcaaact 960
ttgttccagc cctctcactg acagcgggtc ccttcttcgt ccggccccgc ttgtcatcgt 1020
gaaaggcagc agagggttgg tgatcgagcc gcagcgtcag cgcgcggtgc acctaccccc 1080
ggtgcgtcga tctcatcaaa cagcccgaaa tattttatcc ccggaactaa ctaaagccac 1140
gtcaccgcgt agatacacca agagaatccc aataataatt atcatttcat taacaaaaag 1200
gaagaagtag tatatacata tacggtacat cgtttttttt ttgcaaccat atacggtaca 1260
tcggttcgaa atcgaaaaga ttcggacgta tagcggcggt gatgtacacg gatacgttat 1320
tattttctga actgtttgta cacggatacg tacggctcgc acgaggccaa caacttgctt 1380
cctcctagct ctggtcgact cgacgcggtt atatagccgc cctcccgatc tcaccttggc 1440
ctcgcaccag cacaaccccc ttccccttgc ctaccacccc ctgctcgctc cctcagtcct 1500
cccacgccat g 1511
<210> 2
<211> 1584
<212> DNA
<213> Poa pratensis L.
cccaagcttt ccgattagta ttgccgtgat caaccttcta cggatctaga gagcgactca 60
atcgagtcag ccgcctaaga ttttcgtgtc gagggctaca agatatagag aggttcgcgg 120
cacggtggaa tcctccttgt accccttcta aactcccaaa ccgagtcccg atcgatcggg 180
aaaaccagtc acacatacga aaggatgtcc tgacccagcg atcgatcggg gataggacac 240
gacgtacgaa accaaaccaa gaaacgctag cgacgtatga cgtaccacac acagacgaag 300
gaagaaacac tactcgtatt atatagtaaa gattattttt ccttcttttc ttgtaatttt 360
ttttattttg aatacccatt gacaagatgc taggcccgcc cctgcgcatg catgcaccga 420
atgcacgggc tgcacattgg gtcacgtgtg cgctgacggt gcaccgaatc acgcctcagc 480
ttttttccct gaaccgacaa aatctccaca gcttttcggt cctgttccgt accaagaaac 540
gtgcgctcca caccgagtag tagtttctct cctcctgact ctccggttgt atacaaatct 600
ttactggtct cgcgcatgga gctgcaatct tgatcgtaat caacaatttg tatcatttat 660
gaactcctaa tcaaagcatt gtagttttgg taggagaaga tccctggcct ggactggccg 720
cgtgaagatt ccaggaatct gcactccatg ctggctggcg catgaaaaag caggcagcat 780
gggtgtggcc agcattattg atcgaatacg attaataaat aaatccagcg agttttcaaa 840
tcaatcaatt tattccgctt cggagtcctc tggaaaagcg gatttacccc tatgctcgga 900
actcataata aaatcggcgg agaaagctgc cgtccgcgag ctcttcctct caacaaaccg 960
cttcaaactt tgttccagcc ctctcactga cagcgggtcc cttcttcgtc cggccccgct 1020
tgtcatcgtg aaaggcagca gagggttggt gatcgagccg cagcgtcagc gcgcggtgca 1080
cctacccccg gtgcgtcgat ctcatcaaac agcccgaaat attttatccc cggaactaac 1140
taaagccacg tcaccgcgta gatacaccaa gagaatccca ataataatta tcatttcatt 1200
aacaaaaagg aagaagtagt atatacatat acggtacatc gttttttttt tgcaaccata 1260
tacggtacat cggttcgaaa tcgaaaagat tcggacgtat agcggcggtg atgtacacgg 1320
atacgttatt attttctgaa ctgtttgtac acggatacgt acggctcgca cgaggccaac 1380
aacttgcttc ctcctagctc tggtcgactc gacgcggtta tatagccgcc ctcccgatct 1440
caccttggcc tcgcaccagc acaaccccct tccccttgcc taccaccccc tgctcgctcc 1500
ctcagtcctc ccacgccatg gcgctcctca ccgatcttct caacctcgaa ctctccgaaa 1560
ccaccgagaa gatcacccgg ggga 1584
<210>3
<211>23
<212> DNA
<213> Artificial sequence
<220>
<223> SP1。
<400> 3
GCGGCCATGACAAGAATAAGAAG 23
<210>4
<211>22
<212> DNA
<213> Artificial sequence
<220>
<223> SP2。
<400> 4
GCGATGATCTTCTCGGTGGTGT 22
<210>5
<211>22
<212> DNA
<213> Artificial sequence
<220>
<223> SP3。
<400> 5
AGATCGGTGAGGAGCGCCATAA 22
<210>6
<211>23
<212> DNA
<213> Artificial sequence
<220>
<223> SP4。
<400> 6
TCGAACCGATGTACCGTATATGG 23
<210>7
<211>30
<212> DNA
<213> Artificial sequence
<220>
<223> F1。
<400> 7
<210>8
<211>29
<212> DNA
<213> Artificial sequence
<220>
<223> F1。
<400> 8
TCCCCCGGGTGATCTTCTCGGTGGTGTCG 29
Claims (9)
1. Grass land annual bluegrass glutamine synthetasePpGS1.1A gene promoter characterized by: saidPpGS1.1The nucleotide sequence of the gene promoter fragment is shown as SEQ ID NO. 1; saidPpGS1.1The gene promoter is obviously expressed in the stem, the root tip meristematic region and the relatively mature leaf of the arabidopsis thaliana; non-uniform expression in the root; the expression is not significant in young cotyledons; saidPpGS1.1The gene promoter possesses transcriptional activity in tobacco leaves.
