CN114703288A - Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof - Google Patents
Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof Download PDFInfo
- Publication number
- CN114703288A CN114703288A CN202210631750.3A CN202210631750A CN114703288A CN 114703288 A CN114703288 A CN 114703288A CN 202210631750 A CN202210631750 A CN 202210631750A CN 114703288 A CN114703288 A CN 114703288A
- Authority
- CN
- China
- Prior art keywords
- egfr
- gene
- blocker probe
- primer
- upstream
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 102200048955 rs121434569 Human genes 0.000 title claims abstract description 103
- 239000000523 sample Substances 0.000 title claims abstract description 100
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 65
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 59
- 230000035772 mutation Effects 0.000 claims abstract description 37
- 108020004707 nucleic acids Proteins 0.000 claims abstract description 19
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 19
- 102000039446 nucleic acids Human genes 0.000 claims abstract description 19
- 238000001514 detection method Methods 0.000 claims abstract description 18
- 239000002773 nucleotide Substances 0.000 claims description 67
- 125000003729 nucleotide group Chemical group 0.000 claims description 67
- 238000006243 chemical reaction Methods 0.000 claims description 44
- 230000003321 amplification Effects 0.000 claims description 34
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 34
- 239000012634 fragment Substances 0.000 claims description 15
- 238000000034 method Methods 0.000 claims description 15
- 239000007850 fluorescent dye Substances 0.000 claims description 10
- 238000000137 annealing Methods 0.000 claims description 7
- 230000000903 blocking effect Effects 0.000 claims description 7
- 206010064571 Gene mutation Diseases 0.000 claims description 6
- 230000000295 complement effect Effects 0.000 claims description 6
- 230000000692 anti-sense effect Effects 0.000 claims description 4
- 210000004369 blood Anatomy 0.000 claims description 4
- 239000008280 blood Substances 0.000 claims description 4
- 238000002360 preparation method Methods 0.000 claims description 4
- 208000005443 Circulating Neoplastic Cells Diseases 0.000 claims description 3
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 3
- 210000001124 body fluid Anatomy 0.000 claims description 3
- 239000010839 body fluid Substances 0.000 claims description 3
- 239000003795 chemical substances by application Substances 0.000 claims description 3
- 210000001519 tissue Anatomy 0.000 claims description 3
- 108020004414 DNA Proteins 0.000 description 55
- 238000012986 modification Methods 0.000 description 18
- 230000004048 modification Effects 0.000 description 18
- 210000004027 cell Anatomy 0.000 description 17
- 108091092584 GDNA Proteins 0.000 description 12
- 239000013612 plasmid Substances 0.000 description 11
- 230000000052 comparative effect Effects 0.000 description 8
- 238000005457 optimization Methods 0.000 description 8
- 238000007847 digital PCR Methods 0.000 description 6
- 230000000694 effects Effects 0.000 description 6
- 230000035945 sensitivity Effects 0.000 description 6
- 230000005764 inhibitory process Effects 0.000 description 4
- 230000036438 mutation frequency Effects 0.000 description 4
- 238000012360 testing method Methods 0.000 description 4
- 238000011529 RT qPCR Methods 0.000 description 3
- 210000002381 plasma Anatomy 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 230000007614 genetic variation Effects 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 239000000047 product Substances 0.000 description 2
- 206010059866 Drug resistance Diseases 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 108020005187 Oligonucleotide Probes Proteins 0.000 description 1
- 230000002860 competitive effect Effects 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 229940121645 first-generation egfr tyrosine kinase inhibitor Drugs 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 208000002154 non-small cell lung carcinoma Diseases 0.000 description 1
- 239000002751 oligonucleotide probe Substances 0.000 description 1
- 230000026731 phosphorylation Effects 0.000 description 1
- 238000006366 phosphorylation reaction Methods 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 125000002924 primary amino group Chemical group [H]N([H])* 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 229940121644 second-generation egfr tyrosine kinase inhibitor Drugs 0.000 description 1
- 125000006850 spacer group Chemical group 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 239000013589 supplement Substances 0.000 description 1
- 208000029729 tumor suppressor gene on chromosome 11 Diseases 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of gene detection, in particular to a blocker probe, a primer set and application thereof for amplifying EGFR-T790M gene variation. The length of the blocker probe provided by the invention is less than 20nts, and the thermal stability of the combination of the blocker probe and a wild-type template can be ensured by modifying locked nucleic acid in the range of 1 or 2nts on both sides of a mutation site. In addition, the invention also provides a primer group for amplifying EGFR-T790M gene variation, the primer group comprises the above blocker probe, and also comprises two upstream primers matched with the blocker probe, and the arrangement of the two upstream primers can avoid the occurrence of false negative results when the G & gtA mutation exists at the SNP locus rs 1050171.
Description
Technical Field
The invention relates to the technical field of gene detection, in particular to a blocker probe, a primer set and application thereof for amplifying EGFR-T790M gene variation.
Background
At present, on a qPCR platform, a common method for detecting tumor mutation sites is a mutation amplification system (ARMS) method, an upstream primer and a blocker of the method are in a competitive combination relationship, the difference of Tm values between the primer/blocker and a template is utilized to ensure that the blocker is preferentially combined with a wild template, the primer is preferentially combined with a mutant, the wild amplification is blocked, and the mutant amplification is not blocked, so that the effect of enriching the mutant template is achieved.
Based on the above, the applicant provides a blocker probe for selective amplification of EGFR-T790M gene mutant type in Chinese patent application and multiple homologous invention applications, which are filed by Chinese patent office in 2019, 5/21/2019, have the application number of CN2019104222174 and are entitled as 'a non-quenched oligonucleotide probe for amplifying mutant target gene fragment and application thereof'.
However, in the subsequent use process, the applicant finds that (1) the blocker probe is too long, so that the blocker probe is poor in performance in a qPCR reaction system, obviously inhibits mutants and cannot achieve a good effect; (2) a high-frequency SNP locus rs1050171 (G > A) exists in front of the T790M locus, in 19.6% of Asians, the rs1050171 locus is A (G > A), and the mutation state of rs1050171 can influence the sensitivity of an EGFR-T790M detection system based on ARMS, so that a false negative or false positive result is generated.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to further improve a blocker probe on the basis of the existing blocker probe of EGFR-T790M genetic variation of an applicant to obtain an iterative blocker probe and an amplification primer group so as to further improve the detection sensitivity of low-frequency genetic variation, and meanwhile, the blocker probe is expected to achieve the detection effect which is not inferior to that of digital PCR or high-throughput sequencing under the condition of qPCR, so that the advantages of simple operation, low cost and high cost performance are achieved.
