CN110396517B

CN110396517B - Non-quenching oligonucleotide probe for amplifying variant target gene fragment and application thereof

Info

Publication number: CN110396517B
Application number: CN201910776862.6A
Authority: CN
Inventors: 唐东江; 赵计昌; 黄雅菁; 齐盼盼; 乔一恺; 李雁茭; 林上炎
Original assignee: Zhuhai Livzon Cynvenio Diagnostics Ltd; Zhuhai Shengmei Gene Detection Technology Co ltd
Current assignee: ZHUHAI LIVZON CYNVENIO DIAGNOSTICS Ltd.; Zhuhai shengmei Gene Detection Technology Co.,Ltd.
Priority date: 2019-05-21
Filing date: 2019-08-22
Publication date: 2021-10-15
Anticipated expiration: 2039-08-22
Also published as: CN110157703A; CN111518800A; CN110396517A; CN111518800B

Abstract

The invention relates to a non-quenching oligonucleotide probe for amplifying a variant target gene fragment and application thereof, wherein the non-quenching oligonucleotide meets the following conditions: completely matching with a wild target gene fragment and locally mismatching with a variant target gene fragment; adjusting the length of the oligonucleotide probe; modifying at a specific position near the mutation site; fourthly, the probe does not mark a fluorescent group and a quenching group; modifying the 3' tail end of the probe; sixthly, the variation is single or multiple base variation; the probes can be used alone or in combination. The probe balances the inhibition of wild gene amplification and the no influence on the amplification of the variant gene, inhibits the amplification of the wild gene to the maximum limit, avoids influencing the amplification of the variant gene at the same time, and has good enrichment effect on the variant gene. Meanwhile, the method has the advantages of low cost, high flexibility of the enriched detection mode and stable effect.

Description

Non-quenching oligonucleotide probe for amplifying variant target gene fragment and application thereof

The present application claims the priority of Chinese patent application with the application number of CN2019104222174, entitled "non-quenched oligonucleotide probe for amplifying variant target gene fragment and application thereof" filed in the patent office of China, 5/21/2019, the entire contents of which are incorporated herein by reference.

Technical Field

The invention relates to the field of gene detection, in particular to a non-quenched oligonucleotide probe for amplifying a variant target gene fragment and application thereof.

Background

Genetic variation (mutation) refers to the change of genetic material and the resulting phenotypic change, including point mutation, deletion, duplication, rearrangement, etc. Various techniques are currently available in the market for detecting and analyzing gene mutations, such as ARMS-PCR (amplification recovery mutation system PCR), NGS (next generation sequence), dd-PCR (repeat digital-PCR) and the like, which can detect mutant sequences from wild type, but all have disadvantages. Wherein, the detection sensitivity of ARMS-PCR is lower; the detection sensitivity of NGS and dd-PCR is higher, but dd-PCR and NGS have the defects of high detection cost, expensive equipment, complex operation, easy pollution, difficult clinical popularization and the like. In addition, the current gene detection reagents are usually used for detecting serum and tissue samples, and a reagent or a kit which can be compatible with Circulating Tumor Cell (CTC) sample detection is lacked.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a non-quenching oligonucleotide probe, a reagent and/or a kit, a mixed reaction system, an amplification method and application of a target amplification variant target gene fragment, wherein the probe can continuously and effectively block amplification of a wild type gene fragment in an amplification reaction process, but basically has no influence on the variant gene fragment, so that the effective enrichment of the variant gene fragment is realized, the detection of gene variation, especially low-frequency gene variation, is favorable, and has the advantages of high detection sensitivity, simple operation, low cost and high cost performance.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

a non-quenched oligonucleotide probe for amplifying a variant target gene fragment, wherein (1) the nucleotide sequence of the non-quenched oligonucleotide probe perfectly matches a wild-type target gene fragment and mismatched with the variant target gene fragment at a variant position;

(2) the length of the non-quenching oligonucleotide probe is 24-50 bp, wherein at least 1-6 nucleotides are modified within the range of 1-5 bp at the variation position and two sides of the variation position to enhance the thermal stability of the probe and a complementary chain, and preferably, the modification is locked nucleic acid modification or peptide nucleic acid modification; the 3' end of the non-quenched oligonucleotide probe is modified to block extension of the probe during amplification, preferably the modification is a dideoxy modification, an amino modification or a phosphorylation modification;

(3) the non-quenched oligonucleotide probe can bind to the wild-type target gene fragment and the variant target gene fragment when annealed, and only bind to the wild-type target gene fragment when extended.

The invention designs the non-quenching oligonucleotide probe, and the non-quenching oligonucleotide probe meets the following conditions: matching with wild target gene segment and mismatching with mutant target gene segment; adjusting the length of the oligonucleotide probe; and modifying at specific positions to enhance the thermal stability of the probe and the complementary link. The probe can be combined with a wild type template with high binding force and a variant template with low binding force in an annealing state, and is only combined with the wild type template in an extension state, so that the balance between the inhibition of the amplification of the wild type gene fragment and the inhibition of the amplification of the variant gene fragment is achieved, the inhibition of the amplification of the wild type gene fragment is limited to the maximum extent, and the influence on the amplification of the variant gene fragment is avoided.

The aforementioned probe of the present invention also satisfies the following conditions: fourthly, the probe is a non-quenching oligonucleotide probe; the 3' end of the probe is subjected to dideoxy modification, amino modification or phosphorylation modification and the like. Compared with the common fluorescence quenching type probe, the non-quenching type oligonucleotide probe has the advantages of low cost, large flexibility of the detection mode after enrichment and stable effect. Specifically, firstly, the probe does not need the labeling modification of a fluorescent group and a quenching group, and the cost of the probe is reduced. Secondly, the application range of the non-quenching oligonucleotide probe is wide, and the non-quenching oligonucleotide probe is suitable for various platforms. For example, the non-quenched oligonucleotide probe can be used in combination with a double-stranded DNA dye (such as SYBR Green or EvaGreen) during a PCR amplification stage to obtain a detection result of the variant gene; alternatively, the amplified and enriched PCR product can be directly used for sequencing; alternatively, other low-sensitivity genetic variation detection kits are used to detect the enriched sample. Finally, the 3 'end of the probe is subjected to dideoxy modification, amino modification or phosphorylation modification and the like, so that the extension of the 3' end of the probe in the amplification process can be avoided, and the increase of Tm of the probe due to the increase of the length can be prevented, and the inhibition effect on the amplification of the variant gene can be generated.

In some specific embodiments, the probe has a length of 24bp, 25bp, 26bp, 27bp, 28bp, 29bp, 30bp, 31bp, 32bp, 33bp, 34bp, 35bp, 36bp, 37bp, 38bp, 39bp, 40bp, 41bp, 42bp, 43bp, 44bp, 45bp, 46bp, 47bp, 48bp, 49bp, or 50 bp; preferably, the probe is 24bp, 28bp, 30bp, 32bp, 33bp, 43bp, 48bp or 49bp in length.

In some embodiments, the variation comprises a single base variation (e.g., EGFR-T790M, EGFR-L858R, or K-ras), or a multiple base variation (e.g., EGFR-19 Del).

In some specific embodiments, the non-quenched oligonucleotide probe is probe 1, probe 2, or probe 3 for amplifying EGFR-T790M variation; the nucleotide sequence of the probe 1 is TCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCC(SEQ ID NO：1) The nucleotide sequence of the probe 2 is GTGCAGCTCATCACGCAGCTCATGCCCT (SEQ ID NO: 2), and the nucleotide sequence of the probe 3 is GTGCAGCTCATCACGCAGCTCATGCCCT (SEQ ID NO: 3), wherein the underlined nucleotide in probe 1, probe 2 or probe 3 is the nucleotide modified to enhance the thermal stability of the probe to the complementary strand.

In some embodiments, the non-quenched oligonucleotide probe is probe 4 or probe 5 for amplification of a K-ras mutation; the nucleotide sequence of the probe 4 is GGTAGTTGGAGCTGGTGGCGTAGGCAAGAG (SEQ ID NO: 4), and the nucleotide sequence of the probe 5 is TGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTG (SEQ ID NO: 5), wherein the underlined nucleotide in probe 4 or probe 5 is the nucleotide modified to enhance the thermostability of the probe to the complementary strand.

In some specific embodiments, the non-quenched oligonucleotide probe is probe 6 or probe 7 for amplifying EGFR-L858R variation; the nucleotide sequence of the probe 6 is CACAGATTTTGGGCTGGCCAAACTGCTGGGTG (SEQ ID NO: 6), and the nucleotide sequence of the probe 7 is ATTTTGGGCTGGCCAAACTGCTGG (SEQ ID NO: 7), wherein the underlined nucleotide in probe 6 or probe 7 is the nucleotide modified to enhance the thermal stability of the probe to the complementary strand.

In some specific embodiments, the non-quenched oligonucleotide probe is probe 8 or probe 9 for amplification of EGFR-19Del deletion variants; the nucleotide sequence of the probe 8 is GCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACA (SEQ ID NO: 8), the nucleotide sequence of the probe 9 is GTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGG (SEQ ID NO: 9), wherein the underlined nucleotides in probe 8 or probe 9 are the nucleotides that have been modified to enhance the thermal stability of the probe to the complementary strand.

EGFR-T790M, K-ras, EGFR-L858R and EGFR-19Del variants are of great interest for cancer therapy, especially for the treatment of lung cancer. The non-quenched oligonucleotide probe is designed, optimized and obtained, and is used for amplifying EGFR-T790M, K-ras, EGFR-L858R and EGFR-19Del variant genes, the probe can effectively inhibit amplification of wild type genes without basically influencing amplification of variant genes, so that the variant genes can be efficiently enriched, and the non-quenched oligonucleotide probe is suitable for samples with multiple variant sites (K-ras), low variant rate and low abundance. However, it is noteworthy that the present invention found that the length of the probe and the modification position of the locked nucleic acid have a significant influence on the effect of the non-quenched oligonucleotide probe in the optimization process. Taking EGFR-T790M as an example, the locked nucleic acid modification positions of probe 1 and probe 3 are the same, the lengths of the probes are different, and although the amplification of wild-type genes can be inhibited, the inhibition effect of probe 1 is obviously better than that of probe 3. Taking K-ras as an example, probe 4 and probe 5 have basically the same length and different nucleotide modification positions, and both of them show blocking effect on wild-type K-ras, but probe 4 has no amplification inhibition effect on G12V and G13D, while probe 5 inhibits the amplification of G13D.

The invention also relates to: a reagent and/or kit for amplifying a variant target gene fragment, comprising the aforementioned non-quenched oligonucleotide probe, other amplification reagents and/or amplification consumables.

In some embodiments, the non-quenched oligonucleotide probes are one or more, preferably, the plurality of oligonucleotide probes are directed against the same variant target gene, or different variant target genes.

In some specific embodiments, the reagents and/or kits are used to amplify at least two of a K-ras variation, an EGFR-L858R variation, an EGFR-L858R variation, and an EGFR-19Del deletion variation.

In some specific embodiments, the variant target gene fragments that the reagents and/or kits are used for amplifying include the EGFR-L858R variant and the EGFR-19Del deletion variant; the reagents and/or kits include probe 6 or probe 7 for amplification of the EGFR-L858R variation, and probe 8 or probe 9 for amplification of the EGFR-19Del deletion variation; preferably, the reagents and/or kits comprise probe 6 for amplification of the EGFR-L858R variation, and probe 8 for amplification of the EGFR-19Del deletion variation.

In some specific embodiments, the variant target gene fragments that the reagents and/or kits are used for amplifying include the EGFR-T790M variant, the EGFR-L858R variant, and the EGFR-19Del deletion variant; the reagents and/or kits include probe 1, probe 2 or probe 3 for amplifying the EGFR-T790M variation, probe 6 or probe 7 for amplifying the EGFR-L858R variation, and probe 8 or probe 9 for amplifying the EGFR-19Del deletion variation; preferably, the reagents and/or kits include probe 1 for amplifying the EGFR-T790M variation, probe 6 for amplifying the EGFR-L858R variation, and probe 8 for amplifying the EGFR-19Del deletion variation.

In some embodiments, the probe and the additional amplification reagent are provided in a separate package, or the probe and the additional amplification reagent are provided in a mixed single reagent.

In some specific embodiments, the additional amplification reagents comprise one or more of primer pairs, DNA polymerases, buffers, dNTPs, sterile water, and double-stranded DNA dyes; further optionally, the additional amplification reagents are provided in separate packages when they are multiple, or at least two of the additional amplification reagents are provided as a mixed single reagent.

In some specific embodiments, the reagents and/or kits comprise primers Mix, Blocker Mix, buffer and PCR enzymes; the reagents and/or kits are useful for amplifying at least two of a K-ras variation, an EGFR-L858R variation, an EGFR-L858R variation, and an EGFR-19Del deletion variation.

In some specific embodiments, the primer pair consists of an upstream primer and a downstream primer for amplifying a mutation location comprising the mutant target gene fragment, the primer pair and the non-quenched oligonucleotide probe do not overlap or partially overlap at a binding site to the target gene fragment; further optionally, the molar ratio of the upstream primer to the downstream primer is 1: 0.75-1.25, preferably 1: 1.

In some specific embodiments, the reagents and/or kits are used to amplify EGFR-T790M variation, and the nucleotide sequences of the primer pairs are shown below: CATGCGAAGCCACACTGAC (SEQ ID NO: 10) and GTCTTTGTGTTCCCGGACATAGTCCAGG (SEQ ID NO: 11).

In some specific embodiments, the reagents and/or kits are used for amplifying K-ras variants, and the nucleotide sequences of the primer pairs are respectively as follows: AAGCGTCGATGGAGGAGTTTGTAAAT (SEQ ID NO: 12) and GTTGGATCATATTCGTCCACAA (SEQ ID NO: 13).

In some specific embodiments, the reagents and/or kits are used to amplify EGFR-L858R variation, and the nucleotide sequences of the primer pairs are shown below: TACTTGGAGGACCGTCGCTT (SEQ ID NO: 14) and GCTGACCTAAAGCCACCTCCTTA (SEQ ID NO: 15).

In some specific embodiments, the reagents and/or kits are used for amplifying EGFR-19Del deletion variants, and the nucleotide sequences of the primer pairs are respectively as follows: ACGTCTTCCTTCTCTCTCTGTCATA (SEQ ID NO: 16) and GCCAGACATGAGAAAAGGT (SEQ ID NO: 17).

In some specific embodiments, the variant target gene fragments that the reagents and/or kits are used for amplifying include the EGFR-L858R variant and the EGFR-19Del deletion variant; the kit comprises a primer pair for amplifying EGFR-L858R variation: the nucleotide sequences of the primer pairs are respectively shown as follows: TACTTGGAGGACCGTCGCTT (SEQ ID NO: 14) and GCTGACCTAAAGCCACCTCCTTA (SEQ ID NO: 15), and the primer pair for amplifying the EGFR-19Del deletion variant: the nucleotide sequences of the primer pairs are respectively shown as follows: ACGTCTTCCTTCTCTCTCTGTCATA (SEQ ID NO: 16) and GCCAGACATGAGAAAAGGT (SEQ ID NO: 17).

In some specific embodiments, the variant target gene fragments that the reagents and/or kits are used for amplifying include the EGFR-T790M variant, the EGFR-L858R variant, and the EGFR-19Del deletion variant; the kit comprises a primer pair for amplifying EGFR-T790M variation, wherein the nucleotide sequences of the primer pair are respectively as follows: CATGCGAAGCCACACTGAC (SEQ ID NO: 10) and GTCTTTGTGTTCCCGGACATAGTCCAGG (SEQ ID NO: 11); primer pairs for amplification of EGFR-L858R variation: the nucleotide sequences of the primer pairs are respectively shown as follows: TACTTGGAGGACCGTCGCTT (SEQ ID NO: 14) and GCTGACCTAAAGCCACCTCCTTA (SEQ ID NO: 15), and the primer pair for amplifying the EGFR-19Del deletion variant: the nucleotide sequences of the primer pairs are respectively shown as follows: ACGTCTTCCTTCTCTCTCTGTCATA (SEQ ID NO: 16) and GCCAGACATGAGAAAAGGT (SEQ ID NO: 17).

The method further limits the primer pair matched with the oligonucleotide probe for use in amplification of EGFR-T790M, K-ras, EGFR-L858R and EGFR-19Del variant genes, the amplified segment of the primer pair covers the variant position of a target gene, and the method has the advantages of good specificity, no non-specific amplification, no primer dimer and the like.

The invention also relates to: a mixed reaction system for amplifying the mutant target gene fragment, wherein the mixed reaction system comprises the reagent and a sample to be detected; optionally, the sample to be tested is a low copy number sample or a low variation frequency sample, preferably, the low copy number is 800 to 20000 copies, for example, 1000 copies, 4000 copies, 8000 copies or 16000 copies, and the low variation frequency is 0.03% to 5% variation rate, for example, 0.05% variation rate, 0.075% variation rate, 0.1% variation rate, 0.15% variation rate, 0.25% variation rate, 0.3% variation rate, 0.5% variation rate, 1% variation rate, 1.2% variation rate or 4% variation rate;

optionally, the sample to be detected is a low copy number and low variation rate sample; preferably, the low copy number is 800 to 20000 copies, for example, 1000 copies, 4000 copies, 8000 copies or 16000 copies, and the low variation frequency is 0.03% to 5% variation rate, for example, 0.05% variation rate, 0.075% variation rate, 0.1% variation rate, 0.15% variation rate, 0.25% variation rate, 0.3% variation rate, 0.5% variation rate, 1% variation rate, 1.2% variation rate or 4% variation rate; more preferably, the low copy number is 800-1200 copies (e.g., 1000 copies), and the low variation frequency is 0.3% -5% (e.g., 0.4%, 1.2%, or 4%); alternatively, the low copy number is 3000-5000 copies (e.g., 4000 copies), and the low variation frequency is 0.075-1.25% (e.g., 0.1%, 0.3%, or 1%); alternatively, the low copy number is 7000-9000 copy numbers (e.g., 8000 copy numbers), and the low variation frequency is 0.03% -1%, e.g., (0.05%, 0.15%, or 0.5%); alternatively, the low copy number is 15000-17000 copies (e.g., 6000 copies) 1, and the low variation frequency is 0.05% to 0.3% (e.g., 0.075% or 0.25%).

In some embodiments, the sample has a copy number of 1000-16000 wild-type gene and 12-40 mutant genes.

The invention also relates to: a method for amplifying a variant target gene fragment, the method comprising the steps of: (1) preparing the mixed reaction system; (2) performing a PCR reaction, wherein the PCR reaction comprises denaturation, annealing and extension; wherein, upon annealing, the non-quenched oligonucleotide probe binds to the wild-type target gene fragment and the variant target gene fragment; upon extension, the non-quenched oligonucleotide probe binds only to the wild-type target gene fragment.

In some specific embodiments, the method is used for amplifying EGFR-T790M variant gene fragments, and the non-quenched nucleotide probe is probe 1, probe 2 or probe 3; the annealing temperature of the probes 1-3 is preferably 56-60 ℃, more preferably 56.5-57.5 ℃, and most preferably 57 ℃; the extension temperature is preferably 66 ℃ to 69 ℃, more preferably 67.5 ℃ to 68.5 ℃, and most preferably 68 ℃.

In some embodiments, the method is used for amplifying a K-ras variant gene fragment, the non-quenched oligonucleotide probe is probe 4, the annealing temperature is preferably 61-63 ℃, more preferably 61.5-62.5 ℃, most preferably 62 ℃, the extension temperature is preferably 71-73 ℃, more preferably 71.5-72.5 ℃, and most preferably 72 ℃; alternatively, the non-quenched oligonucleotide probe is probe 5, the annealing temperature is preferably 65 ℃ to 67 ℃, more preferably 65.5 ℃ to 66.5 ℃, and most preferably 66 ℃, and the extension temperature is preferably 67 ℃ to 69 ℃, more preferably 67.5 ℃ to 68.5 ℃, and most preferably 68 ℃.

In some embodiments, the method is used to amplify EGFR-L858R variation, the non-quenched oligonucleotide probe is Probe 6 or Probe 7, the probes 6-7 are preferably annealed at a temperature of 58-61 deg.C, more preferably at a temperature of 59.5-60.5 deg.C, and most preferably at a temperature of 60 deg.C, and the extension temperature is preferably 67-70 deg.C, more preferably at a temperature of 68.5-69.5 deg.C, and most preferably at a temperature of 69 deg.C.

In some embodiments, the method is used for amplification of EGFR-19-Del, the non-quenched oligonucleotide probe is probe 8 or probe 9, the annealing temperature of the probes 8-9 is preferably 59-61 ℃, more preferably 59.5-60.5 ℃, most preferably 60 ℃, and the extension temperature is preferably 65-68 ℃, more preferably 65.5-66.5 ℃, most preferably 66 ℃.

In some specific embodiments, the method is used for the double amplification of EGFR-L858R and EGFR-19Del, and the non-quenched oligonucleotide probes comprise probe 6 and probe 8; the annealing temperature is preferably 59 ℃ to 61 ℃, more preferably 59.5 ℃ to 60.5 ℃, and most preferably 60 ℃; the extension temperature is preferably from 64 ℃ to 70 ℃, more preferably from 65 ℃ to 68 ℃, most preferably 67 ℃.

In some specific embodiments, the method is used for triple amplification of EGFR-T790M, EGFR-L858R, and EGFR-19Del, the non-quenched oligonucleotide probes comprising Probe 1, Probe 6, and Probe 8; the annealing and elongation temperatures are preferably 56 ℃ to 58 ℃, more preferably 56.5 ℃ to 57.5 ℃, and most preferably 57 ℃.

In some specific embodiments, the test sample of the method is a blood, body fluid, tissue, circulating tumor cells, cfDNA, or fetal early test sample.

In some specific embodiments, the fetal early detection sample is selected from maternal blood, a villus puncture sample, or an amniotic puncture sample.

In some specific embodiments, the method is for non-diagnostic purposes.

The invention also relates to: the oligonucleotide probe, the reagent or the kit, the mixed reaction system or the method can be used for detecting or enriching the target gene variation, and preferably, the enrichment is a database before sequencing.

Definition of terms

The term "match" as used herein means that the nucleotide sequences of the two are identical or satisfy a reverse complementary pair.

The non-quenched oligonucleotide probe refers to the probe which is not marked with a fluorescent group and a quenching group.

Variations described herein include, but are not limited to, point mutations, deletion mutations, frameshift mutations, and insertion mutations.

The primer Mix in the present invention refers to a mixed system containing at least two primers.

In the present invention, a Blocker Mix refers to a mixed system containing at least two probes.

The probe 1, the Ins and the BL27 are the same probe; probe 2 and BL26 are the same probe; probe 3 and BL28 are the same probe; the probe 4 and the K-ras-bock-36 are the same probe; the probe 6 is the same as the L8-BL 3; the probe 7 is the same as the probe L8-BL 4; the probe 8 and the probe 19D-BL1 are the same; the probe 9 and the probe 19D-BL2 are the same; probe 16 is the same probe as Blocker 1; the probe 17 is the same probe as the Blocker 2.

Advantageous effects

Compared with the prior art, the invention has the beneficial effects that:

(1) the invention provides a non-quenching oligonucleotide probe, a reagent and/or a kit, a mixed reaction system, an amplification method and application for targeted amplification of a target gene fragment containing single base variation or multi-base variation, wherein the oligonucleotide probe balances the inhibition of wild-type gene amplification and the inhibition of mutant gene amplification, inhibits the wild-type gene amplification to the maximum limit, avoids influencing the mutant gene amplification, plays a role in high mutant gene enrichment efficiency and good detection sensitivity, and is particularly suitable for samples with low abundance, such as CTC cells, or samples with low variation rate (such as samples with variation rate of 0.05-0.5%).

(2) The probe is a non-quenching oligonucleotide probe, does not mark a fluorescent group and/or a quenching group, is modified by dideoxy, amino or phosphorylation at the 3' end, and the like, and has the advantages of low cost, high flexibility of an enriched detection mode and stable effect.

(3) Aiming at EGFR-T790M, K-ras, EGFR-L858R and EGFR-19Del variant genes, the invention designs and optimizes a probe sequence, a primer pair, an extension and annealing temperature, realizes the enrichment and detection of the variant genes in a low-abundance sample or a sample with low variant rate (such as 0.1 percent variant rate, even 0.05 percent variant rate), and can be used for building a library before sequencing and improving the detection limit of a low-sensitivity PCR kit.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a schematic diagram of the principle of the oligonucleotide probe of the present invention for inhibiting the PCR amplification of wild-type gene (example EGFR-T790M), wherein the inhibitor is the oligonucleotide probe of the present invention;

FIG. 2 PCR amplification results for different cases (wild type sample or variant sample, with or without probe 1, 64 ℃/68 ℃/72 ℃/76 ℃) with the inhibitor, probe 1 described in example 1;

FIG. 3 shows the effect of probes 1-3 (i.e., BL26/27/28) described in example 1 on amplification of EGFR-T790M wild-type gene;

FIG. 4 shows the effect of probes 1-3 (i.e., BL26/27/28) described in example 1 on EGFR-T790M mutant gene amplification, where the curves represent, according to the Ct values from small to large, no probe control (i.e., no Block control), BL26 (i.e., probe 2), BL27 (i.e., probe 1), and BL28 (i.e., probe 3), respectively;

FIG. 5 shows the sequencing results of PCR products of EGFR-T790M template with different variation rates and different copy numbers (example 1);

FIG. 6 is a graph of the amplification effect of Probe 1 (i.e., BL27) on CTC recovered samples (example 1);

FIG. 7 is a graph showing the effect of probes 10-12 on the results of wild-type amplification of EGFR-T790M (example 1);

FIG. 8 is a graph showing the effect of probes 10-12 on the amplification results of EGFR-T790M variant (example 1);

FIG. 9 is a graph showing the effect of probe 4 (i.e., Kras-block-36) on the amplification result of a wild-type K-ras gene (example 2);

FIG. 10 is a graph showing the effect of probe 4 (i.e., Kras-block-36) on the amplification result of the mutant K-ras gene (G12V) (example 2);

FIG. 11 is a graph showing the effect of probe 4, Kras-block-36, on the amplification result of the mutant K-ras gene (G13D) (example 2);

FIG. 12 shows the amplification results of wild-type K-ras gene under the extension condition at 72 ℃ (example 2);

FIG. 13 shows the amplification results of wild-type K-ras gene under extension conditions at 73 ℃ (example 2);

FIG. 14 shows the amplification result of a mutant K-ras gene (G12V) under extension conditions at 73 ℃ (example 2);

FIG. 15 shows the amplification result of a mutant K-ras gene (G12V) under extension conditions at 73 ℃ (example 2);

FIG. 16 shows the amplification result of a mutant K-ras gene (G13D) under the extension condition at 72 ℃ (example 2);

FIG. 17 shows the amplification result of a mutant K-ras gene (G13D) under extension conditions at 73 ℃ (example 2);

FIG. 18 shows the results of fluorescent PCR amplification on the enriched K-ras gene variation sample (variation rate of 0.5%) (example 2);

FIG. 19 is the Ct value data of fluorescence PCR on the enriched K-ras gene variation sample (variation rate of 0.5%) (example 2);

FIG. 20 shows the results of fluorescent PCR amplification on the enriched K-ras gene variation sample (variation rate of 0.25%) (example 2);

FIG. 21 shows Ct value data of fluorescence PCR on enriched K-ras gene variation sample (variation rate of 0.25%) (example 2);

FIG. 22 shows the results of PCR amplification of plasmid S009 with different copy numbers (example 2);

FIG. 23 is a standard graph (example 2);

FIG. 24 shows the blocking effect of probes 13 to 15 on wild-type K-ras gene (example 2);

FIG. 25 shows the blocking effect of probe 5 on the wild-type K-ras gene (example 2);

FIG. 26 shows the blocking effect of probe 5 on variant G12V (example 2);

FIG. 27 shows the blocking effect of probe 5 on variant G13D (example 2);

FIG. 28 shows the blocking effect of probe 6 (i.e., L8-BL3) and probe 13(L8-BL4) on wild-type EGFR-L858R gene (example 3);

FIG. 29 shows the blocking effect of probes 6 (i.e., L8-BL3) and 13(L8-BL4) on the mutant EGFR-L858R gene (example 3);

FIG. 30 shows the blocking effect of probe 7(L8-BL4) on the mutant EGFR-L858R gene after optimization of reaction conditions (example 3);

FIG. 31 shows the sequencing results of PCR products of EGFR-L858R wild-type template (example 3);

FIG. 32 shows the sequencing results of PCR products of EGFR-L858R variant template with a variation rate of 0.1% (example 3);

FIG. 33 shows the sequencing results of PCR products of EGFR-L858R variant template with a variation rate of 0.2% (example 3);

FIG. 34 shows the sequencing results of PCR products of EGFR-L858R variant template with a variation rate of 0.5% (example 3);

FIG. 35 shows the sequencing results of PCR products of EGFR-L858R variant template with a variation rate of 1% (example 3);

FIG. 36 shows the effect of probes 16-17 (i.e., Blaker 1 and Blocker2) on amplification of EGFR-L858R wild-type template (example 3);

FIG. 37 shows the effect of probes 16-17 (i.e., Blaker 1 and Blocker2) on amplification of EGFR-L858R variant templates (example 3);

FIG. 38 shows the effect of probes 8-9 (i.e., 19D-BL1, 19D-BL2) on amplification of EGFR-19Del wild-type template (example 4);

FIG. 39 shows the effect of probes 8-9 (i.e., 19D-BL1, 19D-BL2) on amplification of EGFR-19Del variant template (example 4);

FIG. 40 is the sequencing result of PCR product of EGFR-19Del wild-type template (example 4);

FIG. 41 shows the sequencing results of PCR products of EGFR-19Del variant template with a variation rate of 0.1% (example 4);

FIG. 42 shows the sequencing results of PCR products of EGFR-19Del variant template with a variation rate of 0.2% (example 4);

FIG. 43 shows the sequencing results of PCR products of EGFR-19Del variant template with a variation rate of 0.5% (example 4);

FIG. 44 shows the sequencing results of PCR products of EGFR-19Del variant template with a variation rate of 1% (example 4);

FIG. 45 shows the results of amplification of EGFR-19Del wild type in two PCR pools with the kit of example 5;

FIG. 46 shows the results of amplification of EGFR-19Del mutant in two PCR pools using the kit of example 5;

FIG. 47 shows the amplification results of EGFR-L858R wild type in two PCR pools with the kit provided in example 5;

FIG. 48 shows the results of amplification of EGFR-L858R mutant in two PCR pools using the kit of example 5;

FIG. 49 shows the sequencing results of PCR products of EGFR-19Del wild-type template after two PCR pools of the kit provided in example 5;

FIG. 50 shows the sequencing results of the PCR products of 0.1% EGFR-19Del mutant templates after two PCR pools of the kit provided in example 5;

FIG. 51 is the sequencing results of the PCR products of 0.2% EGFR-19Del mutant template after two PCR pools of the kit provided in example 5;

FIG. 52 shows the sequencing results of the PCR products of 0.5% EGFR-19Del mutant templates after two PCR pools of the kit provided in example 5;

FIG. 53 shows the sequencing results of the PCR products of 1% EGFR-19Del mutant templates after two-fold PCR pooling using the kit provided in example 5;

FIG. 54 shows the sequencing results of the PCR products of EGFR-L858R wild-type template after two PCR pools of the kit provided in example 5;

FIG. 55 shows the sequencing results of the PCR products of 0.1% EGFR-L858R mutant templates after two PCR pools with the kit of example 5;

FIG. 56 is the sequencing results of the PCR products of 0.2% EGFR-L858R mutant template after two PCR pools with the kit provided in example 5;

FIG. 57 shows the sequencing results of the PCR products of 0.5% EGFR-L858R mutant templates after two PCR pools with the kit of example 5;

FIG. 58 shows the sequencing results of the PCR products of 1% EGFR-L858R mutant templates after two PCR pools of the kit provided in example 5;

FIG. 59 shows the results of amplification of EGFR-19Del wild type in a triple PCR library set up with the kit provided in example 6;

FIG. 60 shows the results of amplification of EGFR-19Del mutant in a triple PCR library using the kit of example 6;

FIG. 61 shows the results of amplification of EGFR-T790M wild type in a triple PCR library set up with the kit provided in example 6;

FIG. 62 shows the results of amplification of EGFR-T790M mutant in a triple PCR library using the kit provided in example 6;

FIG. 63 shows the results of amplification of EGFR-L858R wild type in a triple PCR library set up using the kit provided in example 6;

FIG. 64 shows the results of amplification of EGFR-L858R mutant in a triple PCR library using the kit of example 6;

FIG. 65 shows the sequencing results of the PCR products of EGFR-19Del wild-type template after triple PCR pooling with the kit provided in example 6;

FIG. 66 shows the sequencing results of the PCR products of 0.1% EGFR-19Del mutant templates after triple PCR pooling with the kit provided in example 6;

FIG. 67 is the sequencing results of the PCR products of 0.2% EGFR-19Del mutant templates after triple PCR pooling with the kit provided in example 6;

FIG. 68 is the sequencing results of the PCR products of 0.5% EGFR-19Del mutant template after triple PCR pooling with the kit provided in example 6;

FIG. 69 shows the sequencing results of the PCR products of 1% EGFR-19Del mutant templates after triple PCR pooling with the kit provided in example 6;

FIG. 70 shows the sequencing of the PCR product of the EGFR-T790M wild-type template after triple PCR pooling with the kit provided in example 6;

FIG. 71 shows the sequencing results of the PCR products of 0.1% EGFR-T790M mutant template after triple PCR pooling with the kit provided in example 6;

FIG. 72 is a sequence of the PCR products of 0.2% EGFR-T790M mutant template after triple PCR pooling with the kit provided in example 6;

FIG. 73 shows the sequencing results of the PCR products of 0.5% EGFR-T790M mutant template after triple PCR pooling with the kit provided in example 6;

FIG. 74 is the sequencing results of the PCR products of 1% EGFR-T790M mutant template after triple PCR pooling with the kit provided in example 6;

FIG. 75 shows the sequencing results of the PCR products of EGFR-L858R wild-type template after triple PCR pooling with the kit provided in example 6;

FIG. 76 shows the sequencing results of the PCR products of 0.1% EGFR-L858R mutant templates after triple PCR pooling with the kit provided in example 6;

FIG. 77 shows the sequencing results of the PCR products of 0.2% EGFR-L858R mutant templates after triple PCR pooling with the kit provided in example 6;

FIG. 78 shows the sequencing results of the PCR products of 0.5% EGFR-L858R mutant templates after triple PCR pooling with the kit provided in example 6;

FIG. 79 shows the sequencing results of the PCR products of 1% EGFR-L858R mutant templates after triple PCR pooling with the kit provided in example 6.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by manufacturers, and are all conventional products available on the market.

Example 1 EGFR-T790M

1. Oligonucleotide probes designed to amplify the EGFR-T790M variant gene were designated Probe 1 (also known as the Inhibitor Sequence, InS, or BL27) and the upstream (FP) and downstream (RP) primers. The working principle of the probe 1 is shown in fig. 1: (I) LNA-modified oligonucleotides mismatch with variants and can bind to the template strand when annealed at low temperatures, but mismatches make the binding weak. When the temperature is raised to a certain temperature in the extension stage, the oligonucleotide probe is separated from the variant template strand, so that the variant DNA sequence is normally amplified; (II) LNA modified oligonucleotide probe perfectly matched the wild type sequence and bound strongly to the template strand during annealing at low temperature, even when the temperature was raised to 68 ℃ during the extension phase, the oligonucleotide probe could not be separated from the template strand, and amplification of the wild type DNA sequence was inhibited.

Probe 1 specific nucleotide information:

5'-TCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCC-3' (SEQ ID NO: 1), wherein the underlined nucleotides are modified with locked nucleic acids and the 3' terminus is dideoxy modified.

An upstream primer: 5'-CATGCGAAGCCACACTGAC-3' (SEQ ID NO: 10); a downstream primer: 5'-GTCTTTGTGTTCCCGGACATAGTCCAGG-3' (SEQ ID NO: 11).

2. Detecting the influence of the probe 1 on the amplification effect of the EGFR-T790M variant gene under different conditions, comprising the following steps:

(1) template extraction: the extracted DNA of the EGFR-T790M mutant cell line NCl-H1975 cell at a concentration of 7 ng/. mu.L was used as a template. Wild-type healthy human leukocyte (WBC) DNA was extracted at a concentration of 7 ng/. mu.L as a template.

(2) Preparing a PCR reaction system: (ii) an InS reaction system: the amount of 2 XPCR Multi Premix was 25. mu.L, the amount of 5U/. mu.L Taq enzyme was 2. mu.L, the amount of 10. mu.M forward primer was 1.2. mu.L, the amount of 10. mu.M reverse primer was 1.2. mu.L, the amount of 10. mu.M Probe 1 was 1.2. mu.L, the amount of 20 XPGreen was 5. mu.L, the amount of water was 9.4. mu.L and the amount of DNA template was 5. mu.L.

(ii) -Ins reaction system: the amount of 2 XPCR buffer Multi Premix was 25. mu.L, the amount of 5U/. mu.L of the enzyme LTaq was 2. mu.L, the amount of 10. mu.M forward primer was 1.2. mu.L, the amount of 10. mu.M reverse primer was 1.2. mu.L, the amount of 20 XPVAGreen was 5. mu.L, the amount of water was 10.6. mu.L and the amount of DNA template was 5. mu.L.

(3) PCR reaction procedure: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 57 ℃ for 45 sec; extension (collection of fluorescence signal) 64/68/72/76 ℃, 30 sec; a total of 40 cycles; ③ Final extension: 72 ℃, 7min, for a total of 1 cycle.

(4) And (4) analyzing results: the fluorescence signal during the PCR reaction is shown in FIG. 2. From the results shown in FIG. 2, it can be seen that:

adding a probe 1 into a reaction system, and when the extension temperature is 64 and 68 ℃, combining the probe 1 with a wild template chain, and inhibiting the amplification of wild DNA; when the extension temperature is 72 ℃ and 76 ℃, probe 1 and the wild-type template strand are melted, amplification of the wild-type DNA sequence cannot be inhibited, and the higher the temperature is, the more thoroughly the probe 1 and the template strand are melted.

Secondly, the probe 1 can be combined with the variant template chain during low-temperature annealing, but when the temperature is raised to 64 ℃ in the extension stage, the probe and the variant template chain are partially melted; when the extension temperature is increased to 68 ℃ or above, the inhibitor and the variant template are completely melted, and the variant DNA is amplified as the melting is more complete at higher temperature.

In summary, the elongation temperature of 68 ℃ is selected as the optimum elongation temperature because the wild-type amplification can be effectively inhibited without substantially affecting the variant amplification.

3. Designing oligonucleotide probes 2-3 of the same kind (similar to probe 1, the length is equivalent, the oligonucleotide probes are all modified by locked nucleic acid, and the 3' tail end is modified by dideoxy), wherein the specific nucleic acid information of the oligonucleotide probes 2-3 is as follows:

probe 2 (aka BL 26): GTGCAGCTCATCACGCAGCTCATGCCCT (SEQ ID NO: 2), the locked nucleic acid modification is underlined, and the 3' terminus is the dideoxy modification.

Probe 3 (aka BL 28): GTGCAGCTCATCACGCAGCTCATGCCCT (SEQ ID NO: 3), the locked nucleic acid modification is underlined, and the 3' terminus is the dideoxy modification.

4. Detecting the amplification effect of the probes 1-3 on the EGFR-T790M variant gene, comprising the following steps:

(1) template extraction: the extracted EGFR-T790M mutant cell line NCl-H1975 cell DNA is used as a mutant template. The extracted DNA of wild type healthy human leucocyte (WBC) was used as a wild type template.

(2) Preparing a PCR reaction system: 2 XPCR Multi Premix was used at 12.5. mu.L, SYBR Green at 0.75. mu.L, 5U/. mu.L Taq enzyme at 0.8. mu.L, 10 XPrimer Mix (2.5. mu.M) at 2.5. mu. L, DNA template (7 ng/. mu.L) at 2.5. mu.L, water at 3.45. mu.L and 1. mu.M probe 1/2/3 at 2.5. mu.L (note that the same volume of water as the probe was added as a control without probe).

(4) And (3) analyzing an amplification result: FIGS. 3-4 show the fluorescence signals during the PCR reaction described above. As is clear from the results shown in FIG. 3, the amplification of the wild-type gene was blocked in all of probes 1 to 3, and the blocking effect was the best with probe 1. From the results shown in FIG. 4, it was found that the probes 1 to 3 had a small effect on the amplification of mutant genes.

5. Detecting the amplification influence of the probe 1 on EGFR-T790M gene variation samples with different copy numbers and different proportions, specifically comprising the following steps:

(1) sample preparation: EGFR-T790M mutant cell line NCI-H1975DNA, concentration 100 copies/. mu.L, designated C1; EGFR-T790M wild type cell line HEK293T DNA at a concentration of 1X 10⁵Copy/. mu.L, named D1; the copy numbers were verified by a digital PCR instrument (model: Bio-Rad QX 200). Test samples were prepared according to the following table:

TABLE 1

(2) Preparing a PCR reaction system and setting a PCR reaction program: the amount of 2 XPCR Multi Premix was 25. mu.L, the amount of 20 XPVAgren was 5. mu.L, the amount of 5U/. mu.L Taq enzyme was 2. mu.L, the amount of the forward primer (10. mu.M) was 3. mu.L, the amount of the reverse primer (10. mu.M) was 3. mu. L, DNA, the amount of the template was 2. mu. L, NF-water was 4. mu.L, and the amount of the 10. mu.M probe 1 was 6. mu.L.

(3) PCR reaction procedure: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 57 ℃ for 45 sec; extension (collection of fluorescence signal) 68, 30 sec; a total of 40 cycles; ③ Final extension: 72 ℃, 7min, for a total of 1 cycle.

(4) Sanger sequencing was performed on the results of the PCR reaction, and the specific sequencing results are shown in FIG. 5. According to the Sanger sequencing result shown in FIG. 5, the EGFR c.2369C > T (T790M) wild type is from 1000-16000 copies, and the method can ensure that the result is wild type, namely the wild type base C is at the EGFR c.2369. When the mutant is 4 copies and the wild type is 1000 to 8000 copies, the method can detect that the position of EGFR c.2369 is positive in the coexistence state of T/C bases; the wild type is expanded to 16000 copies, the mutant information can not be detected by sequencing, and only the wild type base C can be obtained; when the mutant is expanded to 12-40 copies, the wild type background can still detect positive from 1000-16000 copies, and is a single mutant base "T". In conclusion, the method can detect 4 mutant copies, and the mutation frequency under the background of 8000 wild-type copies is 0.05 percent of the mutation frequency.

6. Detecting the amplification influence of the probe 1 on the CTC recovered cell sample, specifically comprising the following steps:

(1) sample preparation: adding 200 SKBR-3 cells or 200 NCI-H1975 cells into blood of normal human, enriching the sample by using a circulating tumor cell separation and enrichment system, eluting the cells captured in the chip to obtain SKBR-3 cells and NCI-H1975 cells recovered from the blood, and using a cell lysate kit to lyse the recovered cells to respectively serve as a wild type sample and a mutant type sample.

(2) Preparing a PCR reaction system: the amount of 2 XPCR Multi Primix was 12.5. mu.L, the amount of SYBR Green was 0.75. mu.L, the amount of 5U/. mu.L Taq enzyme was 0.8. mu.L, the amount of 10. mu.M forward primer was 0.625. mu.L, the amount of 10. mu.M downstream primer was 0.625. mu.L, the amount of cleaved DNA sample was 6.5. mu.L, the amount of water was 0.7. mu.L, and the amount of 1. mu.M Probe 1 was 2.5. mu.L (Note that the same volume of water as the probe was added as a control group without the probe).

(3) Setting a PCR reaction program: referring to section 4 of this example, the extension temperature was chosen to be 68 ℃.

(4) And (3) analyzing an amplification result: the signals during the PCR reaction are shown in FIG. 6. As can be seen from the results shown in fig. 6, in the CTC sample, the probe 1 can block amplification of the wild-type template, has little effect on the mutant, and can normally amplify the mutant, thereby enriching the mutant gene.

7. Detecting the influence of the probe 1 on the enrichment of the variant product and the detection efficiency of a subsequent PCR kit (EGFR-T790M variant), specifically comprising the following steps:

(1) preparing a variant enriched product: samples with different variation ratios were prepared using DNA extracted from leukocytes of healthy persons as a wild-type DNA template and DNA extracted from NCI-H1975 cells as a variant template, and the sample information is shown in Table 2.

TABLE 2

(2) Preparing a PCR reaction system: 2 XPCR Multi Premix was used at 12.5. mu. L, Taq enzyme at 0.8. mu.L (5U/. mu.L), 10 XPrimer Mix (2.5. mu.M) at 2.5. mu. L, DNA template (sample size: 7 ng/. mu.L; 5% variant, 0.5% variant and wild type) at 2.5. mu.L, water at 4.2. mu.L, 1. mu.M probe 1 at 2.5. mu.L; for 0.1% of the variant samples, 5. mu.L of water, 1.7. mu.L of water and 2.5. mu.L of 1. mu.M of probe 1 were used.

(3) Setting a PCR reaction program: referring to section 4 of this example, the extension temperature was selected to be 68 ℃, the number of cycles of denaturation, annealing and extension was set to be 15, and the product after the PCR reaction was completed was the enriched product.

(4) Evaluating the influence of the enriched product on the detection efficiency of the PCR kit: the plasma cfDNA sample was simulated with a 10% variant sample to which 3 μ L of the enriched product was added as the sample to be tested. The detection was performed using an EGFR genetic variation detection kit (fluorescence PCR) of jiangsu, genuine bio-pharmaceutical technology, ltd, wherein the sample information is shown in table 3, and the detection results are shown in table 4. According to the results shown in table 4, the addition of the mutation-enriched product can improve the CT value of the sample, which indicates that the proportion of the mutant gene is significantly improved after the low-mutation-proportion sample is enriched, thereby improving the detection efficiency of the PCR kit.

TABLE 3

TABLE 4

Comparative example

Other different classes of oligonucleotide probes 10-12 were designed for comparison (comparable in length to probe 1, but not modified by the locked nucleic acid, with the same or different modifications at the 3' end) and evaluated for their effect on the amplification of the mutated gene:

(1) the specific nucleic acid information for oligonucleotide probes 10-12 is shown below:

a probe 10: 5'-GTGCAGCTCATCACGCAGCTCATGCCCT-3' (SEQ ID NO: 18), wherein the 3' end T is modified with a C3 spacer.

A probe 11: 5'-GTGCAGCTCATCACGCAGCTCATGCCCT-3' (SEQ ID NO: 19), wherein the C7 position of the T at the 3' end is modified with an amino group.

The probe 12: 5'-GTGCAGCTCATCACGCAGCTCATGCCCT-3' (SEQ ID NO: 20), wherein the 3' end T is modified by dideoxy.

(2) Detecting the amplification effect of the probes 10-12 on the wild-type and variant DNAs of EGFR-T790M: the effect of the oligonucleotides on the blocking of wild-type DNA was evaluated by performing PCR using DNA extracted from healthy human leukocytes as a wild-type DNA template and DNA extracted from NCI-H1975 cells as a variant template. The experimental grouping information is shown in table 5, the PCR reaction system is shown in section 4 of this example, and the PCR reaction procedure is shown below: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 57 ℃ for 45 sec; extension (collection of fluorescence signal) 72 ℃, 30 sec; a total of 40 cycles; ③ Final extension: 72 ℃, 7min, for a total of 1 cycle. The amplification results are shown in FIGS. 7-8. From the results shown in FIGS. 7-8, it can be seen that probes 10-12 failed to block amplification of the wild-type DNA of EGFR-T790M.

Example 2K-ras

1. Oligonucleotide probes for amplifying K-ras variant genes are designed and named as probe 4 (also named as K-ras block-36), an upstream primer (FP) and a downstream primer (RP), and the influence of the probe on amplification of wild-type and variant K-ras genes is detected. Wherein:

(1) probe 4 specific nucleotide information: 5' -GGTAGTTGGAGCTGGTGGCGTAGGCAAGAG-3'(SEQ ID NO: 4), wherein the underlined nucleotides are modified with a locked nucleic acid and the 3' terminus is dideoxy modified.

(2) An upstream primer: 5'-AAGCGTCGATGGAGGAGTTTGTAAAT-3' (SEQ ID NO: 12); a downstream primer: 5'-GTTGGATCATATTCGTCCACAA-3' (SEQ ID NO: 13).

(3) The effect of the blocking oligonucleotide on the amplification of the wild-type and variant K-ras genes was examined by PCR amplification using DNA extracted from NCI-H1975 cells as the wild-type DNA template and DNA extracted from SW620, MDA-MB231 cells as the variant template. The reaction system used for PCR amplification is shown as follows: the 2 XPCR Multi Premix was used at 10. mu.L, SYBR Green at 0.6. mu. L, Taq enzyme, 5U/. mu.L at 0.6. mu.L, 5. mu.M upstream primer at 1. mu.L, 5. mu.M downstream primer at 1. mu. L, DNA template (wild-type or variant template, 7 ng/. mu.L) at 2. mu.L, water at 4.3. mu.L and 5. mu.M probe 4 at 0.5. mu.L (Note: same volume of water was added as control without probe 4). The PCR reaction procedure is as follows: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 62 ℃ for 30 sec; extension (collection of fluorescence signal) 72 ℃, 45 sec; a total of 35 cycles; ③ Final extension: 72 ℃, 7min, for a total of 1 cycle.

The amplification results of the wild-type DNA template and the variant DNA template are shown in FIGS. 9 to 11, respectively. As is clear from the results shown in FIGS. 9 to 11, the oligonucleotide for blocking of the present example had an excellent blocking effect on the amplification of the wild-type K-ras gene, but did not adversely affect the amplification of the two variant K-ras genes (G12V and G13D).

2. The influence of the probe 4 on the amplification of wild-type and variant K-ras genes under different extension conditions is detected: the DNA extracted from NCI-H1975 cells is used as a wild type DNA template, the DNA extracted from SW620 and MDA-MB231 cells is used as a variant template, PCR amplification is carried out, and the influence of the probe 4 on the amplification of wild type and variant K-ras genes is detected. Wherein, the using condition of the probe 4 and the primer, the PCR reaction system and the PCR reaction program in the PCR amplification process are shown in section 1 of this embodiment, but the difference is that this embodiment not only detects the PCR amplification effect under the condition of the extension temperature of 72 ℃, but also detects the PCR amplification effect under the condition of the extension temperature of 73 ℃, and the specific detection results are shown in FIGS. 12-17. As can be seen from the amplification results shown in FIGS. 12 to 17, the probe 4 of this example has a good blocking effect on the amplification of the wild-type K-ras gene under the extension conditions of 72 ℃ or 73 ℃ with no or little adverse effect on the amplification of the variant K-ras gene.

3. The influence of the probe 4 in the present example on the amplification effect of the variant K-ras gene with different ratios and types is detected, which comprises the following steps:

(1) synthesizing different types of Kras variant genes with variant second exons respectively: G12D, G12A, G12V, G12C, G12S, G12R and G13D mutant and wild-type plasmids are prepared into samples with the mutation ratio of 0.5 percent and 0.25 percent, and PCR reaction for enriching and amplifying mutant K-ras gene is carried out, wherein a specific PCR reaction system is used for PCR amplification as follows: the 2 XPCR Multi Premix was used at 10. mu.L, SYBR Green at 0.6. mu. L, Taq enzyme, 5U/. mu.L at 0.6. mu.L, Primer Mix (40. mu.M) at 0.5. mu. L, DNA template (samples of different variation ratios) at 2. mu.L, water at 5.8. mu.L and 20. mu.M probe 4 (i.e.K-ras block-36) at 0.5. mu.L. PCR reaction procedure referring to section 1 of this example, the only difference is that the number of cycles for denaturation, annealing and extension is 15.

(2) After the PCR reaction, the enriched product was diluted 25 times, and fluorescence PCR detection was performed using seven mutation detection kits (fluorescence PCR method) for human K-ras gene (fluorescence PCR method), with a detection limit of 1%, in wuhan heijili biotechnology limited, where the fluorescence PCR detection results of samples with a mutation rate of 0.5% are shown in fig. 18 to 19, and the fluorescence PCR detection results of samples with a mutation rate of 0.25% are shown in fig. 20 to 21. FIGS. 18 and 20 show partial amplification results, and FIGS. 19 and 21 show amplification results of seven different variant K-ras genes. According to the detection results shown in fig. 20-21, the probe 4 of the embodiment 1 of the present invention can perform enrichment amplification on a DNA template containing trace variations (0.25%), and the amplified enriched product can detect low-abundance variations by using a fluorescence PCR detection kit.

4. The detection probe 4 and the amplification efficiency of the upstream primer and the downstream primer in a PCR reaction system are as follows:

plasmid S009 containing a variant fragment of the K-ras second exon G12D was diluted to 10⁸Copy/. mu.L, 10⁷Copy/. mu.L, 10⁶Copy/. mu.L, 10⁵Copy/. mu.L, 10⁴The samples were copied/. mu.L and PCR reaction was performed. Wherein, the PCR reaction system is as follows: the 2 XPCR Multi Premix was used at 10. mu.L, SYBR Green at 0.6. mu. L, Taq enzyme, 5U/. mu.L at 0.6. mu.L, 5. mu.M upstream primer at 2. mu.L, 5. mu.M downstream primer at 2. mu. L, DNA template (wild-type or variant template, 7 ng/. mu.L), water at 0.8. mu.L, and probe 4 (i.e.K-ras block-36, 5. mu.M) at 2. mu.L (Note: same volume of water was added as a control without probe 4). PCR reaction procedure reference is made to section 1 of this example. The amplification results are shown in FIG. 22. According to the amplification result shown in FIG. 22, the log value of the sample copy number is plotted as the abscissa and the Ct value of the amplification curve is plotted as the ordinate to prepare the standard curve shown in FIG. 23 and its formula y-3.387 x +34.882, R2-0.9974. Use the expansionThe formula of the efficiency is as follows: the slope was-1/lg (1+ e), and the calculated amplification efficiency e was 1.972, corresponding to a percent amplification efficiency of 97.2%.

5. Designing other modified oligonucleotide probes (probes 13-15), and evaluating the amplification influence of the oligonucleotide probes on K-ras mutant genes and wild-type genes, wherein:

(1) and (3) probe 13: 5'-GGAGCTGGTGGCGTAGGCAAGAGTGCC-3' (SEQ ID NO: 21), which is modified at its 3' terminus with a C3 spacer;

the probe 14: 5'-GGAGCTGGTGGCGTAGGCAAGAGTGCC-3' (SEQ ID NO: 22), modified with an amino group at the C7 position at the 3' terminus;

and (3) probe 15: 5'-GGAGCTGGTGGCGTAGGCAAGAGTGCC-3' (SEQ ID NO: 23), which has been dideoxy modified at its 3' terminus.

(2) The effect of probes 13-15 on the amplification of K-ras wild-type and variant genes was evaluated by PCR using DNA extracted from NCI-H1975 as the wild-type DNA template and DNA extracted from SW620, MDA-MB231 cells as the variant template. The experimental groups are shown in Table 5, and the PCR reaction system is as follows: the 2 XPCR Multi Premix was used at 10. mu.L, SYBR Green at 0.6. mu. L, Taq enzyme, 5U/. mu.L at 0.6. mu.L, Primer Mix (5. mu.M) at 2. mu. L, DNA template (wild-type or variant template, 7 ng/. mu.L) at 2. mu.L, water at 2.8. mu.L, and probe 13/14/15 (i.e.K-ras block-1/K-ras block-2/K-ras block-3, 5. mu.M) at 2. mu.L (note: same volume of water was added as a control without probe 4). The PCR reaction procedure is described in section 1 of this example, but the annealing temperature is 58 ℃ and the extension temperature is 72 ℃.

(3) The specific detection results of the probes 13 to 15 are shown in FIG. 24. From the detection results shown in FIG. 24, it was found that the amplification curves of the mutant DNA and the wild-type DNA in reaction group 1 overlapped and could not be distinguished (red), and similarly, the amplification curves of the mutant DNA and the wild-type DNA could not be distinguished in reaction group 2 (green), reaction group 3 (yellow) and reaction group (magenta). Therefore, the probes 13-15 have no blocking effect on wild K-ras genes.

TABLE 5 grouping information

6. Other oligonucleotide probes (probe 5) with locked nucleic acid modifications were designed and evaluated for their effect on the amplification of K-ras mutant and wild-type genes, where:

(1) and 5, probe: 5' -TGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTG-3 '(SEQ ID NO: 5), wherein the underlined nucleotides are modified with a locked nucleic acid and the 3' terminus is modified with a C3 spacer.

(2) DNA extracted from NCI-H1975 is used as a wild type DNA template, DNA extracted from SW620 and MDA-MB231 cells is used as a variant template, a probe 5 is added for PCR reaction, and the influence of the probe 5 on the amplification efficiency is detected. The grouping information is shown in table 6. The PCR reaction system is shown below: 2 XPCR Multi Premix was used at 10. mu.L, SYBR Green at 0.6. mu. L, Taq enzyme, 5U/. mu.L at 0.6. mu.L, Primer Mix (5. mu.M) at 2. mu. L, DNA template (wild-type or variant template, 7 ng/. mu.L) at 2. mu.L, water at 2.8. mu.L and probe 5 (5. mu.M) at 2. mu.L (Note: same volume of water was added as control without probe 4). The PCR reaction procedure is described in section 1 of this example, except that the annealing temperature is 66 ℃ and the extension temperature is 68 ℃.

TABLE 6 grouping information

(3) See FIGS. 25-27 for specific effects of Probe 5 on PCR reactions. The results shown in FIGS. 25 to 27 indicate that probe 5 had a blocking effect on the wild-type K-ras gene sample (see FIG. 25), had no inhibitory effect on variant G12V, and that the G12V sample was able to be normally amplified (see FIG. 26), but the amplification of the variant G13D sample was blocked (see FIG. 27).

Example 3 EGFR-L858R

1. Designing oligonucleotide probes (named as probe 6 and probe 7), upstream primers and downstream primers for amplifying EGFR-L858R variant gene, and detecting their influence on amplification effect of EGFR-L858 variant gene and wild-type gene,

(1) probe 6 (also known as L8-BL 3): CACAGATTTTGGGCTGGCCAAACTGCTGGGTG (SEQ ID NO: 6), the nucleic acid modification is underlined, and the dideoxy modification is at the 3' terminus;

probe 7 (also known as L8-BL 4): ATTTTGGGCTGGCCAAACTGCTGG (SEQ ID NO: 7), the nucleic acid modification is underlined, and the dideoxy modification is at the 3' terminus;

upstream primer (5 '-3'): TACTTGGAGGACCGTCGCTT (SEQ ID NO: 14), downstream primer (5 '-3'): GCTGACCTAAAGCCACCTCCTTA (SEQ ID NO: 15).

(2) The influence of the probes 6-7 on the amplification effect of EGFR-L858R mutant gene and wild-type gene was examined by using DNA extracted from healthy human leukocytes as wild-type DNA template and DNA extracted from NCI-H1975 cells as mutant template. Wherein the PCR reaction system is as follows: the amount of 2 XPCR Multi Premix was 10. mu.L, the amount of SYBR Green was 0.6. mu.L, the amount of 5U/. mu.L Taq enzyme was 0.4. mu.L, the amount of 10 XPrimer Mix (10. mu.M) was 1. mu. L, DNA template (wild type or variant template, 7 ng/. mu.L), the amount of water was 5.5. mu.L, and the amount of 10. mu.M probe 6/7 was 0.5. mu.L (note that the same volume of water as the probe was added as a control without probe). The PCR reaction procedure is as follows: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 60 ℃ for 45 sec; extension (collection of fluorescence signal) 69 ℃, 30 sec; a total of 35 cycles; ③ Final extension: 72 ℃, 7min, for a total of 1 cycle.

The amplification results of the wild-type template are shown in FIG. 28, and the amplification results of the variant template are shown in FIG. 29. FIGS. 28-29 show that probe 6 and probe 7 can both block amplification of the wild-type gene, and that probe 7 has the best blocking effect, probe 6 and probe 7 both have a certain effect on the amplification of the variant, and probe 7 has a smaller effect on the amplification of the variant, but there is still room for optimization. The amplification results of the variant template obtained by optimizing the reaction conditions for the probe 7 (the extension temperature was adjusted to 66 ℃) are shown in FIG. 30.

2. The enrichment effect of the detection probe 7 on the mutant genes in samples with different mutation ratios is as follows: samples with different mutation ratios were prepared using DNA extracted from leukocytes of healthy persons as a wild-type DNA template and DNA extracted from NCI-H1975 cells as a variant template, and the sample information is shown in Table 7. PCR reaction System referring to section 1 of this example, the PCR reaction procedure is as follows: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 60 ℃ for 45 sec; extension (collection of fluorescence signal) at 66 ℃, 30 sec; a total of 40 cycles; ③ Final extension: 72 ℃, 7min, for a total of 1 cycle. The amplification products were submitted for first-generation sequencing, and the results are shown in FIGS. 31 to 35. FIGS. 31-35 show that probe 7 can perform enrichment amplification on DNA templates containing minor variations (0.1%), and EGFR-L858R variations can be detected by first-generation sequencing, although the 0.1% and 0.2% sample machine readings are still T, but the intensity of G increases with the increase of the variation concentration ratio; the wild type shows no mutation information.

TABLE 7

Sample(s)	Dosage (. mu.L) of NCI-H1975 at a concentration of 0.07 ng/. mu.L	WBC dosage (μ L) at concentration of 7 ng/. mu.L
			0.10％	20	200
0.20％	40	200
			0.50％	50	100
1％	100	100
			Wild type	0	200

5. Designing other oligonucleotide probes modified by locked nucleic acid, named probes 16-17, and evaluating the influence of probes 16-17 on the amplification results of mutant genes and wild-type genes, including:

(1) probe 16 (aka packer 1): GATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCGG (SEQ ID NO: 24); probe 17 (aka Blocker 2): GTCAAGATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCG(SEQ ID NO：25)。

(2) The influence of the probes 16 to 17 on the amplification results was evaluated by PCR using DNA extracted from healthy human leukocytes as a wild-type DNA template and DNA extracted from NCI-H1975 cells as a variant template. Wherein the PCR reaction system is as follows: 2 XPCR Multi Premix was used at 10. mu.L, SYBR Green at 0.4. mu.L, 10 XPrimer Mix (10. mu.M) at 1. mu. L, DNA template (7 ng/. mu.L), water at 6.1. mu.L, 10. mu.M probe 16/17 at 0.5. mu.L (note that the same volume of water as the probe was added as a control without probe). The PCR reaction procedure is as follows: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 70 ℃ for 20sec/60 ℃ for 35 sec; extension (collection of fluorescence signal) 70 ℃, 30 sec; a total of 35 cycles; ③ Final extension: 72 ℃, 7min, for a total of 1 cycle.

(3) The amplification curves of the PCR reactions are shown in FIGS. 36-37. From the results shown in FIGS. 36 to 37, it was found that the probes 16 to 17 were not only inhibited from amplifying the wild-type gene but also from amplifying the mutant-type gene, and were poor in specificity, and thus they were not suitable for use as probes.

Example 4 EGFR-19Del

1. Oligonucleotide probes (probes 8 to 9), upstream primers and downstream primers for amplifying EGFR-19Del variant gene were designed and tested for their effect on the amplification results of variant and wild-type genes, including:

(1) probe 8 (also known as 19D-BL 1):

GCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACA (SEQ ID NO: 8), the nucleic acid modification is underlined, and the dideoxy modification is at the 3' terminus;

probe 9 (also known as 19D-BL 2):

GTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGG (SEQ ID NO: 9), the locked nucleic acid modification is underlined, and the 3' terminus is the dideoxy modification.

Upstream primer (5 '-3'): ACGTCTTCCTTCTCTCTCTGTCATA (SEQ ID NO: 16); downstream primer (5 '-3'): GCCAGACATGAGAAAAGGT (SEQ ID NO: 17).

(2) The DNA extracted from the white blood cells of healthy people is used as a wild type DNA template, the DNA extracted from HCC827 cells is used as a variant template, PCR reaction is carried out, and the influence of the probes 8-9 on the amplification result of the gene is detected. Wherein the PCR reaction system comprises: 2 XPCR Multi Premix was used at 10. mu.L, SYBR Green at 0.6. mu.L, 5U/. mu.L Taq enzyme at 0.4. mu.L, 10 XPrimer Mix (10. mu.M) at 1. mu. L, DNA template (wild-type or variant template, 7 ng/. mu.L), water at 5.5. mu.L, 10. mu.M probe 8-9 at 0.5. mu.L (note that the same volume of water as the probe was added as a control without probe). PCR amplification sequencing is shown below: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 60 ℃ for 45 sec; extension (collection of fluorescence signal) at 66 ℃, 30 sec; a total of 35 cycles; ③ Final extension: 72 ℃, 7min, for a total of 1 cycle.

The amplification results of the wild-type gene are shown in FIG. 38, indicating that: probes 8-9 can block amplification of wild-type gene, so that the blocking effect of probe 8 is optimal. The results of amplification of the mutant genes are shown in FIG. 39, which shows that: the probes 8-9 have small influence on the amplification of the mutant genes.

(3) The enrichment effect of the detection probe 8 on the mutant genes in samples with different mutation ratios is as follows: samples with different variation ratios were prepared using DNA extracted from healthy human leukocytes as wild-type DNA template and DNA extracted from HCC827 cells as variant template, and the sample information is shown in table 11 below. PCR reaction System see section 1 of this example, and PCR reaction procedure see section 1 of this example, except that the number of cycles for denaturation, annealing and extension is 40. The amplification products were submitted for first-generation sequencing, and the results are shown in FIGS. 40-44. FIGS. 40-44 show that the probe 8 can enrich and amplify DNA templates containing minor variations (0.1%), and can detect variant types by first-generation sequencing, while the wild type does not detect variant information.

TABLE 11

Sample(s)	Concentration 0.07 ng/. mu.L HCC827 dosage (. mu.L)	WBC dosage (μ L) at concentration of 7 ng/. mu.L
			0.10％	20	200
0.20％	40	200
			0.50％	50	100
1％	100	100
			Wild type	0	200

Example 5 kit for the double amplification of EGFR-L858R and EGFR-19Del

The kit provided by the embodiment is used for enrichment amplification of EGFR 19-Del and L858R mutant sequences, so that the detection capability of a common PCR detection reagent is improved.

1. The kit comprises the following components: the composition of the kit of this example is shown in table 12:

TABLE 12

In this example, 2 × PCR Multi Premix was used as the buffer to reduce nonspecific amplification, and Taq enzyme was used as the PCR enzyme, which did not cause nonspecific amplification and 5 '-3' exonuclease activity; in the kit provided by this embodiment, the underlined nucleotides in the Blocker are the nucleotides modified by LNA to enhance the thermal stability of the probe and the complementary strand, and can specifically block amplification of a wild-type gene; in the embodiment, the PCR amplification primer can cover 19 deletion positions in 19-Del, and non-specific amplification and primer dimer are avoided; wherein, GFP in the external control tube is used as an external control template, and primer + SYBRGreen is used as an external control amplification primer. The kit has the following beneficial effects: an enzyme having no exonuclease activity of 5 '-3' is preferable, and the amount of the enzyme used in the 20. mu.L system is preferably 3.2U. The key step in the library building program is the selection of extension temperature: the preferred temperature range is 64 ℃ to 70 ℃. ③ (3) the Blocker sequence used had LNA modifications at the 19-Del deletion and at the L858R mutation point. And fourthly, the amplification of the wild type template can be blocked by using the library building kit, so that a large amount of templates in a sample containing a small amount of mutant templates are enriched for subsequent kit analysis. The effect of the enrichment was as follows: a Blocker of 250nM blocked amplification of 112ng of wild type template. 0.1% mutated sample can be detected by first-generation sequencing after library construction.

2. And (3) under the condition of double PCR library construction, testing the performance of a two-site Block:

DNA extracted from healthy human leukocytes was used as a wild-type DNA template, and DNA extracted from HCC827 cells and NCI-H1975 cells was used as a mutant template. The PCR system was prepared as follows: 2 × Robustart multi primix was used at 10 μ L, TAQ enzyme (5U/. mu.L) at 0.64. mu.L, 10 × Primer Mix (10. mu.M) at 2 μ L, DNA (wild-type or mutant template, 7ng) at 2. mu.L, Blocker Mix (10. mu.M) at 1. mu.L and water at 4.36. mu.L, the same volume of water was added as a control without Blocker; the PCR amplification procedure was as follows: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 60 ℃ for 45 sec; extending at 67 ℃ for 1 min; a total of 15 cycles; ③ extension: 72 ℃, 7min, for a total of 1 cycle.

And then detecting the library building products by using a qPCR method, and respectively detecting the relative existence amount of the target products in the library building products by using a fluorescence quantification method. The primer information is as follows: 19-Del-FP:5 '-ACGTCTTCCTTCTCTCTCTGTCATA-3'; 19-Del-RP:5 '-GCCAGACATGAGAAAAGGT-3'; L858R-FP:5 '-TACTTGGAGGACCGTCGCTT-3'; L858R-RP:5 '-GCTGACCTAAAGCCACCTCCTTA-3'. The PCR reaction system is as follows: 2 × Accustart Premix (SYBR qPCR) 10 μ M10 μ L, FP 10 μ M0.2 μ L, RP 10 μ M0.2 μ L library building product 1 μ L and Nuclear-Free Water 8.6 μ L. The PCR procedure was as follows: firstly, hot start is carried out for 5min at 95 ℃; ② denaturation, at 95 ℃ for 30 sec; annealing at 57 ℃ for 30 sec; extension (collection of fluorescence signal) 72 ℃, 30 sec; for a total of 30 cycles. The experimental results are shown in fig. 45-48:

as can be seen from FIGS. 45 and 46, in the EGFR 19-Del and L858R duplicate PCR libraries, Blocker1-19D-BL1 can effectively block the amplification of 19-Del wild type (delta Ct >10), and has little effect on the amplification of 19-Del mutant (delta Ct < 0.5); as can be seen from FIGS. 47 and 48, in the EGFR 19-Del and L858R duplicate PCR library, Blocker2-L8-BL3 can effectively block the amplification of L858R wild type (delta Ct >10) and has little effect on the amplification of L858R mutant (delta Ct < 0.5).

3. And (3) analyzing the enrichment effect of samples with different mutation proportions on the mutant types:

using DNA extracted from healthy human leukocytes as a wild-type DNA template and DNA extracted from NCI-H1975 cells as a mutant template, preparing samples with different mutation ratios, wherein the sample information is as shown in table 7, the library construction method and the qPCR method are as shown in the 2 nd node (performance test of two-site Block under duplex PCR library construction) of this example, and the products are subjected to detection and first-generation sequencing: the 19-Del generation sequencing results are shown in FIGS. 49-53, and indicate that: the DNA template containing trace mutation (0.1%) is enriched and amplified by adopting a double PCR library, and 19-Del deletion mutation can be detected by first-generation sequencing; no deletion was detected in the wild type. The results of the L858R generation sequencing are shown in FIGS. 54-58, and the L858R mutation can be detected by the generation sequencing by performing enrichment amplification on the DNA template containing trace mutations (0.1%) by using a duplex PCR library, although the reading data of 0.1% and 0.2% of sample machines are still T, the intensity of G is increased along with the increase of the mutation concentration ratio; the wild type shows no mutation information detected.

Example 6 kit for triple amplification of EGFR-L858R, EGFR-T790M, and EGFR-19Del

The kit provided by the embodiment is used for enrichment amplification of EGFR 19-Del, EGFR-T790M and EGFR-L858R mutant sequences, so that the detection capability of a common PCR detection reagent is improved.

1. The kit comprises the following components: the composition of the kit of this example is shown in table 13:

watch 13

In this example, 2 × PCR Multi Premix was used as the buffer to reduce nonspecific amplification, and Taq enzyme was used as the PCR enzyme, which did not cause nonspecific amplification and 5 '-3' exonuclease activity; in the kit provided by this embodiment, the underlined nucleotides in the Blocker are the nucleotides modified by LNA to enhance the thermal stability of the probe and the complementary strand, and can specifically block amplification of a wild-type gene; in the embodiment, the PCR amplification primer can cover 19 deletion positions in 19-Del, and non-specific amplification and primer dimer are avoided; wherein, GFP in the external control tube is used as an external control template, and primer + SYBRGreen is used as an external control amplification primer. The kit has the following beneficial effects: an enzyme having no exonuclease activity of 5 '-3' is preferable, and the amount of the enzyme used in the 20. mu.L system is preferably 3.2U. The key step in the library building program is the selection of extension temperature: the preferred temperature range is 64 ℃ to 70 ℃. ③ (3) the Blocker sequence used had LNA modifications at the 19-Del deletion, the T790M mutation site and the L858R mutation site. And fourthly, the amplification of the wild type template can be blocked by using the library building kit, so that a large amount of templates in a sample containing a small amount of mutant templates are enriched for subsequent kit analysis. The effect of the enrichment was as follows: a Blocker of 250nM blocked amplification of 112ng of wild type template. 0.1% mutated sample can be detected by first-generation sequencing after library construction.

2. Performance test of three-site Block under triple PCR library building condition

DNA extracted from healthy human leukocytes was used as a wild-type DNA template, and DNA extracted from HCC827 cells and NCI-H1975 cells was used as a mutant template. The blocking effect of Blocker corresponding to 19-Del, T790M and L858R under the condition of triple PCR library construction is tested. The PCR system was prepared as follows: the PCR system was prepared as follows: 2 × Robustart multi primix was used at 10 μ L, TAQ enzyme (5U/. mu.L) at 0.64. mu.L, 10 × Primer Mix (10. mu.M) at 3. mu. L, DNA (wild-type or mutant template, 7ng) at 2. mu.L, Blocker Mix (10. mu.M) at 1.5. mu.L and water at 2.86. mu.L, the same volume of water was added as a no Blocker control; the PCR amplification procedure was as follows: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 57 deg.C for 45sec for 1 min; for a total of 15 cycles.

And then detecting the library building products by using a qPCR method, and respectively detecting the relative existence amount of the target products in the library building products by using a fluorescence quantification method. The primer information is as follows: 19-Del-FP:5 '-ACGTCTTCCTTCTCTCTCTGTCATA-3'; 19-Del-RP:5 '-GCCAGACATGAGAAAAGGT-3'; L858R-FP:5 '-TACTTGGAGGACCGTCGCTT-3'; L858R-RP:5 '-GCTGACCTAAAGCCACCTCCTTA-3'; T790M-FP: 5 '-CATGCGAAGCCACACTGAC-3'; T790M-RP: 5 '-GTCTTTGTGTTCCCGGACATAGTCCAGG-3'. The PCR reaction system is as follows: 2 × Accustart Premix (SYBR qPCR) 10 μ M10 μ L, FP 10 μ M0.2 μ L, RP 10 μ M0.2 μ L library building product 1 μ L and Nuclear-Free Water 8.6 μ L. The PCR procedure was as follows: firstly, hot start is carried out for 5min at 95 ℃; ② denaturation, at 95 ℃ for 30 sec; annealing at 57 ℃ for 30 sec; extension (collection of fluorescence signal) 72 ℃, 30 sec; for a total of 30 cycles. The experimental results are shown in fig. 59-65:

as can be seen from FIGS. 59 and 60, in the triple PCR library of EGFR 19-Del, T790M and L858R, Blocker1-19D-BL1 can effectively block the amplification of 19-Del wild type (delta Ct >10), and has little effect on the amplification of 19-Del mutant (delta Ct < 0.5); as can be seen from FIGS. 61 and 62, in the triple PCR library of EGFR 19-Del, T790M and L858R, Blocker2-BL27 can effectively block the amplification of T790M wild type (delta Ct >10) and has little effect on the amplification of T790M mutant (delta Ct < 0.5); as can be seen from FIGS. 63 and 64, in the triple PCR library of EGFR 19-Del, T790M and L858R, Blocker3-L8-BL3 can effectively block the amplification of L858R wild type (delta Ct >10) and has little effect on the amplification of L858R mutant type (delta Ct < 0.5).

3. Analysis of enrichment effect of samples with different mutation proportions on mutants

Samples with different mutation ratios were prepared using DNA extracted from healthy human leukocytes as wild-type DNA template and DNA extracted from HCC827 cells and NCI-H1975 cells as mutant templates, and the sample information is shown in Table 14:

TABLE 14

The triple PCR library construction PCR system is prepared as follows: the PCR system was prepared as follows: 2 × Robustart multi primix was used at 10 μ L, Taq enzyme (5U/. mu.L) at 0.64. mu.L, 10 × Primer Mix (10. mu.M) at 2 μ L, DNA (wild-type or mutant template, 7ng) at 2. mu.L, Blocker Mix (10. mu.M) at 1. mu.L and water at 4.36. mu.L, the same volume of water was added as a control without Blocker; the PCR amplification procedure was as follows: firstly, hot start is carried out, the temperature is 95 ℃, the time is 5min, and 1 cycle is counted; ② denaturation, at 95 ℃ for 30 sec; annealing at 57 deg.C for 45sec for 1 min; for a total of 15 cycles. The qPCR method for detecting the library-building product, the qPCR primers, the reaction system and the reaction program are the same as the qPCR detection method used in the 2 nd paragraph of this example, and the 19-Del generation sequencing result is shown in FIG. 65-FIG. 69: the triple PCR library is adopted to carry out enrichment amplification on the DNA template containing trace mutation (0.1%), and 19-Del deletion mutation can be detected through first-generation sequencing; the wild type is not detected to be deleted; the results of the T790M generation sequencing are shown in fig. 70-74: the DNA template containing trace mutation (0.1%) is enriched and amplified by adopting a triple PCR library construction, and the T790M mutation can be detected through first-generation sequencing; the wild type shows no mutation information detected. The results of the L858R generation sequencing are shown in fig. 75-79: by adopting triple PCR library construction to perform enrichment amplification on a DNA template containing trace mutation (0.1%), L858R mutation can be detected by first-generation sequencing, although the read data of 0.1% and 0.2% of sample machines are still T, the intensity of G is increased along with the increase of the mutation concentration ratio; the wild type shows no mutation information detected.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Zhuhaishengmei bio-diagnostic technology Co., Ltd

<120> a non-quenched oligonucleotide probe for amplifying a variant target gene fragment and use thereof

<160> 25

<170> PatentIn version 3.3

<210> 1

<211> 48

<212> DNA

<213> Artificial sequence

<400> 1

tcacctccac cgtgcagctc atcacgcagc tcatgccctt cggctgcc 48

<210> 2

<211> 28

<212> DNA

<213> Artificial sequence

<400> 2

gtgcagctca tcacgcagct catgccct 28

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence

<400> 3

gtgcagctca tcacgcagct catgccct 28

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<400> 4

ggtagttgga gctggtggcg taggcaagag 30

<210> 5

<211> 33

<212> DNA

<213> Artificial sequence

<400> 5

tggtagttgg agctggtggc gtaggcaaga gtg 33

<210> 6

<211> 32

<212> DNA

<213> Artificial sequence

<400> 6

cacagatttt gggctggcca aactgctggg tg 32

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence

<400> 7

attttgggct ggccaaactg ctgg 24

<210> 8

<211> 43

<212> DNA

<213> Artificial sequence

<400> 8

gctatcaagg aattaagaga agcaacatct ccgaaagcca aca 43

<210> 9

<211> 49

<212> DNA

<213> Artificial sequence

<400> 9

gtcgctatca aggaattaag agaagcaaca tctccgaaag ccaacaagg 49

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence

<400> 10

catgcgaagc cacactgac 19

<210> 11

<211> 28

<212> DNA

<213> Artificial sequence

<400> 11

gtctttgtgt tcccggacat agtccagg 28

<210> 12

<211> 26

<212> DNA

<213> Artificial sequence

<400> 12

aagcgtcgat ggaggagttt gtaaat 26

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence

<400> 13

gttggatcat attcgtccac aa 22

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

tacttggagg accgtcgctt 20

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence

<400> 15

gctgacctaa agccacctcc tta 23

<210> 16

<211> 25

<212> DNA

<213> Artificial sequence

<400> 16

acgtcttcct tctctctctg tcata 25

<210> 17

<211> 19

<212> DNA

<213> Artificial sequence

<400> 17

gccagacatg agaaaaggt 19

<210> 18

<211> 28

<212> DNA

<213> Artificial sequence

<400> 18

gtgcagctca tcacgcagct catgccct 28

<210> 19

<211> 28

<212> DNA

<213> Artificial sequence

<400> 19

gtgcagctca tcacgcagct catgccct 28

<210> 20

<211> 28

<212> DNA

<213> Artificial sequence

<400> 20

gtgcagctca tcacgcagct catgccct 28

<210> 21

<211> 27

<212> DNA

<213> Artificial sequence

<400> 21

ggagctggtg gcgtaggcaa gagtgcc 27

<210> 22

<211> 27

<212> DNA

<213> Artificial sequence

<400> 22

ggagctggtg gcgtaggcaa gagtgcc 27

<210> 23

<211> 27

<212> DNA

<213> Artificial sequence

<400> 23

ggagctggtg gcgtaggcaa gagtgcc 27

<210> 24

<211> 38

<212> DNA

<213> Artificial sequence

<400> 24

gatcacagat tttgggctgg ccaaactgct gggtgcgg 38

<210> 25

<211> 42

<212> DNA

<213> Artificial sequence

<400> 25

gtcaagatca cagattttgg gctggccaaa ctgctgggtg cg 42

Claims

1. A non-quenched oligonucleotide probe for amplifying a variant target gene fragment, comprising:

(1) the nucleotide sequence of the non-quenching oligonucleotide probe is completely matched with the wild target gene fragment and is mismatched with the variant target gene fragment at the variant position;

(2) the length of the non-quenching oligonucleotide probe is 24-50 bp, and the modified nucleotide composition is as follows:

at least 1-6 nucleotides are modified within the range of 1-5 bp at the variation position and two sides of the variation position, and the 3' tail end of the non-quenching oligonucleotide probe is modified;

(3) the non-quenched oligonucleotide probe can bind to a wild-type target gene fragment and a variant target gene fragment when annealed, and only bind to the wild-type target gene fragment when extended;

the non-quenched oligonucleotide probe is probe 1, probe 2 or probe 3 for amplifying EGFR-T790M variation; the nucleotide sequence of the probe 1 is TCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCC, the nucleotide sequence of the probe 2 is GTGCAGCTCATCACGCAGCTCATGCCCT, the nucleotide sequence of the probe 3 is GTGCAGCTCATCACGCAGCTCATGCCCT, wherein the underlined nucleotides in the probe 1, the probe 2 and the probe 3 are nucleotides modified by locked nucleic acids, and the 3' ends of the probe 1, the probe 2 and the probe 3 are all dideoxy modified;

or the non-quenched oligonucleotide probe is probe 4 or probe 5 for amplifying K-ras variation; the nucleotide sequence of the probe 4 is GGTAGTTGGAGCTGGTGGCGTAGGCAAGAG, the underlined nucleotides in the probe 4 are nucleotides modified by locked nucleic acid, and the 3' end of the probe 4 is modified by dideoxy; the nucleotide sequence of the probe 5 is TGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTG, wherein the underlined nucleotide in the probe 5 is a nucleotide modified by a locked nucleic acid, and the 3' end of the probe 5 is modified by a C3 spacer;

alternatively, the first and second electrodes may be,the non-quenched oligonucleotide probe is probe 6 or probe 7 for amplifying EGFR-L858R variation; the nucleotide sequence of the probe 6 is CACAGATTTTGGGCTGGCCAAACTGCTGGGTG, the nucleotide sequence of the probe 7 is ATTTTGGGCTGGCCAAACTGCTGG, wherein the underlined nucleotides in the probe 6 and the probe 7 are nucleotides modified by locked nucleic acids, and the 3' ends of the probe 6 and the probe 7 are both subjected to dideoxy modification;

or the non-quenched oligonucleotide probe is a probe 8 or a probe 9 for amplifying EGFR-19Del deletion variation; the nucleotide sequence of the probe 8 is GCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACA, the nucleotide sequence of the probe 9 is GTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGG, wherein the underlined nucleotides in the probe 8 and the probe 9 are nucleotides modified by locked nucleotides, and the 3' ends of the probe 8 and the probe 9 are both dideoxy modified.

2. A reagent and/or kit for amplifying a mutant target gene fragment, comprising the non-quenched oligonucleotide probe of claim 1 and other amplification reagents.

3. The reagent and/or kit of claim 2, wherein the non-quenched oligonucleotide probe is a single non-quenched oligonucleotide probe or a plurality of non-quenched oligonucleotide probes.

4. The reagent and/or kit of claim 3, wherein the plurality of non-quenched oligonucleotide probes are directed against the same variant target gene or different variant target genes.

5. The reagent and/or kit of claim 4, wherein the reagent and/or kit is used to amplify at least two of a K-ras mutation, an EGFR-T790M mutation, an EGFR-L858R mutation, or an EGFR-19Del deletion mutation.

6. The reagent and/or kit of claim 5, wherein the mutated target gene fragment amplified by the reagent and/or kit comprises the EGFR-L858R mutation and the EGFR-19Del deletion mutation; the reagents and/or kits include probe 6 or probe 7 for amplification of the EGFR-L858R variation, and probe 8 or probe 9 for amplification of the EGFR-19Del deletion variation.

7. The reagent and/or kit of claim 6, wherein the reagent and/or kit comprises probe 6 for amplification of EGFR-L858R variation, and probe 8 for amplification of EGFR-19Del deletion variation.

8. The reagent and/or kit of claim 5, wherein the mutated target gene fragment for amplification by the reagent and/or kit comprises the EGFR-T790M mutation, the EGFR-L858R mutation and the EGFR-19Del deletion mutation; the reagents and/or kits include probe 1, probe 2 or probe 3 for amplification of the EGFR-T790M variation, probe 6 or probe 7 for amplification of the EGFR-L858R variation, and probe 8 or probe 9 for amplification of the EGFR-19Del deletion variation.

9. The reagent and/or kit of claim 8, wherein the reagent and/or kit comprises probe 1 for amplification of EGFR-T790M variation, probe 6 for amplification of EGFR-L858R variation, and probe 8 for amplification of EGFR-19Del deletion variation.

10. The reagent and/or kit of claim 2, wherein the probe and the other amplification reagents are provided in a separate package or the probe and the other amplification reagents are provided in a mixed single reagent.

11. The reagent and/or kit of claim 2, wherein the other amplification reagents comprise one or more of primer pairs, DNA polymerases, buffers, dNTPs, sterile water, and double stranded DNA dyes.

12. The reagent and/or kit of claim 11, wherein the additional amplification reagents are provided in separate packages when they are multiple, or at least two of the additional amplification reagents are provided as a mixed single reagent.

13. The reagent and/or kit according to claim 12, characterized in that it comprises primers Mix, Blocker Mix, buffer and PCR enzymes; the reagents and/or kits are useful for amplifying at least two of a K-ras variation, an EGFR-T790M variation, an EGFR-L858R variation, and an EGFR-19Del deletion variation.

14. The reagent and/or kit according to claim 11, wherein the primer pair consists of an upstream primer and a downstream primer for amplifying a mutation site comprising the mutant target gene fragment, and the primer pair and the non-quenched oligonucleotide probe do not overlap or partially overlap at a binding site to the target gene fragment.

15. The reagent and/or kit according to claim 14, wherein the molar ratio of the upstream primer to the downstream primer is 1: 0.75-1.25.

16. The reagent and/or kit according to claim 15, wherein the molar ratio of the forward primer to the backward primer is 1: 1.

17. The reagent and/or kit according to claim 11, wherein the reagent and/or kit is used for amplifying EGFR-T790M variation, and the nucleotide sequences of the primer pairs are respectively as follows: CATGCGAAGCCACACTGAC and GTCTTTGTGTTCCCGGACATAGTCCAGG;

alternatively, the reagent and/or the kit is used for amplifying K-ras variation, and the nucleotide sequences of the primer pairs are respectively shown as follows: AAGCGTCGATGGAGGAGTTTGTAAAT and GTTGGATCATATTCGTCCACAA;

alternatively, the reagent and/or the kit is used for amplifying EGFR-L858R variation, and the nucleotide sequences of the primer pairs are respectively shown as follows: TACTTGGAGGACCGTCGCTT and GCTGACCTAAAGCCACCTCCTTA;

alternatively, the reagent and/or the kit is used for amplifying EGFR-19Del deletion variation, and the nucleotide sequences of the primer pairs are respectively shown as follows: acgtcttccttctctctctgtcata, and gccagacatgagaaaaggt.

18. The reagent and/or kit of claim 2, wherein the mutated target gene fragment for amplification by the reagent and/or kit comprises an EGFR-L858R mutation and an EGFR-19Del deletion mutation; the kit comprises a primer pair for amplifying EGFR-L858R variation: the nucleotide sequences of the primer pairs are respectively shown as follows: TACTTGGAGGACCGTCGCTT and GCTGACCTAAAGCCACCTCCTTA, and the primer pair used to amplify the EGFR-19Del deletion variant: the nucleotide sequences of the primer pairs are respectively shown as follows: ACGTCTTCCTTCTCTCTCTGTCATA, and GCCAGACATGAGAAAAGGT.

19. The reagent and/or kit of claim 2, wherein the mutated target gene fragment for amplification by the reagent and/or kit comprises the EGFR-T790M mutation, the EGFR-L858R mutation and the EGFR-19Del deletion mutation; the kit comprises a primer pair for amplifying EGFR-T790M variation, wherein the nucleotide sequences of the primer pair are respectively as follows: CATGCGAAGCCACACTGAC and GTCTTTGTGTTCCCGGACATAGTCCAGG; primer pairs for amplification of EGFR-L858R variation: the nucleotide sequences of the primer pairs are respectively shown as follows: TACTTGGAGGACCGTCGCTT and GCTGACCTAAAGCCACCTCCTTA, and the primer pair used to amplify the EGFR-19Del deletion variant: the nucleotide sequences of the primer pairs are respectively shown as follows: ACGTCTTCCTTCTCTCTCTGTCATA, and GCCAGACATGAGAAAAGGT.

20. A mixed reaction system for amplifying a mutant target gene fragment, comprising the reagent according to any one of claims 2 to 19 and a sample to be tested.

21. The mixed reaction system of claim 20, wherein the sample to be tested is a low copy number sample or a low variation frequency sample.

22. The mixed reaction system of claim 21, wherein the low copy number is 800 to 20000 copies.

23. The mixed reaction system of claim 22, wherein the low copy number is 1000 copies, 4000 copies, 8000 copies, or 16000 copies.

24. The hybrid reaction system of claim 21, wherein the low variation frequency is 0.03% to 5% variation rate.

25. The mixed reaction system of claim 24, wherein the low variation frequency is 0.05% variation, 0.075% variation, 0.1% variation, 0.15% variation, 0.25% variation, 0.3% variation, 0.5% variation, 1% variation, 1.2% variation, or 4% variation.

26. The hybrid reaction system of claim 20, wherein the sample to be tested is a low copy number and low variation frequency sample.

27. The mixed reaction system of claim 26, wherein the low copy number is 800-20000 copies and the low variation frequency is 0.03% -5% variation rate.

28. The mixed reaction system of claim 27, wherein the low copy number is 800-1200 copies and the low variation frequency is 0.3% -5%; or the low copy number is 3000-5000 copies, and the low variation frequency is 0.075% -1.25%; or the low copy number is 7000-9000 copy numbers, and the low variation frequency is 0.03% -1%; or the low copy number is 15000-17000 copy numbers, and the low variation frequency is 0.05% -0.3%.

29. The mixed reaction system of claim 27, wherein the low copy number is 1000 copies, 4000 copies, 8000 copies or 16000 copies, and the low variation frequency is 0.05% variation, 0.075% variation, 0.1% variation, 0.15% variation, 0.25% variation, 0.3% variation, 0.5% variation, 1% variation, 1.2% variation or 4% variation.

30. The mixed reaction system of claim 29, wherein the low copy number is 1000 copies and the low variation frequency is 0.4%, 1.2%, or 4%.

31. The mixed reaction system of claim 29, wherein the low copy number is 4000 copies and the low variation frequency is 0.1%, 0.3%, or 1%.

32. The mixed reaction system of claim 29, wherein the low copy number is 8000 and the low variation frequency is 0.05%, 0.15% or 0.5%.

33. The mixed reaction system of claim 29, wherein the low copy number is 16000 copies and the low variation frequency is 0.075% or 0.25%.

34. Use of the oligonucleotide probe of claim 1, the reagent or kit of any one of claims 2 to 19, or the mixed reaction system of any one of claims 20 to 33 for enrichment prior to detection of a mutated target gene fragment.

35. A method for amplifying a variant target gene fragment, comprising the steps of: (1) preparing the mixed reaction system of any one of claims 22 to 33; (2) performing a PCR reaction, wherein the PCR reaction comprises denaturation, annealing and extension; wherein, upon annealing, the non-quenched oligonucleotide probe binds to the wild-type target gene fragment and the variant target gene fragment; upon extension, the non-quenched oligonucleotide probe binds only to the wild-type target gene fragment;

the method is used for enrichment before detection of the variant target gene fragment;

the variant target gene is EGFR-T790M, the non-quenched oligonucleotide probe is probe 1, probe 2 or probe 3, and the primers used in PCR are upstream primer: 5'-CATGCGAAGCCACACTGAC-3', downstream primer: 5'-GTCTTTGTGTTCCCGGACATAGTCCAGG-3', respectively; the annealing temperature is 57 ℃, and the extension temperature is 68 ℃;

or the variant target gene is K-ras, the non-quenched oligonucleotide probe is probe 4 or probe 5, and the primers used in PCR are an upstream primer: 5'-AAGCGTCGATGGAGGAGTTTGTAAAT-3', downstream primer: 5'-GTTGGATCATATTCGTCCACAA-3', respectively; the annealing temperature is 62 ℃, and the extension temperature is 72 ℃;

or the variant target gene is EGFR-L858R, the non-quenched oligonucleotide probe is Probe 6 or Probe 7, and the primers used in PCR are, upstream primer: 5'-TACTTGGAGGACCGTCGCTT-3', downstream primer: 5'-GCTGACCTAAAGCCACCTCCTTA-3', respectively; the annealing temperature of the probe 6 is 60 ℃, and the extending temperature of the probe 6 is 69 ℃; the annealing temperature of the probe 7 is 60 ℃, and the extending temperature of the probe 7 is 66 ℃;

or, the variant target gene is EGFR-19Del, the non-quenched oligonucleotide probe is probe 8 or probe 9, and the primers used in PCR are an upstream primer: 5'-acgtcttccttctctctctgtcata-3', downstream primer: 5'-gccagacatgagaaaaggt-3', respectively; the annealing temperature is 60 ℃, and the extension temperature is 66 ℃;

alternatively, the method is used for double amplification of EGFR-L858R and EGFR-19Del, and the non-quenched oligonucleotide probes comprise probe 6 and probe 8; the primers used in PCR are 19-Del-FP: 5'-ACGTCTTCCTTCTCTCTCTGTCATA-3', 19-Del-RP: 5'-GCCAGACATGAGAAAAGGT-3', L858R-FP: 5'-TACTTGGAGGACCGTCGCTT-3', L858R-RP: 5'-GCTGACCTAAAGCCACCTCCTTA-3'; the annealing temperature is 57 ℃; the extension temperature is 72 ℃;

alternatively, the method is used for triple amplification of EGFR-T790M, EGFR-L858R, and EGFR-19Del, the non-quenched oligonucleotide probes comprising probe 1, probe 6, and probe 8; the primers used in the PCR were a primer consisting of,

19-Del-FP：5’-ACGTCTTCCTTCTCTCTCTGTCATA-3’，

19-Del-RP：5’-gccagacatgagaaaaggt-3’，

L858R-FP：5’-TACTTGGAGGACCGTCGCTT-3’，

L858R-RP：5’-GCTGACCTAAAGCCACCTCCTTA-3’，

T790M-FP：5’-CATGCGAAGCCACACTGAC-3’，

T790M-RP: 5'-GTCTTTGTGTTCCCGGACATAGTCCAGG-3', respectively; the annealing temperature is 57 ℃; the extension temperature was 72 ℃.

36. The mixed reaction system according to any one of claims 20 to 33, or the method according to claim 35, wherein the sample to be tested is a blood, body fluid, tissue, circulating tumor cell, cfDNA, or fetal early detection sample.

37. The mixed reaction system of any one of claims 20 to 33, or the method of claim 35, wherein the sample to be tested is a fetal pretest sample selected from maternal blood, a villus puncture sample, or an amniotic puncture sample.

38. The use according to claim 34 or the method according to any one of claims 35 to 37, wherein the pre-detection enrichment is a pre-sequencing pooling.