2. Obtaining a grass-bluegrass glutamine synthetase of claim 1PpGS1.1The primer of the gene promoter fragment is characterized in that the primer sequence is as follows:
SP1：5'GCGGCCATGACAAGAATAAGAAG3'；
SP2：5'GCGATGATCTTCTCGGTGGTGT3'；
SP3：5'AGATCGGTGAGGAGCGCCATAA3'；
SP4：5'TCGAACCGATGTACCGTATATGG3'。
3. a kit comprising the primer of claim 2.
4. Cloning of an early-maturing glutamine synthetase using the primers according to claim 2PpGS1.1A method for producing a gene promoter fragment, which is carried out in the following manner:
firstly, extracting genome DNA of the meadow bluegrass;
step two, using the genomic DNA of Poa pratensis as a template, carrying out PCR amplification by using the primer of claim 2, carrying out agarose gel electrophoresis, and recovering the PCR product to obtain the targetPpGS1.1A gene promoter fragment.
5. The cloned Poa annua glutamine synthetase according to claim 4PpGS1.1The method for gene promoter fragment is characterized in that the PCR amplification is completed by four rounds of PCR amplification, and specifically comprises the following steps:
first round PCR amplification: using genome DNA of Poa pratensis as a template, and adopting degenerate primers and SP1 as primers to amplify;
second round PCR amplification: taking a first round of PCR amplification product as a template, and adopting degenerate primers and SP2 as primers for amplification;
third round of PCR amplification: taking a second round PCR amplification product diluted by 100 times as a template, and adopting degenerate primers and SP3 as primers for amplification;
fourth PCR amplification: taking a third PCR amplification product diluted by 100 times as a template, and carrying out amplification by adopting a degenerate primer and SP4 as primers.
6. Cloned early-maturing glutamine synthetase according to claim 4 or 5PpGS1.1Method for producing a gene promoter fragment, characterized in thatIn this way, the first and second electrodes can be brought into contact with each other,
the PCR amplification is completed by four rounds of PCR amplification, wherein the PCR amplification system of the first round is as follows:
the first round of PCR amplification conditions were as follows:
the second round of PCR amplification system was as follows:
the second round of PCR amplification conditions were as follows:
the third round of PCR amplification system was as follows:
the third round of PCR amplification conditions were as follows:
the fourth round of PCR amplification was as follows:
the fourth round of PCR amplification conditions were as follows:
7. cloning of a meadow precocious glutamine synthetase containing HindIII and SmaI cleavage sitesPpGS1.1The primer of the gene promoter is characterized in that the primer sequence is as follows:
F1：5'CCCAAGCTTTCCGATTAGTATTGCCGTGAT3'；
R1：5'TCCCCCGGGTGATCTTCTCGGTGGTGTCG3'。
8. HindIII and SmaI cleavage sites obtained using the primers of claim 7PpGS1.1A gene promoter characterized by: saidPpGS1.1The nucleotide sequence of the gene promoter is shown as SEQ ID NO. 2.