In order to solve the above technical problems and achieve the above object, the present invention provides the following technical solutions:
in a first aspect, the invention provides a blocker probe for amplifying EGFR-T790M gene variation, (1) the nucleotide sequence of the blocker probe covers EGFR-T790M gene mutation sites, is completely matched with a wild type EGFR-T790M gene segment, and is mismatched with a mutant type EGFR-T790M gene segment at the mutation sites; (2) the length of the nucleotide sequence of the blocker probe is less than 20nts, wherein the mutation site and the corresponding base in the range of 1 or 2nts on both sides of the mutation site are modified by locked nucleic acid.
In alternative embodiments, the nucleotide sequence of the blocker probe is (X) from 5 'end to 3' endm）CA C GC（Xn) Or a complementary sequence which hybridizes strictly thereto, said XmThe m nucleotides are completely matched with the wild type EGFR-T790M gene segment at the upstream of the mutation site, and the X isnThe n nucleotides which are completely matched with the wild type EGFR-T790M gene segment are positioned at the downstream of the mutation site, wherein m + n is less than 15, the nucleotide which is marked in an italic and bold font in the blocker probe corresponds to the mutation site, underlining shows that the nucleotide is modified by locked nucleic acid, and at least one nucleotide in CA at the upstream of the mutation site and GC at the downstream of the mutation site is modified by locked nucleic acid.
In alternative embodiments, m ≦ 6.
In an optional embodiment, the nucleotide sequence of the blocker probe is selected from any one of SEQ ID No. 1-4, and the nucleotide sequence shown in SEQ ID No.1 is CTCATC CAGCAGCTC, wherein the nucleotide sequence shown in SEQ ID No.2 is CTCATC CAGCAGCTC, wherein the nucleotide sequence shown as SEQ ID No.3 is CTCATCA C GCAGCTCATG, the nucleotide sequence shown in SEQ ID No.4 is CTCATC CAGCAGCTCATGC。
In an alternative embodiment, the 3' end of the blocker probe is modified by extension blocking.
In a second aspect, the present invention provides a primer set for amplifying EGFR-T790M gene variation, the primer set comprising the blocker probe of any one of the preceding embodiments, two upstream primers and at least one downstream primer;
the nucleotide sequences of the two upstream primers cover the SNP locus rs1050171 of the EGFR-T790M gene, wherein the nucleotide sequence of the first upstream primer is (X)m1）A（Xn1) Said X ism1M1 matched nucleotides at the upstream of the rs1050171 site and with the EGFR-T790M gene fragment, wherein X isn1The nucleotide sequence of the second upstream primer is (X) in the sequence of n1 nucleotides matched with EGFR-T790M gene fragments at the downstream of the rs1050171 sitem2）G（Xn2) Said X ism2Is rM2 nucleotides matched with EGFR-T790M gene fragment at upstream of s1050171 site, wherein X isn2The gene fragment is characterized in that n2 nucleotides downstream of the rs1050171 site are matched with the EGFR-T790M gene fragment, and n1 and n2 are selected from any number of 3-7.
In an alternative embodiment, the 3 'ends of the two upstream primers and the 5' end of the blocker probe have nucleotide overlap, and the number of the overlapped nucleotides is 1-7.
In alternative embodiments, the primer set further comprises a fluorescent probe that binds to the antisense strand of the EGFR-T790M gene.
In a third aspect, the present invention provides a use of the blocker probe of any one of the preceding embodiments or the primer set of any one of the preceding embodiments, the use comprising:
(1) preparing a preparation, a PCR reaction system or a kit for selectively amplifying EGFR-T790M gene mutant; or,
(2) amplification enrichment before detection of EGFR-T790M gene mutant type; or,
(3) and (3) establishing a library before detecting the EGFR-T790M gene mutant type.
In a fourth aspect, the present invention provides a EGFR-T790M gene mutation type selective amplification method, wherein a PCR reaction system is configured using the blocker probe according to any one of the foregoing embodiments or the primer set according to any one of the foregoing embodiments, and after a sample to be amplified is denatured, annealed and extended, the amplification product is analyzed;
the annealing temperature and the extension temperature are the same and are selected from 54-62 ℃;
the sample to be amplified is derived from blood, body fluid, tissue, circulating tumor cells, or cfDNA.
The length of the blocker probe provided by the invention is less than 20nts, the blocker probe can be matched with a primer, the specificity and sensitivity of the reaction can be obviously improved, and meanwhile, the thermal stability of the blocker probe combined with a template can be ensured by the locked nucleic acid modification in the range of 1 or 2nts on both sides of a mutation site, so that the specificity of the blocker probe for identifying mutant types and wild types is improved.
The invention also provides a primer group for amplifying EGFR-T790M gene variation, the primer group comprises the above-mentioned blocker probe, and also comprises two upstream primers matched with the blocker probe, the arrangement of the two upstream primers can avoid the occurrence of false negative result under the condition that G & gtA mutation of SNP locus rs1050171 exists.
The invention also provides a method for EGFR-T790M gene mutation type selective amplification by using the blocker probe or the primer group, the method is based on the combination of the blocker probe and double upstream primers, a ROC curve is prepared by detecting a clinical sample, and the result shows that the detection result of the clinical sample is compared with the result of the digital PCR, the positive coincidence rate is 96.3 percent, the negative coincidence rate is 95.7 percent, and the detection rate of the T790M site is not less than 95 percent under the conditions of 7.5 ng/reaction DNA and 0.125 percent of mutation proportion, so that the detection level of the digital PCR is achieved.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is an amplification curve obtained in the experimental example 1 of the present invention without the blocker probe;
FIG. 2 is an amplification curve when a blocker probe is added in Experimental example 1 of the present invention;
FIG. 3 is an amplification curve when the NCI-H1975 template is used in Experimental example 4 of the present invention;
FIG. 4 is a graph showing an amplification curve when a plasmid 002 template was used in Experimental example 4 of the present invention;
FIG. 5 shows the result of optimizing the final concentration of the primer No. 123 in Experimental example 5 of the present invention;
FIG. 6 shows the results of optimizing the final concentration of the primer No. 111 in Experimental example 5;
FIG. 7 shows the results of optimizing the final concentration of the primer No. 211 in Experimental example 5 of the present invention;
FIG. 8 shows the results of optimizing the final concentration of the probe provided in example 1 of Experimental example 5 of the present invention;
FIG. 9 shows the results of optimizing the final concentration of the fluorescent probe in Experimental example 5;
FIG. 10 shows the final concentration optimization results of the upstream and downstream primers and the internal reference probe of the internal reference in Experimental example 5;
FIG. 11 shows the results of optimizing the reaction volume in Experimental example 5 of the present invention;
FIG. 12 shows the results of the optimization of the number of reaction cycles in Experimental example 5 of the present invention;
FIG. 13 shows the results of the annealing/elongation temperature and time optimization in Experimental example 5 of the present invention;
FIG. 14 shows the ROC curve obtained in application example 1.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are some, but not all, embodiments of the present invention. The components of embodiments of the present invention generally described and illustrated in the figures herein may be arranged and designed in a wide variety of different configurations.
Thus, the following detailed description of the embodiments of the present invention, presented in the figures, is not intended to limit the scope of the invention, as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
It should be noted that: like reference numbers and letters refer to like items in the following figures, and thus, once an item is defined in one figure, it need not be further defined and explained in subsequent figures. Furthermore, the terms "first," "second," "third," and the like are used solely to distinguish one from another and are not to be construed as indicating or implying relative importance.
In a specific embodiment, in a first aspect, the invention provides a blocker probe for amplifying EGFR-T790M gene variation, (1) the nucleotide sequence of the blocker probe covers the mutation site of EGFR-T790M gene, is completely matched with the wild-type EGFR-T790M gene segment, and is mismatched with the mutant EGFR-T790M gene segment at the mutation site; (2) the nucleotide sequence length of the blocker probe is less than 20nts, wherein the mutation site and corresponding bases in the range of 1 or 2nts on both sides are modified by locked nucleic acid.
In alternative embodiments, the nucleotide sequence of the blocker probe is (X) from 5 'end to 3' endm）CA C GC（Xn) Or a complementary sequence which hybridizes strictly thereto, said XmThe m nucleotides are completely matched with the wild type EGFR-T790M gene segment at the upstream of the mutation site, and the X isnThe n nucleotides which are completely matched with the wild type EGFR-T790M gene segment are positioned at the downstream of the mutation site, wherein m + n is less than 15, the nucleotide which is marked in an italic and bold font in the blocker probe corresponds to the mutation site, underlining shows that the nucleotide is modified by locked nucleic acid, and at least one nucleotide in CA at the upstream of the mutation site and GC at the downstream of the mutation site is modified by locked nucleic acid.
In the present invention, m, n, m1, n1, m2, or n2 all represent the number of nucleotides, and thus are all natural numbers. Thus, the above m + n may be selected from 0, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14.
The above-mentioned complementary sequence which strictly hybridizes refers to each nucleotide and the sequence (X) in the complementary sequencem）CACGC（Xn) The corresponding nucleotides all satisfy the base complementary pairing principle.
In alternative embodiments, m ≦ 6.
m is less than or equal to 6, the rs1050171 locus can be prevented from being covered by the blocker probe, so that the Tm values of the combination of the blocker probe and the rs1050171 locus wild type template and the mutant type template are consistent, the Tm values are consistent in the two types of templates, the blocking effect difference cannot occur, the reaction is more stable, and the probability of false negative or false positive results is reduced. Said m may be selected from 0, 1, 2, 3, 4, 5 or 6.
In an optional embodiment, the nucleotide sequence of the blocker probe is selected from any one of SEQ ID No. 1-4, and the nucleotide sequence shown in SEQ ID No.1 is CTCATC CAGCAGCTC，SEQ ID No.2 is CTCATC CAGCAGCTC, wherein the nucleotide sequence shown as SEQ ID No.3 is CTCATCA C GCAGCTCATG, the nucleotide sequence shown in SEQ ID No.4 is CTCATC CAGCAGCTCATGC。
In an alternative embodiment, the 3' end of the blocker probe is modified by extension blocking. The extension blocking modification is a modification performed on the 3 'end of the blocker probe aiming at preventing the 3' end of the blocker probe from extending in the amplification process, and the specific modification includes but is not limited to MGB modification, dideoxy modification, amino modification, phosphorylation modification or spacer C3.
In a second aspect, the invention provides a primer set for amplifying an EGFR-T790M gene variation, the primer set comprising the blocker probe of any one of the preceding embodiments, two upstream primers and at least one downstream primer;
the nucleotide sequences of the two upstream primers cover rs1050171 site of EGFR-T790M gene, wherein the nucleotide sequence of the first upstream primer is (X)m1）A（Xn1) Said X ism1M1 matched nucleotides at the upstream of the rs1050171 site and with the EGFR-T790M gene fragment, wherein X isn1The downstream n1 nucleotides of the rs1050171 site are matched with the EGFR-T790M gene segment, and the nucleotide sequence of the second upstream primer is (X)m2）G（Xn2) Said X ism2M2 matched nucleotides at the upstream of the rs1050171 site and with the EGFR-T790M gene fragment, wherein X isn2The gene fragment is characterized in that n2 nucleotides downstream of the rs1050171 site are matched with the EGFR-T790M gene fragment, and n1 and n2 are selected from any number of 3-7. For m1 and m2 of the two upstream primers, after determining the combined sequence of the upstream primer 3' end on the blocker probe, the conventional selection can be carried out according to the requirements of the actual PCR reaction system.
In alternative embodiments, the 3 'ends of the two upstream primers overlap the 5' end of the blocker probe by 1 to 7 nucleotides, for example 1, 2, 3, 4, 5, 6, or 7. The partially overlapped nucleotide sequence can ensure that the upstream primer is directly prevented from being combined with the template after the blocker probe is combined with the wild-type template, and compared with the conventional method for preventing the wild-type extension, the blocking effect is more obvious.
In alternative embodiments, the primer set further comprises a fluorescent probe that binds to the antisense strand of the EGFR-T790M gene. Due to the blocking effect of the blocker probe, the number of amplified sense strands and amplified antisense strands of the EGFR-T790M gene is obviously different, and when the template strands of the EGFR-T790M gene combined by the fluorescent probe and the blocker probe are different strands, the specificity and sensitivity of the reaction can be improved.
In a third aspect, the present invention provides a use of the blocker probe of any one of the preceding embodiments or the primer set of any one of the preceding embodiments, the use comprising:
(1) preparing a preparation, a PCR reaction system or a kit for selectively amplifying EGFR-T790M gene mutant; or,
(2) amplification enrichment is carried out before EGFR-T790M gene mutant type detection; or,
(3) and (3) establishing a library before detecting the EGFR-T790M gene mutant type.
It should be noted that, for other auxiliary reagents or consumables used in the above preparation, PCR reaction system or kit, those skilled in the art can make routine selections according to actual needs, including but not limited to adding internal reference primers, to verify the amplification quality and assist in interpretation of the result.
In a fourth aspect, the present invention provides a EGFR-T790M gene mutation type selective amplification method, wherein a PCR reaction system is configured using the blocker probe according to any one of the foregoing embodiments or the primer set according to any one of the foregoing embodiments, and after a sample to be amplified is denatured, annealed and extended, the amplification product is analyzed;
the annealing temperature and the extension temperature are the same and are selected from 54-62 ℃, such as 54 ℃, 55 ℃, 56 ℃, 57 ℃, 58 ℃, 59 ℃, 60 ℃, 61 ℃ or 62 ℃;
the sample to be amplified is derived from blood, body fluid, tissue, circulating tumor cells or cfDNA.
Some embodiments of the invention are described in detail below with reference to the accompanying drawings. The embodiments described below and the features of the embodiments can be combined with each other without conflict.
Examples 1 to 4 and comparative examples 1 and 2
The group of embodiments respectively provides a blocker probe for amplifying EGFR-T790M gene variation, and the details are shown in the following table, wherein underlining indicates that the nucleotide is modified by a nucleic acid:
| number of the embodiment | Nucleotide sequence of blocker probe (5 '-3') |
| Example 1 | CTCATC A C G CAGCTC （ SEQ ID No.1 ） |
| Example 2 | CTCATC A C GCAGCTC （ SEQ ID No. 2 ） |
| Example 3 | CTCATCA C G C AGCTCATG （ SEQ ID No. 3 ） |
| Example 4 | CTCATC A C GCAGCTCATGC （ SEQ ID No. 4 ） |
| Comparative example 1 | GCTCATCA C GCAGCTCAT （ SEQ ID No. 5 ） |
| Comparative example 2 | CA GCTCATCA C G CAGCTCAT （ SEQ ID No. 6 ） |
Examples 5 to 8
In the embodiments of the group, MGB is added to the 3' end of each of the blocker probes described in the embodiments 1-4 for modification.
Comparative examples 3 and 4
Comparative examples 3 and 4 MGB modification was added to the 3' end of the blocker probe described in comparative examples 1 and 2, respectively.
Example 9
The embodiment provides a group of amplification primers aiming at EGFR-T790M gene, and the amplification primers are numbered, and comprise an upstream primer and a downstream primer, and simultaneously cover rs1050171 site mutant and wild type, the specific primer information is as follows, in the sequence number "abc" of the primers, a is selected from 1 or 2, wherein 1 represents the upstream primer, and 2 represents the downstream primer; b is selected from 1 or 2, wherein 1 represents rs1050171 site mutant type, and 2 represents rs1050171 site wild type; c represents the specific sequence number of a certain primer:
| primer sequence number | Primer types | SNP mutant | SNP wild type |
| 111 | Upstream primer | CCGTGCAACTCATCA （ SEQ ID No.7 ） | |
| 112 | Upstream primer | ACCGTGCAACTCATCA （ SEQ ID No.8 ） | |
| 113 | Upstream primer | CACCGTGCAACTCATCA （ SEQ ID No.9 ） | |
| 114 | Upstream primer | CCACCGTGCAACTCATCA （ SEQ ID No.10 ） | |
| 121 | Upstream primer | CCGTGCAACTCATCA （ SEQ ID No.11 ） | |
| 122 | Upstream primer | CACCGTGCAGCTCAT （ SEQ ID No.12 ） | |
| 123 | Upstream primer | CCGTGCAGCTCATC （ SEQ ID No.13 ） | |
| 211 | Downstream primer | GCAGGTACTGGGAGCCAATA （ SEQ ID No.14 ） | GCAGGTACTGGGAGCCAATA （ SEQ ID No.14 ） |
| 212 | Downstream primer | AGCAGGTACTGGGAGCCAATA （ SEQ ID No.15 ） | AGCAGGTACTGGGAGCCAATA （ SEQ ID No.15 ） |
| 213 | Downstream primer | GCAGGTACTGGGAGCCAAT A （ SEQ ID No.16 ） | GCAGGTACTGGGAGCCAAT A （ SEQ ID No.16 ） |
Example 10
The present example provides a kit for detecting the mutant sequence of EGFR T790M, the composition of which is shown in the following table:
the detection procedure of the above kit is shown in the following table:
experimental example 1
In the experimental example, the detection results of adding the blocker probe and not adding the blocker probe are compared under the condition of using one upstream primer, and the specific steps are as follows:
DNA extracted from MDA-MB231 cells was used as a wild-type DNA template, and DNA extracted from NCI-H1975 cells was used as a mutant template. A PCR reaction system was prepared according to the following formula:
| name of reagent | Volume (ul) |
| 2x Superstart Premix plus | 25 |
| T790M upstream primer: primer No. 111 | 1 |
| T790M downstream primer: primer No. 211 | 1 |
| Blocker (example 1)/not add Blocker group Water supplement | 1.5 |
| PROBE | 0.5 |
| H 2 O | 6 |
| |
15 |
The PCR amplification procedure was as follows:
the amplification results are shown in fig. 1 and fig. 2, and the results show that compared with the method without the addition of the blocker probe set, the wild-type amplification can be obviously inhibited after the addition of the blocker probe, and meanwhile, the mutant-type template is not inhibited. This demonstrates that the specificity of the reaction can be significantly increased by the addition of the blocker probe.
Experimental example 2
In this experimental example, the detection results of 4 different primer groups consisting of the different blocker probes provided in examples 5 to 8 and the different SNP mutation type primers provided in example 9 were randomly selected, and specifically the following were obtained:
DNA extracted from MDA-MB231 cells was used as a wild-type DNA template, and DNA extracted from NCI-H1975 cells was used as a mutant template, each of which was 15 ng/reaction. And (3) performing combined screening by using different primers and a blocker, and setting a control group without the blocker. The combination and sequence of the primers and the blocker are shown in the following table. Remarking: minimum Δ Ct value = wild type template Ct value minimum-mutant template Ct value maximum).
The primer group composition and experimental results are as follows:
according to the experimental result, the comparative example 3 has a weak inhibition effect on wild type and cannot meet the requirement; comparative example 4 strongly inhibits the mutant template, which lowers the sensitivity of the kit and fails to satisfy the requirements. Examples 5 to 8 all have no obvious inhibition on the mutant type, have obvious inhibition on the wild type template, and have minimum delta Ct values less than-10, which meet the requirements, wherein the best effect is example 5.
Experimental example 3
In this experimental example, the detection results of the 3 different SNP wild-type upstream primers provided in example 9 were compared with the blocker probe provided in example 5, and the details are as follows:
DNA extracted from H441 cells was used as a wild-type DNA template, plasmid 002 (SEQ ID No. 21) was used as a mutant template, H441 genomic DNA was used in a template amount of 15 ng/reaction, and plasmid 002 was 4000 copy/reaction.
Wherein, H441 gDNA and plasmid 002 are rs1050171 wild type, and MB231 gDNA and H1975 gDNA are rs1050171 mutant type. H441 gDNA and MB231 gDNA are T790M wild type, H1975 gDNA and plasmid 002 are T790M mutant.
According to the experimental results, the primer number 123 had the best effect, the minimum Δ Ct value had the largest absolute value, no inhibition was observed on the mutant type, and the wild type was well inhibited.
Experimental example 4
The experimental example examines the amplification conditions of the single upstream primer and the double upstream primer, and concretely comprises the following steps:
DNA extracted from H441 cells is used as a rs1050171 wild type T790M wild type DNA template, and synthesized plasmid 002 is used as a rs1050171 wild type T790M mutant template; DNA extracted from MDA-MB231 cells is used as a wild type DNA template of rs1050171 mutant T790M, and DNA extracted from NCI-H1975 cells is used as a mutant template of rs1050171 mutant T790M; each template was 15 ng/reaction. Four templates were tested using three combinations of primers, primer No. 111 (rs1050171 mutant primer), primer No. 123 (rs1050171 wild-type primer), and two primer combinations (T790M FP-1+ T790M FP-2).
The single primer combination is prepared into a system according to the following formula:
| volume (ul) | |
| 2x Superstart Premix plus | 25 |
| T790M FP-1/T790M FP-2 （ 111/123 ） | 1 |
| T790M RP （ 211 ） | 1 |
| Blocker (example 5) | 1.5 |
| Fluorescent probe (SEQ ID No. 17) | 0.5 |
| H 2 O | 6 |
| |
15 |
The double-primer combination is prepared according to the following formula:
| 1X | |
| 2x Superstart Premix plus | 25 |
| T790M FP-1 （ 111 ） | 0.75 |
| T790M FP-2 （ 123 ） | 0.6 |
| T790M RP （ 211 ） | 1 |
| blocker (example 5) | 1.5 |
| Fluorescent probe (SEQ ID No. 17) | 0.5 |
| H 2 O | 5.65 |
| |
15 |
The PCR reaction procedure was as follows:
the amplification results were as follows:
remarking: minimum Δ Ct value = T790M mutant maximum Ct value-T790M wild type minimum Ct value.
As shown in FIGS. 3 and 4, it was found that when the rs1050171 mutant primer No. 111 was used for amplification and the template was plasmid 002, the amplification efficiency of the template was significantly reduced and the specificity was also reduced. When rs1050171 wild type primer No. 123 was used for amplification, the amplification efficiency was significantly reduced when the template was NCI-H1975. When the two templates are used in combination, the two types of templates have higher amplification efficiency and specificity and perform best.
Experimental example 5
In the experimental example, parameters of an amplification system are optimized on the basis of the double upstream primer system obtained in the experimental example 4, and the parameters specifically comprise the concentration of reaction components, the reaction volume and the reaction program.
5.1 reaction component concentration
3-4 concentrations of each reaction component are selected, 4 templates (DNA extracted from H441 cells is used as an rs1050171 wild type T790M wild type DNA template, H441 genomic DNA and plasmid 002 are proportionally configured into a template of 0.25% T790M mutant type as an rs1050171 wild type T790M mutant type template, DNA extracted from MDA-MB231 cells is used as an rs1050171 mutant type T790M wild type DNA template, DNA extracted from MDA-MB231 cells and DNA extracted from NCI-H1975 cells are proportionally configured into a template of 0.25% T790M mutant type as an rs 1050171T 790M mutant type template, and each template is 15 ng/reaction) are used for testing, the specificity under each condition is detected, and the concentration with the best specificity is selected.
The optimization results of the concentrations of the primers in each reaction are shown in fig. 5 to 10, and the specific results are as follows:
| primer sequence number | Optimization conditions (final concentration of the components) | Conclusion (final concentration of the components) |
| 123 | 150nM 、 120nM 、 100nM 、 180nM | 120nM (FIG. 5) |
| 111 | 150nM 、 100nM 、 200nM | 150nM (FIG. 6) |
| 211 | 200nM 、 140nM 、 260nM | 200nM (FIG. 7) |
| Example 1 socket | 300nM 、 200nM 、 400nM | 300nM (FIG. 8) |
| Fluorescent probe | 100nM 、 70nM 、 130nM | 100nM (FIG. 9) |
| Internal reference upstream primer | 50nM 、 70nM 、 30nM | 30nM (FIG. 10) |
| Internal reference downstream primer | 50nM 、 70nM 、 30nM | 30nM (FIG. 10) |
| Internal reference probe | 50nM 、 70nM 、 30nM | 30nM (FIG. 10) |
5.2 reaction volume optimization
The reaction volume was selected in both cases of 50ul/40ul, and it was tested using 4 kinds of templates (the same as above using the template), and the results are shown in FIG. 11, where WT MIN-MT MAX Δ Ct (FAM-VIC) was detected under each condition, and the larger the value, the better the reaction specificity.
5.3 reaction cycle number optimization
The experiment was performed using 40/45/50 cycles, respectively, and the number of reaction cycles with the best specificity was selected. Using a template: rs1050171 mutant: T790M wild-type template (genomic DNA extracted from MDA-MB231 cells) and T790M mutant template with 0.25% mutation frequency (template configured with MDA-MB231 gDNA and NCI-H1975 gDNA); rs1050171 wild type: T790M wild type template (genomic DNA extracted from H441 cells), T790M mutant template (template configured with plasmid 002 and H441 gDNA) with 0.25% mutation frequency, each 15 ng/reaction. The above 4 templates were used to test them, and WT MIN-MT MAX Δ Ct (FAM-VIC) was detected under each condition, and the larger the value, the better the reaction specificity. As shown in FIG. 12, the reaction cycle number was 50, and the specificity of the reaction was better and the performance was better.
5.4 annealing/extension temperature and time optimization
The annealing/extension temperature and time of the reaction are optimized mainly, and the reaction conditions with the best specificity are selected. The conditions to be tested were as follows: firstly, 58 ℃ and 60 s; ② 56 ℃ for 60 s; ③ 58 ℃ for 40 s; 56 ℃ for 40 s. Using a template: rs1050171 mutant: T790M wild-type template (genomic DNA extracted from MDA-MB231 cells) and T790M mutant template with a mutation frequency of 0.25% (template configured with MDA-MB231 gDNA and NCI-H1975 gDNA); rs1050171 wild type: T790M wild type template (genomic DNA extracted from H441 cells), T790M mutant template (template configured with plasmid 002 and H441 gDNA) with 0.25% mutation frequency, each 15 ng/reaction. The above 4 templates were used to test them, and WT MIN-MT MAX Δ Ct (FAM-VIC) was detected under each condition, and the larger the value, the better the reaction specificity. As shown in FIG. 13, the annealing/extension temperature and time were 58 ℃ and 60s, respectively, and the reaction specificity was better and the performance was better.
Application example 1
Determination of positive judgment values was performed using 142 clinical blood samples (samples from shengmei gene testing technologies ltd, bazai). Clinical samples are all non-small cell lung cancer patients in advanced stage, and the patients with drug resistance are treated by the first generation/second generation EGFR TKI drugs. Plasma was obtained and cfDNA was extracted after clinical sample collection. All cfdnas were tested by digital PCR to confirm the information of the T790M mutation site. By using the kit to detect clinical samples, an ROC curve was generated, and as shown in FIG. 14, a positive judgment value of 12 was determined. The positive match rate of the sample was 96.3% and the negative match rate was 95.7%, and sensitivity comparable to digital PCR has been achieved.
Application example 2
cfDNA extracted from blood plasma of healthy people is used as a wild type DNA template, DNA extracted after DNA extracted from NCI-H1975 cells passes through a blood plasma matrix is used as a mutant template, samples with different mutation ratios are prepared, and the prepared samples are quantitatively detected by using a digital PCR method. The mutation ratios were 0.5%, 0.25%, and 0.125%, respectively. And simultaneously detecting the sample by using different sample loading amounts.
The system was formulated according to the following formula:
| 1X | |
| 2x Superstart Premix plus | 25 |
| T790M FP-1 （ 111 ） | 0.75 |
| T790M FP-2 （ 123 ） | 0.6 |
| T790M RP （ 211 ） | 1 |
| blocker (example 5) | 1.5 |
| Fluorescent probe (SEQ ID NO: 17) | 0.5 |
| Internal reference upstream primer (sequence 18) | 0.15 |
| Internal reference downstream primer (sequence 19) | 0.15 |
| Internal reference probe (sequence 20) | 0.15 |
| H 2 O | 5.2 |
| |
15 |
The PCR reaction procedure was as follows:
the results were as follows: and judging according to a threshold value 12, wherein the lowest detection limit of the site which is not less than 95 percent of detection rate is 0.125 percent of mutation rate under 7.5 ng/reaction DNA concentration.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Zhuhaishengmei bio-diagnostic technology Co., Ltd
<120> blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof
<160> 21
<170> PatentIn version 3.5
<210> 1
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> locked nucleic acid modification
<222>（7）...（9）
<223> blocker 1
<400> 1
ctcatcacgc agctc 15
<210> 2
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> locked nucleic acid modification
<222>（7）...（8）
<223> blocker 2
<400> 2
ctcatcacgc agctc 15
<210> 3
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<221> locked nucleic acid modification
<222>（8）and（10）
<223> blocker 3
<400> 3
ctcatcacgc agctcatg 18
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<221> locked nucleic acid modification
<222>（7）...（8）
<223> blocker 4
<400> 4
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<221> locked nucleic acid modification
<222>（9）
<223> blocker 5
<400> 5
gctcatcacg cagctcat 18
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<221> locked nucleic acid modification
<222>（11）...（12）
<223> blocker 6
<400> 6
cagctcatcacg cagctcat 20
<210> 7
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<223> SNP mutant type upstream primer 1
<400> 7
<210> 8
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> SNP mutant type upstream primer 2
<400> 8
accgtgcaac tcatca 16
<210> 9
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> SNP mutant type upstream primer 3
<400> 9
<210> 10
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> SNP mutant type upstream primer 4
<400> 10
ccaccgtgca actcatca 18
<210> 11
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<223> SNP wild-type forward primer 1
<400> 11
<210> 12
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<223> SNP wild-type forward primer 2
<400> 12
<210> 13
<211> 14
<212> DNA
<213> Artificial Sequence
<220>
<223> SNP wild-type forward primer 3
<400> 13
ccgtgcagct catc 14
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> downstream primer 1
<400> 14
gcaggtactg ggagccaata 20
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> downstream primer 2
<400> 15
agcaggtact gggagccaat a 21
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<221> locked nucleic acid modification
<222>（20）
<223> downstream primer 3
<400> 16
gcaggtactg ggagccaata 20
<210> 17
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> fluorescent probe
<400> 17
tgtctttgtg ttcccggaca tagt 24
<210> 18
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> internal reference upstream primer
<400> 18
acaagacttc cagccacaga a 21
<210> 19
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> internal reference downstream primer
<400> 19
ggtgccaagg agataacaga ga 22
<210> 20
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> internal reference probe
<400> 20
tctaagatct gcttcctggt gtgt 24
<210> 21
<211> 892
<212> DNA
<213> Artificial Sequence
<220>
<223> plasmid 002 sequence
<400> 21
cacaattgcc agttaacgtc ttccttctct ctctgtcata gggactctgg atcccagaag 60
gtgagaaagt taaaattccc gtcgctatca aaacatctcc gaaagccaac aaggaaatcc 120
tcgatgtgag tttctgcttt gctgtatgcg aagccacact gacgtgcctc tccctccctc 180
caggaagcct acgtgatggc cagcgtggac aacccccacg tgtgccgcct gctgggcatc 240
tgcctcacct ccaccgtgca gctcatcatg cagctcatgc ccttcggctg cctcctggac 300
tatgtccggg aacacaaaga caatattggc tcccagtacc tgctcaactg gtgtgtgcag 360
atcgcaaagg taatcaggga agggagatac ggggagggca gagcttcttc ccatgatgat 420
ctgtccctca cagcagggtc ttctctgttt cagggcatga actacttgga ggaccgtcgc 480
ttggtgcacc gcgacctggc agccaggaac gtactggtga aaacaccgca gcatgtcaag 540
atcacagatt ttgggcgggc caaactgctg ggtgcggaag agaaagaata ccatgcagaa 600
ggaggcaaag taaggaggtg gctttaggtc agccagcatt ttcctgacac cagggaccag 660
taacctgact ggttaacagc agtcctttgt aaacagtgtt ttaaactctc ctagtcaata 720
tccaccccat ccaatttatc aaggaagaaa tggttcagaa aatattttca gcctacagtt 780
atgttcagtc acacacacat acaaaatgtt ccttttgctt ttaaagtaat ttttgactcc 840
cagatcagtc agagccccta cagcattgtt aagaaagtat ttgatttttg tc 892
Claims (10)
1. The blocker probe for amplifying EGFR-T790M gene variation is characterized in that (1) the nucleotide sequence of the blocker probe covers EGFR-T790M gene mutation sites, is completely matched with a wild type EGFR-T790M gene segment, and is mismatched with a mutant type EGFR-T790M gene segment at the mutation sites; (2) the length of the nucleotide sequence of the blocker probe is less than 20nts, wherein the mutation site and the corresponding base in the range of 1 or 2nts on both sides of the mutation site are modified by locked nucleic acid.
2. The blocker probe of claim 1, wherein the nucleotide sequence of the blocker probe is (X) from 5 'end to 3' endm）CA C GC（Xn) Or a complementary sequence which hybridizes strictly thereto, said XmThe m nucleotides are completely matched with the wild type EGFR-T790M gene segment at the upstream of the mutation site, and the X isnThe n nucleotides which are completely matched with the wild type EGFR-T790M gene segment are positioned at the downstream of the mutation site, wherein m + n is less than 15, the nucleotide which is marked in an italic and bold font in the blocker probe corresponds to the mutation site, underlining shows that the nucleotide is modified by locked nucleic acid, and at least one nucleotide in CA at the upstream of the mutation site and GC at the downstream of the mutation site is modified by locked nucleic acid.
3. The blocker probe of claim 2, wherein m is less than or equal to 6.
4. The blocker probe of claim 3, wherein the nucleotide sequence of the blocker probe is selected from any one of SEQ ID Nos. 1-4, and the nucleotide sequence shown in SEQ ID No.1 is CTCATC CAGCAGCTC, wherein the nucleotide sequence shown in SEQ ID No.2 is CTCATC CAGCAGCTC, wherein the nucleotide sequence shown as SEQ ID No.3 is CTCATCA C GCAGCTCATG, the nucleotide sequence shown in SEQ ID No.4 is CTCATC CAGCAGCTCATGC。
5. The blocker probe of any one of claims 1 to 4, wherein the 3' end of the blocker probe is modified by extension blocking.
6. A primer group for amplifying EGFR-T790M gene variation, wherein the primer group comprises the blocker probe of any one of claims 1-5, two upstream primers and at least one downstream primer;
the nucleotide sequences of the two upstream primers cover SNP locus rs1050171 in front of EGFR-T790M gene, wherein the nucleotide sequence of the first upstream primer is (X)m1）A（Xn1) Said X ism1Matching m1 nucleotides with EGFR-T790M gene fragment at upstream of rs1050171 site, wherein X isn1The nucleotide sequence of the second upstream primer is (X) in the sequence of n1 nucleotides matched with EGFR-T790M gene fragments at the downstream of the rs1050171 sitem2）G（Xn2) Said X ism2M2 matched nucleotides at the upstream of the rs1050171 site and with the EGFR-T790M gene fragment, wherein X isn2The gene fragment is characterized in that n2 nucleotides downstream of the rs1050171 site are matched with the EGFR-T790M gene fragment, and n1 and n2 are selected from any number of 3-7.
7. The primer group of claim 6, wherein the 3 'ends of the two upstream primers and the 5' end of the blocker probe have nucleotide overlap, and the number of the overlapped nucleotides is 1-7.
8. The primer set of claim 6 or 7, wherein the primer set further comprises a fluorescent probe that binds to the antisense strand of the EGFR-T790M gene.
9. Use of the blocker probe of any one of claims 1 to 5 or the primer set of any one of claims 6 to 8, the use comprising:
(1) preparing a preparation, a PCR reaction system or a kit for selectively amplifying EGFR-T790M gene mutant; or,
(2) amplification enrichment before detection of EGFR-T790M gene mutant type; or,
(3) and (3) performing pre-library establishment on EGFR-T790M gene mutant type detection.
The EGFR-T790M gene mutation type selective amplification method is characterized in that a PCR reaction system is configured by using the blocker probe of any claim 1 to 5 or the primer group of any claim 6 to 8, and an amplification product is analyzed after an amplification sample is denatured, annealed and extended;
the annealing temperature and the extension temperature are the same and are selected from 54-62 ℃;
the sample to be amplified is derived from blood, body fluid, tissue, circulating tumor cells or cfDNA.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211027049.7A CN115851928A (en) | 2022-06-06 | 2022-06-06 | Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof |
| CN202210631750.3A CN114703288B (en) | 2022-06-06 | 2022-06-06 | Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210631750.3A CN114703288B (en) | 2022-06-06 | 2022-06-06 | Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211027049.7A Division CN115851928A (en) | 2022-06-06 | 2022-06-06 | Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114703288A true CN114703288A (en) | 2022-07-05 |
| CN114703288B CN114703288B (en) | 2022-09-13 |
Family
ID=82178005
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211027049.7A Pending CN115851928A (en) | 2022-06-06 | 2022-06-06 | Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof |
| CN202210631750.3A Active CN114703288B (en) | 2022-06-06 | 2022-06-06 | Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211027049.7A Pending CN115851928A (en) | 2022-06-06 | 2022-06-06 | Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN115851928A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117025765A (en) * | 2023-02-01 | 2023-11-10 | 珠海圣美生物诊断技术有限公司 | Multiplex digital PCR detection kit and detection method thereof |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130149695A1 (en) * | 2010-04-27 | 2013-06-13 | Samsung Life Public Welfare Foundation | Method for detecting genetic mutation by using a blocking primer |
| US20140248612A1 (en) * | 2011-08-18 | 2014-09-04 | Nestec S.A. | Compositions and methods for detecting allelic variants |
| US20150038520A1 (en) * | 2010-12-22 | 2015-02-05 | Pangaea Biotech S.L. | Molecular Biomarkers for Predicting Response to Tyrosine Kinase Inhibitors in Lung Cancer |
| US20170327868A1 (en) * | 2015-10-21 | 2017-11-16 | Admera Health LLC | Blocker based enrichment system and uses thereof |
| CN108728536A (en) * | 2018-05-25 | 2018-11-02 | 广州永诺生物科技有限公司 | Primer, probe, PCR reaction solution and the kit of Human epidermal growth factor receptor gene T790M site primers |
| CN109234390A (en) * | 2018-09-03 | 2019-01-18 | 刘红彦 | Wild type specificity prevents probe, detection method and application thereof |
| US20190376128A1 (en) * | 2016-11-30 | 2019-12-12 | Exosome Diagnostics, Inc. | Methods and compositions to detect mutations in plasma using exosomal rna and cell free dna from non-small cell lung cancer patients |
| CN111662986A (en) * | 2020-07-24 | 2020-09-15 | 珠海圣美生物诊断技术有限公司 | Method and probe for detecting cis-trans mutation configurations of EGFR-T790M and EGFR-C797S |
| CN114277142A (en) * | 2021-12-28 | 2022-04-05 | 普瑞斯新(上海)生物医疗科技有限公司 | EGFR gene mutation multiplex detection primer probe and kit thereof |
-
2022
- 2022-06-06 CN CN202211027049.7A patent/CN115851928A/en active Pending
- 2022-06-06 CN CN202210631750.3A patent/CN114703288B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130149695A1 (en) * | 2010-04-27 | 2013-06-13 | Samsung Life Public Welfare Foundation | Method for detecting genetic mutation by using a blocking primer |
| US20150038520A1 (en) * | 2010-12-22 | 2015-02-05 | Pangaea Biotech S.L. | Molecular Biomarkers for Predicting Response to Tyrosine Kinase Inhibitors in Lung Cancer |
| US20140248612A1 (en) * | 2011-08-18 | 2014-09-04 | Nestec S.A. | Compositions and methods for detecting allelic variants |
| US20170327868A1 (en) * | 2015-10-21 | 2017-11-16 | Admera Health LLC | Blocker based enrichment system and uses thereof |
| US20190376128A1 (en) * | 2016-11-30 | 2019-12-12 | Exosome Diagnostics, Inc. | Methods and compositions to detect mutations in plasma using exosomal rna and cell free dna from non-small cell lung cancer patients |
| CN108728536A (en) * | 2018-05-25 | 2018-11-02 | 广州永诺生物科技有限公司 | Primer, probe, PCR reaction solution and the kit of Human epidermal growth factor receptor gene T790M site primers |
| CN109234390A (en) * | 2018-09-03 | 2019-01-18 | 刘红彦 | Wild type specificity prevents probe, detection method and application thereof |
| CN111662986A (en) * | 2020-07-24 | 2020-09-15 | 珠海圣美生物诊断技术有限公司 | Method and probe for detecting cis-trans mutation configurations of EGFR-T790M and EGFR-C797S |
| CN114277142A (en) * | 2021-12-28 | 2022-04-05 | 普瑞斯新(上海)生物医疗科技有限公司 | EGFR gene mutation multiplex detection primer probe and kit thereof |
Non-Patent Citations (3)
| Title |
|---|
| JINYIN ZHAO等: "Restriction endonuclease-mediated real-time digestion-PCR for somatic mutation detection", 《INTERNATIONAL JOURNAL OF CANCER》 * |
| SANPENG XU等: "Exploring the impact of EGFR T790M neighboring SNPs on ARMS-based T790M mutation assay", 《EXPLORING THE IMPACT OF EGFR T790M NEIGHBORING SNPS ON ARMS-BASED T790M MUTATION ASSAY》 * |
| 朱玲等: "建立ARMS-LNA-qPCR方法检测肺癌组织中EGFR-T790M突变率", 《标记免疫分析与临床》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117025765A (en) * | 2023-02-01 | 2023-11-10 | 珠海圣美生物诊断技术有限公司 | Multiplex digital PCR detection kit and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115851928A (en) | 2023-03-28 |
| CN114703288B (en) | 2022-09-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110396517B (en) | Non-quenching oligonucleotide probe for amplifying variant target gene fragment and application thereof | |
| CN111304194B (en) | Nucleic acid amplification blocker for detecting low-abundance mutant sequence and application thereof | |
| CN101899496A (en) | K-Ras gene mutation typing fluorescence quantitative PCR detection kit and detection method thereof | |
| CN110438223B (en) | Primer and probe for detecting Kras gene point mutation, kit and detection method thereof | |
| CN107447013B (en) | Method for detecting mutation sites of codons 12 and 13 of Kras gene and kit thereof | |
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| CN114703288B (en) | Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof | |
| CN110714065A (en) | Kit and method for detecting NTRK gene fusion | |
| CN105177118B (en) | Detect the primer and probe system and kit of Human epidermal growth factor receptor gene mutation | |
| CN105420349A (en) | Method and kit for determining mutated nucleic acid bases | |
| CN111662986B (en) | Method and probe for detecting cis-trans mutation configurations of EGFR-T790M and EGFR-C797S | |
| CN107354196B (en) | Kit for detecting human KRAS gene mutation | |
| CN109136367B (en) | Method for improving diagnosis efficiency of BRAF gene V600E mutation | |
| EP4253557A1 (en) | Primer/probe design method, detection composition and kit for mirna detection | |
| CN114410831B (en) | Novel detection kit for coronavirus Delta mutant strain | |
| CN113930485B (en) | Reagent for detecting gene copy number variation and application thereof | |
| CN113637754B (en) | Application of biomarker in diagnosis of esophageal cancer | |
| CN115418394A (en) | Composition, kit and method for detecting CHO cell genome DNA | |
| CN116064775A (en) | Detection kit and detection method for TRECs, KRECs and SMN1 | |
| CN114807318A (en) | Composition, kit and method for detecting Vero cell genome DNA | |
| CN113186353A (en) | Primer for digital PCR detection aiming at C-type retrovirus and detection method | |
| CN110964833A (en) | Kit for detecting KRAS and BRAF gene mutation in plasma free DNA by one tube | |
| CN107312833B (en) | LSP primer and kit for detecting human BRCA1 gene mutation | |
| CN112980932B (en) | Nucleotide for detecting gene mutation, composition and method thereof | |
| CN105603055B (en) | Multiplex polymerase chain reaction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |