CN115043919A - Application of cotton sucrose transporter gene GhSUT6 in improving salt tolerance of plants - Google Patents

Abstract

The invention provides application of a cotton sucrose transporter gene GhSUT6 in improving salt tolerance of plants, and relates to the technical field of plant molecular biology. The experimental research of the invention finds that the sucrose transporter gene GhSUT6 is activated and expressed when the sucrose transporter gene GhSUT6 is under salt stress. In addition, yeast function complementation experiments show that the GhSUT6 can transport sucrose, and further researches on the functions of the Arabidopsis thaliana show that the Arabidopsis thaliana over-expressing GhSUT6 has enhanced salt tolerance and the Arabidopsis thaliana over-expressing GhSUT6 can promote the absorption of sucrose, increase the accumulation of sucrose, has stronger tolerance to NaCl stress and improves the salt tolerance of plants. The invention provides a new way for regulating and controlling the capability of a target plant to respond to salt stress and provides a new method for cultivating a plant variety with high salt tolerance.

Description

Application of cotton sucrose transporter gene GhSUT6 in improving salt tolerance of plants

Technical Field

The invention relates to the technical field of plant molecular biology, in particular to application of a cotton sucrose transporter gene GhSUT6 in improving the salt tolerance of plants.

Background

Cotton is a main raw crop in the textile industry, and has important social significance for production and life in the world. The cotton is also a pioneer crop planted in a salinized land, and the cotton can be widely planted in the salinized land which is not suitable for grain crop growth, so the cotton has a larger development prospect in agricultural production (like tree, 2013). However, cotton belongs to moderately salt-tolerant crops, and when the salt content in soil is too high, the growth and development of seedlings are limited, thereby affecting the yield and quality of cotton fibers (Ma W et al, 2020; Feng J et al, 2021).

The plant sucrose transporter gene can participate in the sugar metabolism process of the plant body and influence the growth and development of the plant. Changes in sucrose content can alter the osmotic potential of cells and affect the stimulation of abiotic stress in plants, including high salinity, drought, low temperature, high temperature, etc. (Sami F et al, 2016). The sucrose transporter gene is capable of increasing sucrose accumulation in a plant cell in response to abiotic stress stimuli, particularly in response to salt stress stimuli. Sucrose substances have little polar charge, high solubility and thick hydration layer on the surface of molecules, so that the swelling pressure of cells can be maintained, the active structure of enzyme molecules in cytoplasm can be stabilized, the enzyme molecules are protected from being damaged by salt ions, and the tolerance of plants to salt stress is enhanced (Yang Hui et al, 2006). Salt stress can promote the accumulation of biomacromolecules such as sugars in plant cells (Zou H et al, 2020), which act as osmolytes and prevent water loss from the cells by reducing the osmotic and water potentials of the cells, thereby enhancing the resistance of plants to salt stress (Zhao C et al, 2020). Salt tolerant plants are primarily responsible for the defense against salt stress injury from regulating osmotic balance, maintaining ion homeostasis, scavenging ROS accumulation, and regulating nutrient absorption (Liu C et al, 2022).

Recent studies have shown that sucrose accumulation in plant cells can enhance plant salt tolerance by reducing cell osmotic potential, reducing the outflow of cellular water. The accumulation of sucrose in plants is mainly transported by sucrose transporters, which can participate in the regulation of salt stress reactions in plants. Currently, studies of sucrose transporter (SUT) in a number of species such as arabidopsis thaliana (Jia W et al, 2015), sweet potato (Wang D et al, 2020), potato (chincinka I a et al, 2008), apple (Ma Q et al, 2019) indicate that sucrose transporter can enhance the tolerance of plant bodies to salt stress, but studies in cotton are not yet clear.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide application of a cotton sucrose transporter gene GhSUT6 in improving salt tolerance of plants, and provides a new way for regulating and controlling the ability of target plants to respond to salt stress.

The technical scheme provided by the invention is as follows:

in one aspect, the invention provides application of a cotton sucrose transporter gene GhSUT6 in improving salt tolerance of plants, wherein the cotton sucrose transporter gene GhSUT6 is GhSUT 6D.

The research of the invention finds that the expression level of the GhSUT6A/D gene is the highest under the salt stress in 9 pairs of GhSUT genes of upland cotton compared with other GhSUT genes, which indicates that the GhSUT6A/D has the strongest capability of responding to the salt stress. Analysis of the expression of GhSUT6A/D under salt stress shows that the expression levels of GhSUT6A and GhSUT6D are gradually increased when the salt treatment concentration is gradually increased. The verification of a subcellular localization experiment, a yeast function complementation experiment and a yeast fluorescence experiment proves that the sucrose transportproteins GhSUT6A and GhSUT6D are transmembrane proteins which are positioned on a cell membrane and have the function of transporting sucrose.

Response analysis of the Arabidopsis thaliana with overexpression GhSUT6A/D to salt stress shows that the Arabidopsis thaliana with overexpression GhSUT6D can enhance the tolerance of the salt stress. In addition, the salt tolerance analysis of cotton over-expressing GhSUT6D shows that the cotton over-expressing GhSUT6D has less water loss and is relatively less stressed by NaCl, and the MDA content of cotton leaves is obviously lower than that of a wild type, which indicates that the cotton over-expressing GhSUT6D is relatively less damaged by salt stress. Therefore, the sucrose transporter gene GhSUT6D can be used for improving the salt tolerance of plants and enhancing the capability of plants to respond to salt stress.

In the present invention, the coding region (CDS) sequence of the GhSUT6D (SEQ ID NO: Gh-D05G2381.1) gene can be downloaded from Cotton genome database Cotton FGD (https:// cottonfgd. org /).

In another aspect, the invention provides a biological material containing the cotton sucrose transporter gene GhSUT6 or application of a protein encoding the GhSUT6 gene in improving salt tolerance of plants.

In one embodiment, the biological material comprises an expression cassette, a vector, or a transgenic cell line.

In one embodiment, the use comprises up-regulating the expression of the GhSUT6 gene (GhSUT6D) in a plant of interest to increase plant salt tolerance. The salt tolerance of the plant can be improved by increasing the expression level of the GhSUT6D gene.

In one embodiment, the plant is a dicot or monocot; the dicotyledonous plants comprise one or more of cotton, arabidopsis thaliana and tobacco; the monocotyledon comprises one or more of rice, corn and wheat;

preferably, the plant comprises arabidopsis and/or cotton.

The research of the invention shows that the root length, fresh weight and dry weight of Arabidopsis thaliana with overexpression of GhSUT6D are obviously higher than those of wild Arabidopsis thaliana under NaCl treatment. The over-expression of GhSUT6D can enhance the tolerance of plants to salt stress. The arabidopsis thaliana over-expressing the GhSUT6D has higher sucrose absorption capacity than the wild type. The sucrose content of Arabidopsis thaliana over expressing GhSUT6D is significantly higher than that of wild Arabidopsis thaliana. The overexpression of GhSUT6D Arabidopsis improves the transport rate of sucrose, promotes the accumulation of sucrose, and further enhances the salt stress resistance of plants. The over-expression of GhSUT6D can improve the sucrose absorption capacity of cotton roots. The sucrose content in the over-expressed cotton roots was significantly higher compared to wild-type cotton. The water loss of the over-expressed cotton is less, and the NaCl stress is relatively small.

In one embodiment, the use comprises enhancing the resistance of a plant to salt stress by increasing the rate of sucrose transport and/or promoting sucrose accumulation in a plant of interest.

In another aspect, the present invention provides a method for breeding a transgenic plant with improved salt tolerance, which comprises increasing the activity of GhSUT6D protein or the expression level of GhSUT6D gene in a plant of interest to obtain a transgenic plant with improved salt tolerance.

In one embodiment, the method comprises introducing the cotton sucrose transporter gene GhSUT6D into a plant of interest to obtain a transgenic plant with improved salt tolerance.

In one embodiment, the method comprises agrobacterium-mediated transformation of a plant expression vector comprising the GhSUT6D gene into a plant.

In one embodiment, the plant expression vector drives overexpression of the GhSUT6D gene by a constitutive or inducible promoter.

Specifically, (1) GhSUT6D gene is operably linked to plant vector to form recombinant vector; (2) transferring the recombinant vector into a plant cell; (3) screening to obtain transformed cells, and then culturing the transformed cells into transgenic salt-tolerant plants and progeny thereof, wherein the progeny comprises plant seeds and plant tissues.

In addition, transcriptome (RNA-seq) analysis is carried out on roots of wild type upland cotton HM-1 and roots of cotton over-expressing GhSUT6D, and the results show that the up-regulated genes are mainly enriched in cellular processes such as biosynthesis and metabolism of glucan and other polysaccharides, and the like, which indicates that the over-expression of GhSUT6D can influence sugar changes in cotton. KEGG analysis is carried out on the up-regulated differentially expressed genes, and the result shows that the up-regulated genes are obviously enriched on a tricarboxylic acid (TCA) circulation path. The result shows that the overexpression of the GhSUT6D gene can influence the metabolism and transportation of sugar in plants. In conclusion, cotton over-expressing GhSUT6D can affect the metabolic pathway of sugar in plants, activate TCA cycle pathway and participate in the life activities of plants. The over-expression GhSUT6D can induce the expression of the genes related to the redox homeostasis in cotton roots, promote the biosynthesis of phenylpropane, participate in the phenylpropane metabolic pathway and enhance the salt tolerance of plants. Salt stress promotes the expression of salt-tolerant genes in over-expressed cotton roots, particularly promotes cell Na ⁺ 、K ⁺ High expression of transport related gene and maintenance of Na in cell ⁺ 、K ⁺ And (4) steady state balance, so that the salt tolerance of the over-expressed cotton is enhanced. The cotton over-expressing GhSUT6D can cause Na after being stressed by salt ⁺ 、K ⁺ Abundant expression of transport-associated genes; na in roots, stems and leaves of cotton OE1 strain after NaCl treatment ⁺ Relative decrease in accumulation, K in root ⁺ The accumulation is relatively increased, thereby further reducing the root, stem and root,Na in leaves ⁺ /K ⁺ Ratio, thereby reducing Na exposure to the cell ⁺ Toxic and side effects.

In conclusion, the GhSUT6D gene can be regulated to regulate the salt tolerance of plants and cultivate salt tolerant plants.

Has the advantages that:

according to the application provided by the invention, the salt tolerance of the plant can be effectively improved by over-expressing the GhSUT6D gene, so that the yield of the plant in saline-alkali soil is improved, and a target gene and theoretical support are provided for improving the environmental adaptability of cotton by molecules and improving the yield of the cotton.

The method for regulating and controlling the salt stress tolerance of the plant comprises the step of regulating and controlling the expression level of the GhSUT6D gene in the plant, so that the phenotype of the plant can be regulated and controlled more accurately, and the regulation and control efficiency is high. The invention provides a new way for regulating and controlling the capability of a target plant to respond to salt stress, and has wide application space and market prospect in the agricultural field.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows the absorption of Esculin by saline-treated Gossypium hirsutum roots (A is the fluorescence intensity of roots observed by confocal laser microscopy in Gossypium hirsutum roots without NaCl treatment and with 200mM NaCl treatment, scale bar 100 μm; B is the mean fluorescence intensity calculated for Image J, Average optical density IntDen/Area, three biological replicates per sample);

FIG. 2 shows gas chromatography-mass spectrometry (GC-MS) for determining the sucrose content in Gossypium hirsutum roots treated with 0mM NaCl (Mock) and 200mM NaCl for 1h, 3h, 6h, and 12h, respectively, three biological replicates per sample, and t-test significance, where P is < 0.01;

FIG. 3 is the evolution analysis and expression analysis of the Gossypium hirsutum GhSUT gene (A is the evolution analysis of AtSUC9 and GhSUT gene; B is the expression level of the GhSUT gene in cotton roots after 12h treatment with 200mM NaCl);

FIG. 4 is an analysis of expression patterns of GhSUT6A and GhSUT6D (A and B are expression patterns of GhSUT6A and GhSUT6D in cotton roots treated with 200mM NaCl for 1h, 3h, 6h, 12 h; C and D are expression patterns of GhSUT6A and GhSUT6D in cotton roots treated with 0mM NaCl, 50mM NaCl, 100mM NaCl, 150mM NaCl, 200mM NaCl for 6 h);

FIG. 5 is a schematic diagram of the overexpression vectors for GhSUT6A and GhSUT 6D;

FIG. 6 shows the subcellular localization of GhSUT6A/D (A is the subcellular localization of GhSUT6A/D in tobacco epidermal cells; B is the subcellular localization of GhSUT6A/D in Arabidopsis protoplasts);

FIG. 7 shows the sucrose transport activity of GhSUT6A/D (wherein SUSY7/ura3 is a sucrose transport-deficient yeast mutant strain; pDR196 as a negative control, and AtSUC2 and AtSUC4 as positive controls);

FIG. 8 shows the sucrose uptake capacity of GhSUT6A/D (wherein pDR196 and AtSUC4 serve as negative controls; AtSUC2 serves as a positive control);

FIG. 9 is an analysis of the expression of GhSUT6A and GhSUT6D in over-expressed Arabidopsis (where A and B are semiquantitative and fluorometric of GhSUT6A in wild-type and over-expressed Arabidopsis; C and D are semiquantitative and fluorometric of GhSUT6D in wild-type and over-expressed Arabidopsis; AtUBQ5 as an internal reference gene);

FIG. 10 is a phenotypic analysis of Arabidopsis thaliana overexpressing GhSUT6A/D under 100mM NaCl stress;

FIG. 11 shows sucrose absorption capacity and sucrose content change of Arabidopsis thaliana over-expressed by GhSUT6D (wherein A is fluorescence intensity observed under a laser confocal microscope when wild Arabidopsis thaliana and over-expressed Arabidopsis thaliana are treated by Esculin, B is sucrose content of wild Arabidopsis thaliana and over-expressed Arabidopsis thaliana plants detected by GC-MS technology, and C is root length, fresh weight and dry weight statistics when NaCl is treated or not);

FIG. 12 shows the expression analysis of GhSUT6D in over-expressed cotton (wherein A is semiquantitative analysis and B is real-time quantitative fluorescence analysis; wild type upland cotton HM-1(WT), 3 over-expressed GhSUT6D cotton lines OE1, OE2 and OE 3);

FIG. 13 shows the sucrose absorption and sucrose content detection of over-expressed cotton roots (wherein A is the laser confocal microscope observation of WT and OE1 cotton roots after being treated by ESCulin; B is the detection of sucrose content in WT and OE1 cotton roots by GC-MS technology);

FIG. 14 is the analysis of the salt tolerant phenotype of cotton over-expressing GhSUT6D (wherein A is the phenotype after treatment with 0mM NaCl (Mock) and 200mM NaCl for 3 days; B is the statistics of fresh weight of cotton leaves, each sample is repeated for 12 times; C is the measurement of MDA content of leaves by a microplate reader);

FIG. 15 shows the expression of the salt stress related gene induced by overexpression of GhSUT6D (A is the analysis of the transcription level of the salt tolerance related gene; B is the expression pattern of the salt tolerance gene verified by RT-qPCR);

FIG. 16 is a graph of Na in WT and OE1 cotton under normal conditions and salt stress ⁺ And K ⁺ Content and Na ⁺ /K ⁺ (A is Na in roots, stems and leaves ⁺ Content (c); b is K in root, stem and leaf ⁺ Content (c); c is Na in root, stem and leaf ⁺ /K ⁺ )。

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments, and it should be understood that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

1. Experimental Material

The cotton varieties used in the present invention are: upland cotton "9053" (Gossypium hirsutum, cv 9053) and upland cotton "HM-1" (overexpressed cotton receptor) are commercially available in conventional ways; the T3 generation over-expressed GhSUT6D cotton strain, derived from previous studies of the subject group. The wild type Arabidopsis thaliana used was Columbia wild type (Columbia, WT) and the tobacco was Nicotiana benthamiana (Nicotiana benthamiana), which were commercially available conventionally.

2. Experimental methods

2.1 treatment of Cotton Material

Selecting seedlings of 3 lines of upland cotton 9053, upland cotton HM-1 and T3 generations of over-expressed GhSUT6D cotton with similar sizes, transferring the seedlings into a water culture nutrient solution for growth, and performing NaCl treatment when the seedlings grow to the period of two leaves and one heart. Treatment of upland cotton 9053: respectively adding 50mM, 100mM, 150mM and 200mM NaCl into 10L of water culture nutrient solution, taking a 0mM NaCl treatment group as a control, respectively taking roots, stems and true leaves of the water culture nutrient solution when the water culture nutrient solution is treated for 1 hour, 3 hours, 6 hours and 12 hours, quickly freezing the plant sample by using liquid nitrogen, and storing the plant sample in a refrigerator at the temperature of minus 80 ℃, wherein cotton root tissues are used for subsequent sucrose content determination and fluorescence quantitative experiments. At least 3 plants were taken for each treatment. Treatment of upland cotton HM-1 and cotton overexpressing GhSUT 6D: 200mM NaCl is added into 10L of water culture nutrient solution respectively, and when the water culture nutrient solution is treated for 6 hours, roots, stems and true leaves of the water culture nutrient solution are taken respectively, and the water culture nutrient solution is treated for 6 hours by 0mM NaCl to serve as a parallel control. The plant sample is frozen in liquid nitrogen and stored in a refrigerator at-80 deg.c. The cotton root tissue was used for subsequent sucrose content determination and transcriptome sequencing experiments. At least 3 plants were taken for each treatment.

2.2 extraction of RNA from various tissues of Cotton

RNA of each tissue of the Plant was extracted using the EASYspin plus complete Plant Kit of Edley Bio Inc., and the specific experimental procedures were performed according to the instructions of the Kit, and the extracted RNA was stored in a refrigerator at-80 ℃.

2.3 real-time fluorescent quantitation (RT-qPCR)

Obtaining fluorescent quantitative primers: the method comprises the steps of predicting conserved domains of GhSUT6A and GhSUT6D by using an HMMER online tool, selecting 200bp lengths in non-conserved regions, respectively designing specific primers of GhSUT6A and GhSUT6D genes by using DNAMAN, and detecting the specificity of the primers by using e-PCR, wherein the sequences of the primers are shown in Table 1 and are respectively named as GhSUT6A-qF/R and GhSUT 6D-qF/R.

TABLE 1 GhSUT6A and GhSUT6D specific primers

Reverse transcription synthesis of cDNA template: the sample used was 2.1 pieces of root tissue of Nakayama gossypii 9053 at different times of NaCl treatment at different concentrations. The extraction process of RNA is shown in 2.2,acquisition of template cDNA Using reverse transcription reagent of Novozam

II Q RT Supermix for qPCR (+ gDNA wiper), the specific experimental procedures were performed according to the instructions of the kit.

RT-qPCR reaction: GhHis3 of cotton is used as an internal reference gene, and a ChamQ Universal SYBR qPCR Master Mix reagent is used for preparing a GhSUT6A fluorescent quantitative reaction system and a GhSUT6D fluorescent quantitative reaction system respectively. The real-time fluorescence quantitative reaction program is shown in table 2.

TABLE 2 RT-qPCR reaction procedure

Cloning of the GhSUT6A/D Gene

Obtaining a GhSUT6A/D gene amplification template: extracting total RNA of root, stem and true leaf of upland cotton 9053 (2.2) with reverse transcription reagent of Novozam biology

II 1st Strand cDNASynthesis Kit (+ gDNA wiper) cDNA was obtained and used as a template for gene cloning.

PCR amplification of the GhSUT6A/D gene sequence: CDS sequences of GhSUT6A (SEQ ID NO: Gh _ A05G2131.1) and GhSUT6D (SEQ ID NO: Gh _ D05G2381.1) genes were downloaded from Cotton genome database Cotton FGD (https:// cottonfgd. org /), and primer sequences were designed using DNAMAN software and named GhSUT6-F/GhSUT6-R (the primer sequences of GhSUT6A and GhSUT6D were identical according to gene sequence alignment), as shown in Table 3.

TABLE 3 GhSUT6 Gene cloning primers

Amplification of the target gene: taking the total RNA extracted from the root, stem and leaf of upland cotton as a template,high fidelity enzyme of Takara Bio Inc

GXL, and performing PCR amplification.

TABLE 4 GhSUT6A/D Gene amplification System

And (3) PCR reaction conditions: the reaction system of the above mixture was placed in a PCR apparatus to complete the amplification of the target gene, and the reaction procedure is shown in Table 5.

TABLE 5 PCR reaction procedure

Recovery of the GhSUT6A/D target fragment: and carrying out agarose gel electrophoresis on the PCR product, and cutting a single strip which accords with the PCR product under the irradiation of an ultraviolet lamp of a gel imager to complete the recovery of the PCR product. The specific experimental procedures are described in relation to the general formula of Jinzhi Co

Instructions for the Quick Gel Extraction Kit.

Construction of GhSUT6A/D cloning vector and transformation of recombinant plasmid into Escherichia coli: by using

The Blunt Zero Cloning Kit completes the construction of GhSUT6A and GhSUT6D Cloning vectors, the ligation product is transformed into Trans-T1 escherichia coli competence, and the bacterial liquid is coated on an LB solid medium (containing kanamycin) for growth.

Colony PCR and sequencing verification: and (3) selecting a monoclonal colony growing on the culture medium in the step, inoculating the colony to an LB liquid culture medium (containing kanamycin), shaking the colony at 37 ℃ and 220rpm to culture until the bacterial liquid is turbid, and performing PCR amplification by using 2 XTaq Plus Master Mix enzyme, the bacterial liquid as a template and M13F/R as a primer. The reaction procedure for colony PCR is shown in Table 6. After PCR of the bacterial liquid, the bacterial liquid with the bands meeting expectations is sent to the worker for sequencing, and the bacterial liquid with correct sequencing is stored.

TABLE 6 reaction procedure

Tobacco subcellular localization of GhSUT6A/D

(1) Cloning and purifying a target fragment containing the enzyme cutting site:

and (3) plasmid extraction: and extracting plasmids from the bacterial liquid in the step 2.4 to be used as a template for gene amplification in the experiment.

Obtaining a target gene primer containing a restriction enzyme site: an overexpression vector pCambia2300-eGFP (hereinafter referred to as eGFP) is used, two enzyme cutting sites of BamH I and Sac I are selected, and a primer is designed by using CE Design software to obtain a specific primer sequence containing the enzyme cutting sites, as shown in Table 7. And named GhSUT6-eF 1/R1.

TABLE 7 subcellular localization specific primers for GhSUT6

Amplification of the target gene: using the recombinant plasmid of the GhSUT6A and GhSUT6D cloning vector as a template

GXL high fidelity enzyme is used for amplifying a target gene, and a PCR amplification system and a program are shown in 2.4. And (4) completing product gel recovery of the amplified PCR product, and storing the purified product in a refrigerator at the temperature of-20 ℃.

(2) Enzyme digestion and recovery of the fusion expression vector:

obtaining of vector plasmid: the E.coli liquid of eGFP vector was thawed on ice, added to an Erlenmeyer flask of LB liquid medium (containing kanamycin), shaken overnight at 37 ℃ and 220rpm for 12 hours, and then the plasmid was extracted. Enzyme digestion of the vector: pCambia2300-eGFP vector plasmid was digested with the restriction enzymes BamH I and Sac I from New England Biolabs (NEB) BioInc. Preparing an enzyme digestion system in a 200 mu L PCR centrifuge tube, and placing the enzyme digestion system in a PCR instrument for 3 hours at a constant temperature of 37 ℃. And (4) carrying out electrophoresis and gel recovery on the enzyme digestion product, and storing the recovered eGFP linear vector product in a refrigerator at the temperature of-20 ℃.

(3) Connection and transformation of the GhSUT6A/D gene and a fusion expression vector: cloning kit using homologous recombination

II One Step Cloning Kit (C115), using the mixture of the target gene fragment with the restriction enzyme site obtained in the above Step and the obtained linearized vector fragment to heat in a PCR instrument at 50 ℃ for 5 minutes, and cooling on ice to obtain the ligation product. The ligation product was transformed into E.coli competence.

(4) Sequencing and verifying a recombinant product: and (3) taking an HP158 sequence (TTTCATTTGGAGAGAACACGGGG, SEQ ID No.9) on the eGFP overexpression vector as an upstream primer and GhSUT6-R as a downstream primer, performing colony PCR verification, sequencing correct bacteria liquid, and preserving bacteria.

(5) Transforming agrobacterium with the recombinant plasmid: and (4) sequencing the correct GhSUT6A-eGFP and GhSUT6D-eGFP recombinant vector bacterial liquid in the step (4), extracting plasmids, and transforming the agrobacterium GV3101 (the GV3101 competence of the exclusively-living organism).

(6) Instantaneous transformation of tobacco and confocal observation of laser:

transient transformation of tobacco: the Agrobacterium strains of GhSUT6A-eGFP, GhSUT6D-eGFP and eGFP empty vector were removed from the freezer at-80 ℃ and added to liquid LB medium (containing kanamycin and rifampicin) separately and shaken for 16h at 28 ℃ and 220rpm in a shaker. Shaking the bacteria liquid to bright orange, taking out the bacteria liquid, transferring to a 50mL centrifuge tube, centrifuging at 5000rpm for 9min, pouring off the clear liquid, resuspending the bacteria with a resuspension liquid, and formulating the resuspension liquid (MgCl) ₂ ·6H ₂ O, 10 mmol/L; 2-morpholine ethanesulfonic acid, 10 mmol/L; acetosyringone, 200. mu. mol/L). Then, the OD value was adjusted to 1.2 under an ultraviolet spectrophotometer, and the back of the tobacco lamina was injected with a 1mL syringe after being shielded from light at room temperature for 3 hours, so that the whole lamina was completely soaked. Growing the tobacco after injection in the dark for 12h, illuminating for 12h, and observing the tobacco under a laser confocal microscopeFluorescent sites of grass leaf cells.

And (3) observation by a laser confocal microscope: the leaf tissue near the injection site was cut, washed clean with deionized water, stained with 4mM membrane dye FM4-64 in the dark for 15-20min, and washed. Fluorescence intensity observed by laser confocal microscope: the fluorescence emitted by eGFP is selected from an Alexa Fluor 488nm excitation light source, and the fluorescence emitted by FM4-64 is selected from a Rhodamine Red-X excitation light source.

Arabidopsis protoplast subcellular localization of GhSUT6A/D

(1) Preparation, isolation and transformation of arabidopsis protoplasts: arabidopsis Protoplast Preparation and Transformation selection the Arabidopsis plasmid Preparation and Transformation Kit from Coolaber was used.

(2) And (3) laser confocal observation: the fluorescence emitted by eGFP is selected from an Alexa Fluor 488nm excitation light source, and the autofluorescence of chloroplast is selected from a 633nm excitation light source.

2.7. Yeast function complementation experiment

The sucrose transport-deficient yeast mutant SUSY/ura3 was not able to grow normally on a medium containing sucrose as a sole carbon source, but could grow normally on a medium containing sucrose as a sole carbon source when the sucrose transporter gene was transformed in the yeast mutant. For example, after the AtSUC2 gene and AtSUC4 gene in Arabidopsis are transformed into a SUSY7/ura3 yeast mutant respectively, the sucrose transport activity of the mutant can be recovered, and the mutant has the function of transporting sucrose. Therefore, the experiment was carried out with the yeast expression vector pDR196 as a negative control and AtSUC4 and AtSUC2 of Arabidopsis thaliana as positive controls.

In the experiment, yeast recombinant expression vectors GhSUT6A-pDR196, GhSUT6D-pDR196, AtSUC4-pDR196 and AtSUC2-pDR196 are constructed, SUSY7/ura3 is converted, and the sucrose transport activity of GhSUT6A and GhSUT6D is verified.

(1) Construction of Yeast expression vectors

Obtaining a target gene primer containing a restriction enzyme site: a yeast expression vector pDR196 is used, and two enzyme cutting sites of EcoR I and Sal I are selected to design an enzyme cutting primer. The primer sequences are shown in Table 8.

TABLE 8 Yeast expression vector specific primer sequences

Specific gene fragment amplification: respectively taking plasmids of cloning vectors of the extracted GhSUT6A, GhSUT6D, AtSUC2 and AtSUC4 as templates to amplify specific target gene segments.

Enzyme digestion and recovery of yeast expression vector pDR 196: the restriction enzymes EcoR I and Sal I from New England Biolabs (NEB) Bio Inc. were chosen for the cleavage.

Connection and transformation of target gene and yeast expression vector: and (3) selecting a specific target gene fragment and a purified product of the pDR196 linearized vector fragment by using a homologous recombination reagent C115 to complete a homologous recombination cloning process.

Identification of the recombinant product: the picked monoclonal colony is inoculated into an ampicillin-resistant LB liquid culture medium for shake culture, and the primer of colony PCR is M13F/R. The recombinant expression vectors GhSUT6A-pDR196, GhSUT6D-pDR196, AtSUC2-pDR196 and AtSUC4-pDR196 which are correctly sequenced are respectively preserved and then put into a refrigerator at the temperature of minus 80 ℃ for storage and standby.

(2) Preparation of sucrose-deficient Yeast mutants

The Super yeast transformation kit from Coolaber corporation was selected to complete the preparation of the yeast mutation and the transformation of the recombinant plasmid.

Converting GhSUT6A-pDR196, GhSUT6D-pDR196, AtSUC4-pDR196, AtSUC2-pDR196 recombinant plasmids and pDR196 empty vector plasmids into SUSY7/ura3 yeast competence, coating bacterial liquid in an SD-ura solid culture medium (2% glucose is used as a carbon source), selecting bacteria, respectively inoculating the bacteria in an SD-ura liquid culture medium (2% glucose is used as a carbon source), shaking overnight for 16h, carrying out colony PCR, and using the bacterial liquid with correct bands for verifying function complementation in subsequent experiments.

(3) Functional verification of GhSUT6A/D in sucrose transport-deficient yeast mutant

Bacterial liquid with correct bands in colony PCR is respectively inoculated into 40mL of SD-ura liquid culture with 2% glucose as a carbon source in an ultra-clean workbench, and the SD-ura liquid culture is shaken overnight in a shaking table at 30 ℃ and 220rpm for 16 h. Taking out the cells the next day, detecting OD values of yeast solutions respectively transformed with pDR196 vector, GhSUT6A-pDR196, GhSUT6D-pDR196, AtSUC4-pDR196 and AtSUC2-pDR196 recombinant plasmids by using an ultraviolet spectrophotometer, adjusting OD values of the above bacterial solutions to 0.6 by using sterile water, diluting the bacterial solutions by 10 times, 100 times, 1000 times and 10000 times respectively, and respectively sucking 5 mu L of bacterial solutions to drip on an SD-ura solid culture medium containing 2% sucrose as a carbon source and an SD-ura culture medium containing 2% glucose as a carbon source. And (3) growing in an incubator at 30 ℃ for 3 days, taking out, observing the growth condition of the yeast, and taking a picture.

2.8 acquisition of GhSUT6A/D transgenic Arabidopsis

(1) Constructing a GhSUT6A/D overexpression vector: the GhSUT6A and GhSUT6D gene sequences with stop codons are subjected to homologous recombination and connected with an overexpression vector pCambia2300-eGFP to construct GhSUT6A-eGFP and GhSUT6D-eGFP overexpression vectors.

(2) Infecting arabidopsis thaliana by flower soaking;

(3) screening of Arabidopsis positive seedlings: seeds of T0 generation harvested from the infected arabidopsis are disinfected and cleaned and then sowed in an MS culture medium containing kanamycin antibiotics, green seedlings growing on an MS plate are used as transgenic positive seedlings of T1 generation and are continuously planted, and positive plants of the arabidopsis of T3 generation are obtained and are used for subsequent experimental study.

(4) Semi-quantitative analysis of Arabidopsis thaliana: selecting seeds of WT arabidopsis, 3 strains of over-expression GhSUT6A arabidopsis and 3 strains of over-expression GhSUT6D arabidopsis for planting, and respectively extracting RNA; reverse transcription of cDNA, selection

GXL Hi-Fi enzyme, an Arabidopsis internal reference gene AtUBQ5, and target genes are amplified by respectively using cDNA of WT Arabidopsis and cDNA of overexpression GhSUT6A Arabidopsis as templates. Selecting AtUBQ5 as reference gene of Arabidopsis thaliana, respectively using cDNA of wild Arabidopsis thaliana and over-expression GhSUT6D Arabidopsis thaliana as template, amplifying target geneThus, the method is simple and easy to operate. The PCR product was added to the agarose gel well, and the amount of the expressed band was observed after electrophoresis.

(5) Quantitative analysis of arabidopsis thaliana fluorescence: over-expression arabidopsis thaliana fluorescence quantitative determination AtUBQ5 in arabidopsis thaliana was selected as an internal reference gene, and GhSUT6A and GhSUT6D fluorescence quantitative reactions were performed.

(6) NaCl treatment of arabidopsis thaliana: seeds of wild type Arabidopsis thaliana, 3 lines of Arabidopsis thaliana overexpressing GhSUT6A, and 3 lines of Arabidopsis thaliana overexpressing GhSUT6D were respectively seeded on an untreated MS plate and a 100mM NaCl-treated MS plate, vernalized in the dark in a refrigerator at 4 ℃ for 2 days, and vertically placed in an Arabidopsis thaliana light incubator for growth. Each treatment was at least 3 replicates. And after the seeds grow in an illumination incubator for 10 days, taking out the seeds for phenotype photographing and counting the number.

2.9 phenotypic characterization of GhSUT6A/D transgenic Cotton

(1) Analysis of expression level of transgenic Cotton

Experiments were performed using cotton overexpressing GhSUT6D in T3 generation, which had been obtained in the early stage of the subject group. Selecting 3 strains of cotton over-expressing GhSUT6D, and performing semi-quantitative analysis and fluorescence quantitative analysis by using a gene GhHis3 stably expressed in the cotton as an internal reference gene.

(2) NaCl treated over-expressed cotton

WT cotton grown to the period of two leaves and one heart and cotton over-expressing GhSUT6D in the same growth vigor were transferred to a new hydroponic tank containing Hoagland nutrient solution, and treated with 200mM NaCl, and used as a control without NaCl treatment. After 3 days of growth in the cotton greenhouse, phenotypic observations and photographs were taken. Collecting roots, stems and second true leaves of NaCl-treated and non-NaCl-treated wild cotton and over-expression cotton plants, wrapping with kraft paper, marking, and oven drying in an oven at 85 deg.C for 72 h. The method is used for the subsequent determination of the content of sodium and potassium ions.

Measurement of ion content by ICP method

Measuring the content of sodium and potassium ions by adopting an ICP method: roots, stems and second true leaves of the collected NaCl-treated and NaCl-untreated wild-type cotton and over-expressed cotton plants were dried in an oven at 85 ℃ for 72 hours, and then the tissues were ground into powders, respectively. Then 0.05g of each ground sample was weighed out and dissolved in 5mL of concentrated nitric acid (i.e., nitrification). The solution was then diluted 12 times with deionized water and centrifuged. And finally, collecting the supernatant, and analyzing the contents of sodium ions and potassium ions by an ICP-OES instrument through an atomic absorption spectrometry.

Esculin experiment

Esculin (a sucrose analogue) is called Esculin and is a derivative of coumarin, namely a substance which is formed by adding certain glycosyl and hydroxyl on the molecular structure of coumarin and can emit blue fluorescence under a laser confocal microscope. The transport rate of the Esculin in plants is similar to that of sucrose, so the substance is often used as a sucrose analogue for in vitro research on the sucrose transport activity of a sucrose transporter in plants. In the experiment, a yeast fluorescence experiment is carried out by using a pDR196 vector and AtSUC4 as negative controls and AtSUC2 as positive controls.

(1) Experiment on Cotton Esculin

The cotton seedlings of upland cotton 9053 growing for about 7 days and in the same growth vigor are respectively transferred into 2 new hydroponic boxes (containing Hoagland nutrient solution), and at least 9 seedlings are planted in each box. One of the pots is used as a control and is not subjected to NaCl treatment, after the other pot is added with 200mM NaCl for 12 hours, the roots of the seedlings are washed, the roots are respectively transferred to a water culture solution containing 10mM ESCulin to treat the roots for 60 minutes, and finally the fluorescence intensity is observed under a laser confocal microscope, and each sample is repeated at least 3 times. And the average fluorescence intensity was calculated using Image J.

(2) Arabidopsis thaliana Esculin experiment

Columbia wild type Arabidopsis thaliana and Arabidopsis thaliana over expressing GhSUT6D were grown for 7 days, the Arabidopsis roots were placed in MS liquid medium of 1 μ MEsculin, treated for 60min and then taken out, and the fluorescence intensity was observed under a laser confocal microscope. The ESCulin experimental treatment and laser confocal observation refer to the experimental method of Ma et al. At least 3 replicates per strain.

(3) Yeast Esculin experiment

The sucrose-absorbing ability of GhSUT6A and GhSUT6D was verified by performing a yeast fluorescence experiment using AtSUC4 and pDR196 as negative controls and AtSUC2 as positive controls according to the previous study method (hanhong et al, 2016). The method comprises the following specific steps:

(1) selecting recombinant yeast transformed with pDR196, AtSUC2, AtSUC4, GhSUT6A and GhSUT6D which have been selected, inoculating in SD-ura liquid medium containing 2% glucose, and shaking overnight in a shaker at 30 ℃ for about 16 h; (2) taking out the bacterial liquid to measure the OD value the next day, and ensuring that the OD value is within the range of 0.4-0.6; (3) respectively sucking 1mL of bacterial liquid into a centrifuge tube, centrifuging at 3100rpm for 5min, and pouring off the supernatant; (4) adding isovolumetric 1mmol/L Esculin solution, mixing, and shaking in a shaker at 30 deg.C for 1 h. 1mmol/L of Esculin using 25mmol/L of NaH ₂ PH ₄ (PH is adjusted to 4); (5) centrifuging at 3100rpm for 5min, pouring off the supernatant, adding an equal volume of NaH ₂ PH ₄ Shaking the reagent for 45s, mixing uniformly, centrifuging for 5min, and pouring off the supernatant; (6) adding 300 mu L of NaH ₂ PH ₄ And uniformly mixing the thalli after the reagent, finally sucking the cell suspension, and observing the fluorescence intensity of the yeast cells under a laser confocal microscope.

2.12. Gas chromatography mass spectrometry (GC-MS)

In the invention, GC-MS technology is adopted for measuring all sucrose contents. (1) Taking 0.5g of fresh plant sample in a refrigerator at-80 deg.C, and freeze drying. (2) The plant sample is ground into powder in a grinding instrument. (3) Taking 0.02g of sample powder, adding 500 μ L of a mixture of methanol, isopropanol and water, mixing well for 3min, and performing ultrasonic treatment in ice water for 30 min. (4) Centrifuging at 14000 deg.C for 3min, collecting 50 μ L supernatant, adding 20 μ L internal standard, mixing, blowing with nitrogen, and lyophilizing. (5) 100 μ L of methoxyammonium pyridine was added. (6) The mixture was then washed with water at 37 ℃ for 2h, 100. mu.L of BSTFA was added, and the mixture was washed with water at 37 ℃ for 30 min. (7) Diluting with n-hexane, storing in dark place, and analyzing by GC-MS.

Determination of the MDA content

Malondialdehyde (MDA) is an index for detecting the damage degree of plants, and the content of MDA can be calculated by measuring the absorbance at 532nm and 600 nm. The MDA content of the over-expressed cotton leaves and wild-type cotton leaves before and after NaCl treatment is measured by a malondialdehyde content kit of Gersti Biotech.

2.14. Transcriptome sequencing analysis

The plant material used for transcriptome sequencing was wild type upland cotton HM-1(WT-NaCl) and cotton overexpressing GhSUT6D (OE-NaCl) treated with 200mM NaCl for 6h, and wild type upland cotton HM-1(WT-Mock) and cotton overexpressing GhSUT6D (OE-Mock) grown under normal conditions under a parallel control of 6 h. Cotton roots were selected for transcriptome sequencing in this experiment, with at least 0.3g per sample. The extracted RNA was analyzed for RNA quality by agarose gel electrophoresis. And then using Illumina

The UltraTM RNA Library Prep Kit is used for Library construction and preparation, after the sequencing is finally completed, the data provided by the website https:// www.cottongen.org/specifices/Gossypium _ hirsutum/UTX-TM1_ v2.1 is used as a reference genome, and the DESeq 2R software is used for analyzing the differential expression genes between each comparison combination. And (4) performing data statistics and mapping by utilizing software such as Tbtools and the like according to the analysis result.

The experimental results are as follows:

1. change of sucrose absorption capacity and content in cotton root of land under salt stress

In order to verify the influence of cotton roots on the sucrose absorption capacity under NaCl stress, an ESCulin was used for sucrose absorption experiments. Firstly, 200mM NaCl treatment is carried out on roots of upland cotton seedlings growing for 7 days for 12h, untreated roots are used as a control, then the roots are transferred into 10mM concentration Esculin solution for treatment for 60min, roots of the seedlings are cut longitudinally, and the fluorescence intensity of longitudinal sections of the roots is observed under a laser confocal microscope. The results showed that the NaCl-treated roots had stronger fluorescence intensity than the untreated roots (A in FIG. 1). Then, the fluorescence intensity was quantitatively analyzed by Image J software, and the quantitative results also showed that the roots treated with NaCl exhibited stronger fluorescence (FIG. 1, B). These results preliminarily indicate that salt stress can enhance sucrose uptake by the root system.

2. Detection of sucrose content in gossypium hirsutum root

Further researching whether salt stress can influence the change of the sucrose content in the cotton roots, respectively sampling the upland cotton roots which are treated by NaCl for 1h, 3h, 6h and 12h, and respectively measuring the sucrose content in the cotton roots of the NaCl treatment group and the cotton roots of the untreated group by using a gas chromatography-mass spectrometry (GC-MS) technology with the untreated group as a reference. The results show that the sucrose content in the roots of the cotton treated with NaCl was significantly higher than the control (FIG. 2). This result demonstrates that NaCl stress promotes the accumulation of sucrose in roots. Therefore, it is presumed that appropriate salt stress can promote the transport of sucrose to the sink organ in the plant body, thereby increasing the accumulation of sucrose in the sink organ.

3.GhSUT 6A/D expression pattern analysis

Expression analysis of upland cotton sucrose transporter gene GhSUT under salt stress: the invention utilizes MEGA7 software, takes AtSUC9 in arabidopsis thaliana as a reference gene, and carries out phylogenetic tree analysis with upland cotton GhSUT gene. The results showed that AtSUC9 has a close relationship with GhSUT6A/D (A in FIG. 3), and it is presumed that GhSUT6A/D is likely to respond to salt stress stimulation. To further verify this hypothesis, the expression level of 9 pairs of GhSUT genes in roots of upland cotton was analyzed by real-time fluorescence quantification (RT-qPCR) technique under 200mM NaCl treatment. The results showed that the expression level of the GhSUT6A/D gene under salt stress was the highest (B in FIG. 3) compared with other GhSUT genes, indicating that the GhSUT6A/D gene has the strongest ability to respond to salt stress. This result preliminarily demonstrates that GhSUT6A/D can participate in salt stress reactions.

Expression analysis of GhSUT6A/D under salt stress: to further clarify the response of GhSUT6A/D to salt stress, specific analyses were performed on the GhSUT6A and GhSUT6D genes, respectively. Firstly, the expression level of GhSUT6A and GhSUT6D in the cotton roots of upland cotton treated with 200mM NaCl for 1h, 3h, 6h and 12h under normal conditions was investigated. The results showed that the expression levels of GhSUT6A and GhSUT6D were significantly increased at 1h, 3h, 6h, and 12h of salt treatment, and the expression level of the gene reached the highest at 6h and tended to decrease by 12h, as compared to the control (a and B in fig. 4). To further investigate the effect of NaCl treatments at different concentrations on the expression patterns of the GhSUT6A and GhSUT6D genes, RT-qPCR analysis was performed on the roots of Gossypium hirsutum treated for 6h at 0mM, 50mM, 100mM, 150mM, and 200mM NaCl in this experiment. The results showed that the expression levels of both GhSUT6A and GhSUT6D increased gradually as the salt treatment concentration increased gradually (C and D in fig. 4). The above results indicate that salt stress can regulate the expression levels of the GhSUT6A and GhSUT6D genes, demonstrating that the genes can participate in salt stress response.

GhSUT6A/D protein transmembrane domain analysis: the transmembrane domains of the GhSUT6A and GhSUT6D proteins were predicted using the online tool TMHMM-2.0. The results show that the sucrose transporters encoded by GhSUT6A and GhSUT6D are both composed of 12 transmembrane domains, wherein, the GhSUT6A protein is composed of 558 amino acids, the GhSUT6D protein is composed of 549 amino acids, and the amino acids C-terminal and N-terminal of the two proteins are both located inside the cell. It is presumed that the sucrose transporters encoded by GhSUT6A and GhSUT6D are mainly localized in the cell membrane and function by multiple transmembrane events.

GhSUT6A/D subcellular localization analysis

To verify that the sucrose transporters GhSUT6A and GhSUT6D localized to the cell membrane, subcellular localization experiments were performed in this study. Overexpression vectors of GhSUT6A-eGFP and GhSUT6D-eGFP (A and B in FIG. 5) were constructed, then tobacco transient transformation experiments were performed, and transformed tobacco was stained with cell membrane dye FM 4-64. The confocal laser microscopy results show that green fluorescence appears in the cell membrane and cell nucleus of the tobacco transformed with the eGFP empty vector, while the tobacco transformed with GhSUT6A-eGFP and GhSUT6D-eGFP only shows green fluorescence on the cell membrane and is completely fused with red fluorescence emitted by the membrane dye (A in FIG. 6). This result preliminarily demonstrates that the sucrose transporters encoded by the GhSUT6A and GhSUT6D genes are localized on the cell membrane. The subcellular localization experiments using Arabidopsis protoplasts showed that after transformation of the eGFP vector plasmid, green fluorescence appeared in both the protoplast membrane and the nucleus, whereas after transformation of GhSUT6A-eGFP and GhSUT6D-eGFP, green fluorescence appeared only in Arabidopsis protoplast membrane (B in FIG. 6). The sucrose transporters encoded by GhSUT6A and GhSUT6D were shown to localize in the cell membrane.

Identification of GhSUT6A/D sucrose transport Activity

And (3) functional complementation verification of GhSUT6A/D yeast: constructing yeast expression vectors GhSUT6A-pDR196 and GhSUT6D-pDR196, using AtSUC2 and AtSUC4 in Arabidopsis thaliana as positive controls, constructing yeast expression vectors AtSUC2-pDR196 and AtSUC4-pDR196, using an empty vector pDR196 as a negative control, then respectively transforming into sucrose transport deficient yeast mutant strain SUSY7/ura3, screening yeast strains positive for transformation on an SD-ura culture medium using glucose as a carbon source, respectively spotting on an SD-ura culture medium using 2% glucose as a carbon source and an SD-ura culture medium using 2% sucrose as a carbon source after activating the strains, and observing the growth conditions of the yeasts. The results show that on glucose-containing medium, yeast strains transformed with GhSUT6A and GhSUT6D grew normally with no significant difference, as did the unloaded and positive controls, while on sucrose-containing medium, yeast strains transformed with GhSUT6A and GhSUT6D grew significantly better than yeast strains transformed with empty vector pDR196 (fig. 7). This result indicates that after GhSUT6A and GhSUT6D are transformed into the yeast mutant SUSY7/ura3, the yeast can utilize sucrose as a carbon source to maintain the growth of the yeast, and the mutant is proved to restore the sucrose transport capability. The above experiments show that the sucrose transporters GhSUT6A and GhSUT6D can transport sucrose.

Analysis of sucrose absorption capacity of GhSUT6A/D Yeast: the sucrose absorption capacity of GhSUT6A/D on sucrose was verified using the sucrose analog Esculin. The fluorescence intensity of the recombinant yeast was observed by confocal laser microscopy, and the results of the observation under confocal laser microscopy of the yeast transformed with pDR196 empty vector, AtSUC4-pDR196, AtSUC2-pDR196, GhSUT6A-pDR196 and GhSUT6D-pDR196 are shown in the figure, respectively. pDR196 and AtSUC4 were used as negative controls, and AtSUC2 was used as a positive control. The results showed that the atsut 4 and pDR196 transformed yeasts were not able to fluoresce, whereas the GhSUT6A, GhSUT6D transformed yeasts were able to fluoresce as the atsut 2 transformed yeasts (fig. 8), indicating that the GhSUT6A and GhSUT6D transformed recombinant yeasts absorb Esculin and are therefore able to fluoresce. The GhSUT6A and GhSUT6D are shown to have the capacity of absorbing sucrose, and the sucrose transporter GhSUT6A/D is further proved to be capable of transporting sucrose.

6. Functional analysis of over-expression GhSUT6A/D Arabidopsis thaliana

To further explore the functions of GhSUT6A and GhSUT6D, cotton GhSUT6A and GhSUT6D genes were genetically transformed into Arabidopsis thaliana to obtain T3 generation Arabidopsis thaliana lines overexpressing GhSUT6A and GhSUT 6D. 3 homozygous transgenic lines are respectively selected to carry out semi-quantitative PCR and real-time fluorescent quantitative PCR detection. The semi-quantitative results show that the reference gene AtUBQ5 can be stably expressed in both wild type and over-expressed Arabidopsis thaliana, and the GhSUT6A and GhSUT6D genes can be expressed in over-expressed Arabidopsis thaliana lines, but not in wild type Arabidopsis thaliana (A in FIG. 9). This result demonstrates that the GhSUT6A and GhSUT6D genes can be stably inherited and expressed in overexpressing arabidopsis thaliana. Further, the expression levels of the GhSUT6A gene in wild Arabidopsis thaliana and over-expression GhSUT6A Arabidopsis thaliana are continuously verified by using RT-qPCR technology, and the expression levels of the GhSUT6D gene in wild Arabidopsis thaliana and over-expression GhSUT6D Arabidopsis thaliana are also verified. The results showed that both the GhSUT6A and GhSUT6D genes were highly expressed in the overexpressing arabidopsis thaliana, whereas the wild-type arabidopsis thaliana did not express the gene of interest (B in fig. 9). The results show that both GhSUT6A and GhSUT6D can be efficiently and stably expressed in the transgenic line.

Response of overexpression of GhSUT6A/D Arabidopsis thaliana to salt stress: the wild type, GhSUT6A and GhSUT6D over-expressed Arabidopsis thaliana were treated with 100mM NaCl, and after 10 days of growth, the growth of the over-expressed Arabidopsis thaliana and the wild type Arabidopsis thaliana were observed, respectively. The results show that the growth of wild arabidopsis thaliana, the arabidopsis thaliana over-expressing GhSUT6A and the arabidopsis thaliana over-expressing GhSUT6D are not significantly different and are consistent in growth vigor in the group without NaCl treatment. After 100mM NaCl treatment, Arabidopsis thaliana over-expressing GhSUT6D grows better than the wild type, while Arabidopsis thaliana over-expressing GhSUT6A grows relatively slightly different from the wild type, and Arabidopsis thaliana over-expressing GhSUT6A does not grow as well as Arabidopsis thaliana over-expressing GhSUT6D (FIG. 10). This result demonstrates that arabidopsis thaliana overexpressing GhSUT6D can enhance tolerance to salt stress.

Over-expression of GhSUT6D Arabidopsis sucrose absorption capacity and sucrose content variation: and (3) carrying out Esculin treatment on roots of the over-expression Arabidopsis and wild Arabidopsis seedlings growing for 7 days on the MS culture medium, and observing the fluorescence intensity of the Arabidopsis roots under a laser confocal microscope. It was shown that the fluorescence intensity of the over-expressed Arabidopsis roots was significantly higher than that of the wild type (A in FIG. 11). The sucrose absorption capacity of the over-expressed arabidopsis is higher than that of the wild type. And detecting the sucrose content of the over-expression arabidopsis and wild arabidopsis plants by using a GC-MS technology. The sucrose content of the over-expressed arabidopsis was shown to be significantly higher than that of the wild-type arabidopsis (B in fig. 11). The result shows that the over-expression of GhSUT6D can promote the absorption of sucrose by plants and enhance the accumulation of sucrose in plants. To further clarify the salt tolerance of the over-expressed GhSUT6D Arabidopsis, statistics of root length, fresh weight and dry weight were continued for the wild type which had not been subjected to NaCl treatment and 100mM NaCl treatment and 3 lines of the over-expressed Arabidopsis. The results show that there is no significant difference in root length, fresh weight and dry weight of the control group, and that the root length, fresh weight and dry weight of arabidopsis thaliana overexpressing GhSUT6D are significantly higher than those of the wild type under NaCl treatment (C in fig. 11). It is further demonstrated that overexpression of GhSUT6D can enhance the tolerance of plants to salt stress. The experimental results preliminarily show that the overexpression of GhSUT6D Arabidopsis improves the transport rate of sucrose, promotes the accumulation of sucrose, and further enhances the salt stress resistance of plants.

7.1 analysis of expression level of cotton over-expressing GhSUT 6D: selecting 3 strains of the cotton with GhSUT6D over-expressed in T3 generation obtained in the early stage of a subject group, and performing semi-quantitative PCR and RT-qPCR detection by using a GhHis3 gene stably expressed in the cotton as an internal reference gene. The semi-quantitative results show that the GhHis3 gene is expressed in both wild-type cotton (WT) and 3 over-expressed cotton lines, and the bands are uniform. The GhSUT6D gene is expressed in WT and 3 lines of over-expressed cotton, but the band of the over-expressed cotton line is brighter and wider than that of WT (A in figure 12), which shows that the GhSUT6D gene is more strongly expressed in the over-expressed cotton. The fluorescence quantification result also shows that the expression level of the GhSUT6D gene in over-expressed cotton is significantly higher than that of WT cotton (B in FIG. 12). The above experimental results show that 3 over-expressed cotton lines can be efficiently and stably expressed. Therefore, the over-expressed OE1 strain was selected for the experiment and the subsequent experimental exploration was carried out.

7.2 overexpression of sucrose absorption capacity and sucrose content variation in GhSUT6D Cotton roots: respectively treating over-expression cotton seedlings (OE1) and wild type cotton seedlings (WT) with 10mM Esculin for 60min, cutting root longitudinal section, and observing fluorescence intensity under laser confocal microscope. The results show that the fluorescence intensity of cotton roots overexpressing GhSUT6D is stronger compared to WT, indicating that more eculin is absorbed by the overexpressing cotton roots and stronger fluorescence is emitted (a in fig. 13). The over-expression of GhSUT6D is shown to improve the sucrose absorption capacity of cotton roots. The roots of WT cotton and over-expressed cotton seedlings grown to the two-leaf one-heart stage were sampled, and the sucrose contents in the roots of WT and over-expressed cotton were measured by GC-MS technique, respectively. The results show that the sucrose content in the over-expressed cotton roots is significantly higher compared to WT cotton (B in fig. 13). The above results indicate that overexpression of GhSUT6D promotes the transport of sucrose to the roots in plants, and increases the accumulation of sucrose in the roots.

7.3 analysis of salt tolerance of cotton over-expressing GhSUT6D and index detection, wherein WT cotton and over-expressing cotton OE1 strains growing to the stage of two leaves and one heart are treated by 200mM NaCl, and phenotype observation and photographing are carried out after 3 days. The experimental results show that the WT cotton and the OE1 cotton have the same growth vigor without NaCl treatment, have no obvious difference and can grow normally; under NaCl treatment, the leaves of OE1 cotton showed only slight leaf wilting, and the influence of salt stress was relatively small, and the plants still could grow normally, while the leaves of WT cotton showed significant drooping and wilting states (A in FIG. 14). The fresh weight statistics is carried out on the two groups of leaves respectively, and the results show that the fresh weight of the group which is not subjected to NaCl treatment has no obvious difference; the leaf weight of OE1 cotton in the NaCl-treated group was significantly higher than that of WT (B in FIG. 14), indicating that the over-expressed cotton had less water loss and was subjected to relatively less NaCl stress. The results of continuing the MDA content tests on WT cotton and OE1 cotton show that there is no significant difference in MDA content when not treated with NaCl, and after treatment with NaCl, the MDA content of OE1 cotton leaves is significantly lower than that of WT (fig. 14, C), indicating that OE1 cotton is relatively less damaged by salt stress. The research result shows that the overexpression of the GhSUT6D can enhance the resistance of plants to salt stress.

RNA-seq analysis of salt tolerance mechanism of cotton overexpressing GhSUT6D

8.1 activation of the TCA cycle pathway after overexpression of GhSUT6D

The present invention performs transcriptome (RNA-seq) analysis on roots of wild type Gossypium hirsutum HM-1(WT) that had not been treated with NaCl and on roots of cotton overexpressing GhSUT6D (OE 1). The results show that OE1-Mock induced differential expression of 495 genes, 190 of which were up-regulated and 305 of which were down-regulated, compared to WT-Mock. GO analysis is carried out on the up-regulated differential gene, and the result shows that the up-regulated gene is mainly enriched in the processes of cell glucan and other polysaccharide biosynthesis and metabolism, and the like, which indicates that the over-expression of GhSUT6D can influence the change of sugar in cotton. It is speculated that overexpression of GhSUT6D may affect the carbohydrate signaling pathway in plants. KEGG analysis is carried out on the up-regulated differentially expressed genes, and the result shows that the up-regulated genes are obviously enriched on a tricarboxylic acid (TCA) circulation path. The result shows that the overexpression of the GhSUT6D gene can influence the metabolism and transportation of sugar in plants. The over-expression GhSUT6D cotton is shown to affect the metabolic pathway of sugar in plants, activate TCA cycle pathway and participate in the life activities of plants.

8.2 activation of the phenylpropanoid signaling pathway following overexpression of GhSUT6D

RNA-seq analysis of roots of WT cotton and OE1 cotton lines treated for 6h with 0mM NaCl and 200mM NaCl and using | log ₂ foldchange|>1.0 and P<0.05 determination of the difference in the expression amounts of the two samples. The results show that, compared with WT-Mock, the expression of 8146 differential genes in WT-NaCl is induced, and the expression of 5946 differential genes is inhibited; 190 differential genes are induced in OE1-Mock, and 305 differential genes are inhibited; whereas in OE1-NaCl expression of 6294 differential genes was induced and expression of 3362 differential genes was suppressed, whereas under the combined effect of overexpression and NaCl expression of 965 differential genes was induced and expression of 568 differential genes was suppressed. Analysis of these up-and down-regulated differential genes affected by overexpression and NaCl stress. GO analysis results showed that 3 of the up-regulated genes were found to be the most significant biological processes, including cellular redox homeostasis, cellular homeostasis, and 6 of the down-regulated genes were found to be the most significant biological processes, including translation, peptide biosynthesis, peptide metabolism, cellular amide metabolism, cellular nitrogen biosynthesis, and amide biosynthesis. The analysis result shows that after the GhSUT6D is over-expressed, the expression of genes related to the intracellular and extracellular steady-state processes is maintained through induction on one hand, and the biological combination of certain amino acid metabolism and cell nitrogen is regulated on the other handThe expression of the related genes enhances the adaptability of the plant to salt stress, thereby avoiding the damage caused by the salt stress.

To further analyze the effect of overexpression of GhSUT6D on plant metabolic pathways under NaCl stress, KEGG analysis was performed. The results show that the up-regulated expressed genes are mainly enriched in pathways such as phenylpropane synthesis and metabolism. The phenylpropanoid compounds are secondary metabolites generated after plants suffer from abiotic stress, are indexes and key mediums of the abiotic stimulation response of the plants, and can improve the salt tolerance of the plants through the biosynthesis of the phenylpropanoid. Meanwhile, the genes with down-regulated expression are mainly found in the pathways of photosynthesis, biosynthesis of some amino acids and the like. Previous studies show that when plants are subjected to abiotic stress, some amino acids can enhance the adaptability to the adversity stress by regulating the expression of related genes, but most amino acids also play a role in negative regulation and inhibit the growth of plants. The down-regulated KEGG analysis result shows that the down-regulated expression of the gene for regulating and controlling the biosynthesis of the amino acid lightens the adverse effect of certain amino acid on plants to a certain extent and enhances the adaptability of the plants to salt stress. Research results show that the over-expression of GhSUT6D can induce the expression of genes related to redox homeostasis in cotton roots, promote the biosynthesis of phenylpropane, participate in phenylpropane metabolic pathway, and enhance the salt tolerance of plants.

8.3 overexpression of Cotton induced salt-tolerant Gene expression to reduce Na ⁺ /K ⁺ Ratio of

Over-expression of GhSUT6D cotton induced salt tolerance gene expression: the invention continuously excavates RNA-seq data and analyzes the expression pattern of the gene related to salt stress. The results showed that NaCl treatment caused up-regulation of the expression levels of some genes responding to salt stress, particularly genes related to Na + and K + transport, including GhNHX2, GhCHX15, GhCHX20, GhCIPK11, GhNCL, GhCML27, etc., and that these genes were expressed at lower levels in both WT-Mock and OE-Mock conditions, whereas they were significantly up-regulated in both WT-NaCl and OE-NaCl conditions, particularly at levels significantly higher than WT-NaCl in OE-NaCl conditions (A in FIG. 15). In addition, the experiment utilizes RT-qPCR experiment to verify partial salt toleranceThe results show that the expression level of the salt-tolerant gene in OE-NaCl root is significantly higher than that in WT-NaCl root (B in FIG. 15). The results prove that salt stress promotes the expression of salt-tolerant genes in over-expressed cotton roots, particularly promotes cell Na ⁺ 、K ⁺ High expression of transport related gene and maintenance of Na in cell ⁺ 、K ⁺ And (4) steady state balance, so that the salt tolerance of the over-expressed cotton is enhanced.

Cotton plant Na over-expressing GhSUT6D ⁺ 、K ⁺ The content change is as follows: the RNA-seq data are analyzed, and the result shows that the over-expression GhSUT6D cotton can cause Na after being stressed by salt ⁺ 、K ⁺ Abundance expression of transport associated genes. Further study of the changes in ion content in plants after salt stress of WT and OE1 cotton lines. Determination of Na in roots, stems and leaves of cotton WT and cotton OE1 strains by ICP method ⁺ And K ⁺ Content of Na is calculated ⁺ /K ⁺ A ratio. The results show that Na was present in the roots, stems, and leaves of WT cotton and OE1 cotton lines without NaCl treatment ⁺ And K ⁺ Has no obvious difference in the content of Na ⁺ /K ⁺ The ratio also did not change significantly. Na in roots, stems and leaves of OE1 Cotton line compared to WT after 3 days of NaCl treatment ⁺ The content was significantly reduced (A in FIG. 16), indicating that the OE1 cotton strain reduced the amount of Na to the outside ⁺ The absorption of Na in the cells is accelerated ⁺ Is discharged outside. Meanwhile, K in roots of OE1 cotton strain was found ⁺ The content was elevated (B in FIG. 16), indicating that the OE1 strain slowed K in the roots ⁺ Is discharged outside. Finally calculating Na ⁺ /K ⁺ Ratio to obtain Na in the roots, stems and leaves of the OE1 cotton line under the NaCl treatment ⁺ /K ⁺ The ratio decreased (C in fig. 16). The above experimental results show that Na in roots, stems and leaves of cotton OE1 strain is treated with NaCl ⁺ Relative decrease in accumulation, K in root ⁺ The accumulation is relatively increased, and then the Na in roots, stems and leaves is reduced ⁺ /K ⁺ Ratio, thereby reducing Na exposure of the cells ⁺ Toxic and side effects.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and these modifications or substitutions do not depart from the spirit of the corresponding technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Cotton research institute of Chinese academy of agricultural sciences

Application of cotton sucrose transporter gene GhSUT6 in improving salt tolerance of plants

<130> PA22015712

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 24

<212> DNA

<213> Artificial sequence

<400> 1

attggattgc atggttccct ttct 24

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence

<400> 2

cacaccaagg gacgtgaaac cca 23

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence

<400> 3

atgccggtaa cctaggtggc gg 22

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<400> 4

cagtgtcgaa caacaggaaa g 21

<210> 5

<211> 28

<212> DNA

<213> Artificial sequence

<400> 5

atgcatttca cttgttgttt ccatcacc 28

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence

<400> 6

ttagtgaaag ccagcagtta cagtc 25

<210> 7

<211> 46

<212> DNA

<213> Artificial sequence

<400> 7

ggatccgaat tcgagctcat gcatttcact tgttgtttcc atcacc 46

<210> 8

<211> 42

<212> DNA

<213> Artificial sequence

<400> 8

gagctcgaat tcggatcctc gtgaaagcca gcagttacag tc 42

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence

<400> 9

tttcatttgg agagaacacg ggg 23

<210> 10

<211> 54

<212> DNA

<213> Artificial sequence

<400> 10

gtggatcccc cgggctgcag gaattcatgc atttcacttg ttgtttccat cacc 54

<210> 11

<211> 51

<212> DNA

<213> Artificial sequence

<400> 11

gtaccgggcc ccccctcgag gtcgacttag tgaaagccag cagttacagt c 51

<210> 12

<211> 47

<212> DNA

<213> Artificial sequence

<400> 12

gtggatcccc cgggctgcag gaattcatgg tcagccatcc aatggag 47

<210> 13

<211> 47

<212> DNA

<213> Artificial sequence

<400> 13

gtaccgggcc ccccctcgag gtcgactcaa tgaaatccca tagtagc 47

<210> 14

<211> 51

<212> DNA

<213> Artificial sequence

<400> 14

gtggatcccc cgggctgcag gaattcatgg ctacttccga tcaagatcgc c 51

<210> 15

<211> 51

<212> DNA

<213> Artificial sequence

<400> 15

gtaccgggcc ccccctcgag gtcgactcat gggagaggga tgggcttctg a 51

Claims (10)

1. The application of the cotton sucrose transporter gene GhSUT6 in improving the salt tolerance of plants is characterized in that the cotton sucrose transporter gene GhSUT6 is GhSUT 6D.

2. The use of a biological material containing the cotton sucrose transporter gene GhSUT6 of claim 1 or a protein encoding the GhSUT6 gene in improving salt tolerance of plants.

3. Use according to claim 2, wherein the biological material comprises an expression cassette, a vector or a transgenic cell line.

4. The use according to any one of claims 1 to 3, wherein the use comprises up-regulating the expression of the GhSUT6 gene in a plant of interest to improve plant salt tolerance.

5. The use according to claim 4, wherein the plant is a dicotyledonous plant or a monocotyledonous plant; the dicotyledonous plants comprise one or more of cotton, arabidopsis thaliana and tobacco; the monocotyledon comprises one or more of rice, corn and wheat;

preferably, the plant comprises arabidopsis and/or cotton.

6. The use according to claim 4, wherein the use comprises enhancing the plant resistance to salt stress by increasing the transport rate of sucrose and/or promoting sucrose accumulation in the plant of interest.

7. A method for breeding a transgenic plant with improved salt tolerance, which comprises increasing the activity of GhSUT6D protein or the expression level of GhSUT6D gene in a target plant to obtain the transgenic plant with improved salt tolerance.

8. The method according to claim 7, wherein the method comprises introducing the cotton sucrose transporter gene GhSUT6D into a target plant to obtain a transgenic plant with improved salt tolerance.

9. The method according to claim 8, wherein the method comprises agrobacterium-mediated transformation of a plant expression vector comprising the GhSUT6D gene into a plant.

10. The method according to claim 9, wherein the plant expression vector drives the overexpression of the GhSUT6D gene through a constitutive or inducible promoter.

Images