9. Cloning of a Poa annua glutamine synthetase containing HindIII and SmaI cleavage sites using the primers of claim 7PpGS1.1A method for producing a gene promoter, which comprises:
PCR amplification using the genomic DNA of Poa pratensis as a template with the primers of claim 7, agarose gel electrophoresis, and recovering 1511bp PCR productPpGS1.1A gene promoter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210576013.8A CN114736903B (en) | 2022-05-24 | 2022-05-24 | Cloning and application of promoter of grass land early-maturing glutamine synthetase gene PpGGS1.1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210576013.8A CN114736903B (en) | 2022-05-24 | 2022-05-24 | Cloning and application of promoter of grass land early-maturing glutamine synthetase gene PpGGS1.1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114736903A CN114736903A (en) | 2022-07-12 |
| CN114736903B true CN114736903B (en) | 2023-01-13 |
Family
ID=82287743
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210576013.8A Active CN114736903B (en) | 2022-05-24 | 2022-05-24 | Cloning and application of promoter of grass land early-maturing glutamine synthetase gene PpGGS1.1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114736903B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107904235A (en) * | 2017-12-20 | 2018-04-13 | 东北农业大学 | A kind of method for cloning English grass glutamine synthelase PpGS1 genes |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140228223A1 (en) * | 2010-05-10 | 2014-08-14 | Andreas Gnirke | High throughput paired-end sequencing of large-insert clone libraries |
-
2022
- 2022-05-24 CN CN202210576013.8A patent/CN114736903B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107904235A (en) * | 2017-12-20 | 2018-04-13 | 东北农业大学 | A kind of method for cloning English grass glutamine synthelase PpGS1 genes |
Non-Patent Citations (2)
| Title |
|---|
| 紫花苜蓿MsNAP启动子克隆及转基因分析;穆致远等;《分子植物育种》;20180423(第20期);全文 * |
| 草地早熟禾PpGA2ox基因启动子的克隆及功能分析;檀鹏辉等;《中国草地学报》;20180125;第40卷(第01期);摘要、第2页及表1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114736903A (en) | 2022-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7982093B2 (en) | Promoter sequence obtained from rice and methods of use | |
| EP0584324B1 (en) | Expression cassette and plasmids for a guard cell specific expression and their use for the introduction of transgenic plant cells and plants | |
| CN101516180A (en) | Early-maturing transformed plant | |
| CN110878304A (en) | Application of soybean seed specific promoter | |
| CN114736903B (en) | Cloning and application of promoter of grass land early-maturing glutamine synthetase gene PpGGS1.1 | |
| CN105018520B (en) | The plant expression vector and application thereof of 4 pairs of cotton DELLA protein gene GhGAIs expression of regulation and control | |
| CN115725615B (en) | Upland cotton GhABC1K14-A09 gene and application thereof in drought resistance and salt tolerance of upland cotton | |
| CN100413965C (en) | Phosphorus starvation induced gene promoter and its application | |
| CN102242119A (en) | Rice root-specific promoter Os03g01700 and application thereof | |
| CN115043919A (en) | Application of cotton sucrose transporter gene GhSUT6 in improving salt tolerance of plants | |
| CN112301046A (en) | Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof | |
| CN107164373B (en) | Soybean low-temperature induction artificial synthesis promoter SP5 and application thereof | |
| KR100862599B1 (en) | Promoter for the high level expression in plant-cell culture and vector using the same | |
| CN101270355B (en) | Method for accelerating vegetation in low-nitrogen condition | |
| CN103966220A (en) | Synthetic root-specific promoter and application thereof | |
| CN104560987B (en) | Root-specific promoter GmTIPp 2504 and its application from soybean | |
| CN117535312B (en) | Application of vacuole membrane anion channel protein in regulation and control of carbon-nitrogen balance of corn | |
| Wang et al. | Molecular functional characterisation of MechlPPDK promoter in transgenic tobacco | |
| KR101820925B1 (en) | Root tissue-specific promoter | |
| CN117024538A (en) | Corn lodging-resistant gene and application of related protein and biological material thereof | |
| CN117567576A (en) | NAR2.1 protein variants and uses thereof | |
| CN112608920A (en) | Tribulus medicago conglutin gene Mt1g072600 promoter PMt1g072600 and application thereof | |
| CN104560990B (en) | Root-specific promoter GmTIPp-1201 originated from glycine max(l.)merr. and application thereof | |
| CN117721120A (en) | Corn gene ZmPHT1, 11 and application thereof in breeding against low-phosphorus stress | |
| CN116023452A (en) | Application of rice gene OsROHAN in improving plant ammonium-toxicity resistance and nitrogen utilization efficiency |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |