CN117025765A

CN117025765A - Multiplex digital PCR detection kit and detection method thereof

Info

Publication number: CN117025765A
Application number: CN202310813946.9A
Authority: CN
Inventors: 黄雅菁; 唐东江; 齐盼盼; 赵计昌
Original assignee: Zhuhai Livzon Cynvenio Diagnostics Ltd
Current assignee: Zhuhai Livzon Cynvenio Diagnostics Ltd
Priority date: 2023-02-01
Filing date: 2023-07-04
Publication date: 2023-11-10

Abstract

The present disclosure relates to a multiplex digital PCR detection kit and a detection method thereof, the detection kit comprises a detection primer, a wild-type blocking probe blocker and a detection probe of a corresponding target, wherein the detection primer of the corresponding target comprises an upstream primer and a downstream primer, and the target is selected from any one of K-ras, B-raf, EGFR, ESR1, PIK3CA and N-ras or any combination thereof. The detection kit can detect multiple targets simultaneously, greatly reduces sample consumption, detection time and detection cost, reduces amplification efficiency of a wild type template by a blocker, effectively reduces influence of a wild type background signal on detection, and effectively improves sensitivity and specificity of the multiple digital PCR detection system.

Description

Multiplex digital PCR detection kit and detection method thereof

Technical Field

The present disclosure relates to the field of gene detection, and in particular, to a kit for detecting gene mutation by multiplex digital PCR and a detection method thereof.

Background

Starting from the publication of EGFR inhibitor-treated EGFR mutant lung cancer patients in 2004, tumor diagnosis treatment is moving into the age of targeted therapy. With the mutation of BRAF and K-ras genes, the discovery of targets such as ALK1, ROS1 and RET gene fusion and the appearance of corresponding targeted drugs, the treatment scheme selection and the survival period of lung cancer patients are greatly improved. Meanwhile, the targeted therapy is popularized from lung cancer to other solid tumors, such as gastric cancer, intestinal cancer, gastrointestinal stromal tumor, breast cancer, melanoma, glioblastoma and the like. In recent years, due to the popularization of detection technologies such as NGS, digital PCR, fluorescent PCR and the like, the success of clinical trials of a universal tumor marker and a corresponding targeting drug, and even the approval of the FDA, gene mutation detection and targeted therapy play an increasingly important role in tumor patient treatment.

Digital PCR is also called Digital PCR (dPCR), the basic principle is that PCR reactants are divided into tens to hundreds of thousands of parts and then distributed into different reaction units, so that each droplet unit contains one or more copies of nucleic acid molecules, each unit can amplify a template, statistics of fluorescent signals is carried out on each unit, and the initial copy number or concentration of target molecules is obtained according to the Poisson distribution principle and the number and proportion of positive droplets. Compared with the traditional fluorescent quantitative PCR, the digital PCR has high sensitivity (reaching 0.001-0.0001 percent), strong specificity and high tolerance to PCR reaction inhibitors. Meanwhile, the target copy number can be directly and accurately quantified without depending on a reference substance or a standard substance, and tiny concentration difference can be analyzed; the experimental data is convenient to analyze, the detection result of each droplet is interpreted negatively and positively, and the data analysis is automatic; the mutation rate of the target point can be obtained through statistical analysis.

Early digital PCR gene mutation detection products are limited by instrument fluorescent channels, and single-point detection is usually the main. The single-point detection product can only detect one mutation due to a single reaction, has the advantages of relatively high detection cost, low sample utilization rate, high sensitivity and capability of quantifying, and is difficult to popularize. However, the number of genes to be detected in practical use is often more than two. For example, in primary screening of mutated genes in oncological patients, it is desirable to accurately find a specific gene mutated in a patient among a plurality of genes to give an optimal therapeutic regimen. Therefore, there is a great need for multiplex digital PCR to detect multiple targets in a single reaction. The development of the multichannel digital PCR platform enables multiplex digital PCR detection to be possible, the detection cost can be obviously reduced by realizing multi-index parallel detection, and more abundant detection information is obtained, so that the single sample utilization efficiency is improved, and the multichannel digital PCR platform has the irreplaceable advantage in the field of liquid biopsies of tumors.

In the development process of multiplex digital PCR gene mutation detection products, the inventor finds that compared with a single PCR product, in order to improve the utilization efficiency of a fluorescent channel, a universal internal reference is often used to replace a wild type probe in the single product to evaluate the copy number of a template background. Mutant probes tend to bind to high concentrations of wild-type template without competition from the wild-type probe, resulting in non-specific signal effects on interpretation.

Therefore, development of a high-sensitivity and specificity multiplex digital PCR detection system is urgently needed, interference of a background signal of a wild template in a sample is effectively eliminated, and the method has important significance in diagnosis and treatment of cancers.

Disclosure of Invention

In order to solve the problems in the prior art, the purpose of the present disclosure is to provide a multiple digital PCR detection system, which can complete simultaneous multi-target detection on a multi-channel digital platform, thereby greatly reducing sample consumption, detection time and detection cost. In addition, the blocker in the detection system reduces the amplification efficiency of the wild template, competes with the mutant probe for combination, and effectively reduces the influence of a wild background signal on detection, thereby effectively improving the sensitivity and the specificity of the multiplex digital PCR detection system.

In order to achieve the above object, the present disclosure adopts the following specific schemes:

in one aspect, the present disclosure proposes a multiplex digital PCR detection reagent or detection kit for detecting a gene mutation comprising a detection primer, a wild-type blocking probe blocker, and a detection probe for a corresponding target, wherein the detection primer for the corresponding target comprises an upstream primer and a downstream primer, and the target is selected from any one of K-ras, B-raf, EGFR, ESR1, PIK3CA, and N-ras, or any combination thereof.

In another aspect, the present disclosure provides a method for multiplex digital PCR detection of gene mutations that can simultaneously detect at least 2 mutation sites in one PCR sample, the mutations being at the same target or at different targets, the detection method comprising:

(1) Obtaining DNA from a sample to be tested;

(2) Mixing the DNA obtained in the step (1), a detection primer corresponding to the target point, a detection probe, a blocker and optional internal references;

(3) Droplet generation, PCR amplification and chip reading;

(4) Reading a fluorescent signal of the PCR amplification product, and judging the mutation condition in the detection sample according to the fluorescent signal;

preferably, the DNA is free DNA.

In another aspect, the present disclosure provides the use of the detection reagents or detection kits described above and/or the methods described above in multiplex gene mutation detection.

The beneficial effects obtained by the present disclosure are at least as follows:

(1) The present disclosure provides a multiplex digital PCR detection reagent or detection kit, which can simultaneously complete the detection of multiple gene targets on a multichannel digital PCR platform, thereby greatly reducing the sample consumption, the detection time and the detection cost. The detection reagent or the detection kit can simultaneously complete the gene detection of specific targets of patients with lung cancer, colorectal cancer or breast cancer.

(2) The detection system reduces the amplification efficiency of a wild type template by introducing a wild type blocking probe blocker, competes with a mutant type probe for combination, effectively reduces the interference of a reaction Kong Naye raw type background signal, and improves the sensitivity and the specificity of detection.

(3) The multiple digital PCR detection system and method provided by the disclosure effectively improve the sample utilization rate and have advantages for detecting the micro templates; meanwhile, the amplification system is simple to operate, short in detection time, convenient to operate, visual in result and convenient to analyze.

Drawings

Fig. 1: k-ras blocker test results.

Fig. 2: b-raf blocker test results.

Fig. 3: EGFR T790M blocker test results.

Fig. 4: the blocker-1106 test results.

Fig. 5: amplification curves of the FP1/RP1 primer pair at different temperatures.

Fig. 6: amplification curves of the FP2/FP2 primer pair at different temperatures.

Fig. 7: amplification curves of the FP3/RP3 primer pair at different temperatures.

Fig. 8: amplification efficiency test results of FP2/RP2, FP3/RP3 primer pairs.

Fig. 9: multiplex blocker fluorescent PCR assay of extracted DNA from NCI-H1975 cell line.

Fig. 10: multiplex blocker fluorescent PCR assay of extracted DNA from HT29 cell lines.

Fig. 11: multiplex blocker fluorescent PCR assay of DNA extracted from Calu-1 cell line.

Fig. 12: multiplex blocker fluorescent PCR detection results of DNA extracted from HEK-293 cell line.

Fig. 13: multiplex blocker fluorescent PCR detection results for enzyme-free water blanks.

Fig. 14: multiplex blocker digital PCR assay of DNA extracted from Calu-1 cell line.

Fig. 15: multiplex blocker digital PCR assay of DNA extracted from HT29 cell lines.

Fig. 16: multiplex blocker digital PCR assay of DNA extracted from NCI-H1975 cell line.

Fig. 17: multiplex blocker digital PCR assay of DNA extracted from HEK-293 cell line.

Fig. 18: multiple blocker digital PCR assay results for enzyme-free water blanks.

Fig. 19: multiple blocker digital PCR detection results of analog samples.

Fig. 20: multiple blocker digital PCR detection results of analog samples.

Fig. 21: multiple blocker digital PCR detection results of analog samples. Fig. 22: multiple blocker digital PCR detection results of analog samples.

Detailed Description

The experimental methods of the following examples, in which specific conditions are not specified, are generally performed under conventional conditions or under conditions recommended by the manufacturer. The various commonly used chemical and biological reagents used in the examples are all commercially available products.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The terminology used in the description of the present disclosure is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure.

The terms "comprising" and "having" and any variations thereof, are intended to cover a non-exclusive inclusion. For example, a process, method, apparatus, article, or device that comprises a list of steps is not limited to the elements or modules listed but may alternatively include additional steps not listed or inherent to such process, method, article, or device.

References to "a plurality" in this disclosure refer to two or more. "and/or", describes an association relationship of an association object, and indicates that there may be three relationships, for example, a and/or B, and may indicate: a exists alone, A and B exist together, and B exists alone. The character "/" generally indicates that the context-dependent object is an "or" relationship. Meanwhile, for better understanding of the present disclosure, the following definitions and explanations of the related terms are provided.

The term "locked nucleic acid" as used in this disclosure is Locked Nucleic Acid (LNA) and refers to an artificially synthesized antisense oligonucleotide in which the 2 '-oxygen and 4' -carbon of the ribose ring of a nucleotide residue are linked by a methylene group, and has a strong hybridization ability with a target nucleic acid molecule, and is not easily degraded by an enzyme.

The term "multiplex detection" as used in this disclosure refers to the detection of multiple sets of different mutant genes by multiple sets of upstream and downstream primer pairs.

The term "inverted dT" as used in this disclosure is referred to as inverted dT (invdT), which may be modified as the 3' end of an oligonucleotide to prevent extension of the oligonucleotide.

The term "ddC" as used in this disclosure is a base modification, and refers to dideoxycytidine (3 ' ddC Dideoxy-C,3 ddC) in which the hydroxyl groups at the 2' and 3' positions of ribose are both substituted with H, which can be attached at the ends of nucleotides to prevent extension of the DNA polymerase at the ends.

In some embodiments of the present disclosure, the detection primer, the wild-type blocking probe blocker, and the detection probe of the corresponding target are selected from any one of the following groups or any combination thereof:

(1) The upstream primer for detecting K-ras mutation is selected from the nucleotide sequences shown in any one of SEQ ID NO.1-3 and 103; the downstream primer is selected from nucleotide sequences shown in any one of SEQ ID NO.4-6 and 104; the K-ras blocker is selected from the nucleotide sequence shown in any one of SEQ ID NO.7-9 or a locked nucleic acid with other modifications blocking the blocker from self-extension at the 3' end or the nucleotide sequence is modified to a modified substitution selected from the group consisting of: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other modification that blocks the elongation of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from nucleotide sequences shown in any one of SEQ ID NO.10-11 and 113 or a locked nucleic acid modified by other fluorescent groups or quenching groups at the 5 'end and/or the 3' end of the nucleotide sequences or modified by the nucleotide sequences, and the locked nucleic acid is replaced by the following modified substitutions: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other fluorescent or quenching groups are selected from: FAM, HEX, VIC, ROX, cy3, cy5, cy5.5, cy7, alexa Fluor 488, AMCA, aquaPhluor 593, allo 425, atto 590, BODIPY FL, JOE, R110, NED, pacific Blue, quasar 570, quasar 670, TAMRA, FITC, TET, texas red, yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, dabcyl, eclipse; more preferably, the 5' end of the additional fluorescent group or quenching group is selected from: FAM, VIC, HEX, ROX, CY-5 and CY5.5; the other fluorophore or quencher group at the 3' end is selected from the group consisting of: BHQ1, BHQ2, MGB;

(2) The upstream primer for detecting the B-raf mutation is selected from the nucleotide sequences shown in any one of SEQ ID NO. 12-14; the downstream primer is selected from the nucleotide sequences shown in any one of SEQ ID NO. 15-17; the B-raf blocker is selected from the nucleotide sequence shown in any one of SEQ ID NO.18-20 or a locked nucleic acid with other modifications blocking the self extension of the blocker or the nucleotide sequence thereof at the 3' end is modified to be a modified substitution selected from the group consisting of: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other modification that blocks the elongation of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from the nucleotide sequence shown in any one of SEQ ID NO.21-22 or the locked nucleic acid modified by other fluorescent groups or quenching groups at the 5 'end and/or the 3' end of the nucleotide sequence or the nucleotide sequence is modified by the following modified substitutions: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other fluorescent or quenching groups are selected from: FAM, HEX, VIC, ROX, cy3, cy5, cy5.5, cy7, alexa Fluor 488, AMCA, aquaPhluor 593, allo 425, atto 590, BODIPY FL, JOE, R110, NED, pacific Blue, quasar 570, quasar 670, TAMRA, FITC, TET, texas red, yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, dabcyl, eclipse; more preferably, the 5' end of the additional fluorescent group or quenching group is selected from: FAM, VIC, HEX, ROX, CY-5 and CY5.5; the other fluorophore or quencher group at the 3' end is selected from the group consisting of: BHQ1, BHQ2, MGB;

(3) The upstream primer for detecting EGFR T790M mutation is selected from the nucleotide sequence shown in any one of SEQ ID NO. 23-25; the downstream primer is selected from the nucleotide sequences shown in any one of SEQ ID NO. 26-28; EGFR blocker is selected from the nucleotide sequence shown in SEQ ID NO.29 or 31 or a locked nucleic acid with other modifications blocking the self extension of the blocker or the nucleotide sequence thereof at the 3' end is modified by a modification substitution selected from the group consisting of: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other modification that blocks the elongation of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from the nucleotide sequence shown in SEQ ID NO.32 or a locked nucleic acid modified by other fluorescent groups or quenching groups at the 5 'end and/or the 3' end of the nucleotide sequence or modified by the nucleotide sequence, and the locked nucleic acid is replaced by the following modified substitutions selected from the group consisting of: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other fluorescent or quenching groups are selected from: FAM, HEX, VIC, ROX, cy3, cy5, cy5.5, cy7, alexa Fluor 488, AMCA, aquaPhluor 593, allo 425, atto 590, BODIPY FL, JOE, R110, NED, pacific Blue, quasar 570, quasar 670, TAMRA, FITC, TET, texas red, yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, dabcyl, eclipse; more preferably, the 5' end of the additional fluorescent group or quenching group is selected from: FAM, VIC, HEX, ROX, CY-5 and CY5.5; the other fluorophore or quencher group at the 3' end is selected from the group consisting of: BHQ1, BHQ2, MGB;

(4) The upstream primer for detecting ESR1 mutation is selected from the nucleotide sequences shown in any one of SEQ ID NO. 40-42; the downstream primer is selected from the nucleotide sequences shown in any one of SEQ ID NO. 43-45; the ESR1 Blocker is selected from the nucleotide sequences shown in any one of SEQ ID NO.46-48 and 108 or the 3' -end of the Blocker is provided with other modifications for blocking the self extension of the Blocker or the modification of the locked nucleic acid of the nucleotide sequence is replaced by the following modifications: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other modification that blocks the elongation of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from the nucleotide sequence shown in SEQ ID NO.49 or 111 or the locked nucleic acid with other fluorescent groups or quenching groups modified at the 5 'end and/or the 3' end or the nucleotide sequence thereof is modified by the following modified substitutions: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other fluorescent or quenching groups are selected from: FAM, HEX, VIC, ROX, cy3, cy5, cy5.5, cy7, alexa Fluor 488, AMCA, aquaPhluor 593, allo 425, atto 590, BODIPY FL, JOE, R110, NED, pacific Blue, quasar 570, quasar 670, TAMRA, FITC, TET, texas red, yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, dabcyl, eclipse; more preferably, the 5' end of the additional fluorescent group or quenching group is selected from: FAM, VIC, HEX, ROX, CY-5 and CY5.5; the other fluorophore or quencher group at the 3' end is selected from the group consisting of: BHQ1, BHQ2, MGB;

(5) The upstream primer for detecting the PIK3CA E542/E545 locus mutation is selected from nucleotide sequences shown in any one of SEQ ID NO.50-52 and 105; the downstream primer is selected from nucleotide sequences shown in any one of SEQ ID NO.53-55 and 106; the PIK3CA E542/E545 Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NO.56-58 or has other modifications blocking the self extension of the Blocker at the 3' end or the modification of the locked nucleic acid of the nucleotide sequence is replaced by a modification selected from the following: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other modification that blocks the elongation of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from any one of the nucleotide sequences shown in SEQ ID NO.59-60 and 107 or the 5 'end and/or 3' end of the nucleotide sequence is modified by other fluorescent groups or quenching groups or the locked nucleic acid of the nucleotide sequence is modified by the following modified substitution: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other fluorescent or quenching groups are selected from: FAM, HEX, VIC, ROX, cy3, cy5, cy5.5, cy7, alexa Fluor 488, AMCA, aquaPhluor 593, allo 425, atto 590, BODIPY FL, JOE, R110, NED, pacific Blue, quasar 570, quasar 670, TAMRA, FITC, TET, texas red, yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, dabcyl, eclipse; more preferably, the 5' end of the additional fluorescent group or quenching group is selected from: FAM, VIC, HEX, ROX, CY-5 and CY5.5; the other fluorophore or quencher group at the 3' end is selected from the group consisting of: BHQ1, BHQ2, MGB;

(6) The upstream primer for detecting the PIK3CA H1047 locus mutation is selected from the nucleotide sequences shown in any one of SEQ ID NO. 61-63; the downstream primer is selected from the nucleotide sequences shown in any one of SEQ ID NO. 64-66; the PIK3CA H1047 Blocker is selected from any one of the nucleotide sequences shown in SEQ ID NO.67-69, 110 and 114 or the 3' end of the nucleotide sequence is modified by other modification for blocking the self extension of the Blocker or the locked nucleic acid of the nucleotide sequence is modified by the following modification substitutions: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other modification that blocks the elongation of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from any one of the nucleotide sequences shown in SEQ ID NO.70-71, 109 and 115 or a locked nucleic acid modified by other fluorescent groups or quenching groups at the 5 'end and/or the 3' end of the nucleotide sequence or modified by the nucleotide sequence, and is replaced by the following modification selected from the group consisting of: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other fluorescent or quenching groups are selected from: FAM, HEX, VIC, ROX, cy3, cy5, cy5.5, cy7, alexa Fluor 488, AMCA, aquaPhluor 593, allo 425, atto 590, BODIPY FL, JOE, R110, NED, pacific Blue, quasar 570, quasar 670, TAMRA, FITC, TET, texas red, yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, dabcyl, eclipse; more preferably, the 5' end of the additional fluorescent group or quenching group is selected from: FAM, VIC, HEX, ROX, CY-5 and CY5.5; the other fluorophore or quencher group at the 3' end is selected from the group consisting of: BHQ1, BHQ2, MGB;

(7) The upstream primer for detecting the N-ras mutation is selected from the nucleotide sequences shown in any one of SEQ ID NOS.72-74; the downstream primer is selected from the nucleotide sequences shown in any one of SEQ ID NO. 75-77; the N-ras Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NO.78-80 or a locked nucleic acid having other modifications at the 3' end thereof for blocking the Blocker from self-extension or the nucleotide sequence thereof is modified to a modified substitution selected from the group consisting of: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other modification that blocks the elongation of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from any one of the nucleotide sequences shown in SEQ ID NO.81-82 and 112 or the 5 '-end and/or 3' -end of the nucleotide sequence is modified by other fluorescent groups or quenching groups or the locked nucleic acid of the nucleotide sequence is modified by the following modified substitution: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other fluorescent or quenching groups are selected from: FAM, HEX, VIC, ROX, cy3, cy5, cy5.5, cy7, alexa Fluor 488, AMCA, aquaPhluor 593, allo 425, atto 590, BODIPY FL, JOE, R110, NED, pacific Blue, quasar 570, quasar 670, TAMRA, FITC, TET, texas red, yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, dabcyl, eclipse; more preferably, the 5' end of the additional fluorescent group or quenching group is selected from: FAM, VIC, HEX, ROX, CY-5 and CY5.5; the other fluorophore or quencher group at the 3' end is selected from the group consisting of: BHQ1, BHQ2, MGB;

(8) The upstream primer for detecting EGFR L858R mutation is selected from the nucleotide sequences shown in any one of SEQ ID NO. 83-85; the downstream primer is selected from the nucleotide sequences shown in any one of SEQ ID NO. 86-88; EGFR L858R Blocker is selected from any one of the nucleotide sequences shown in SEQ ID No.89-91 or a locked nucleic acid having other modifications at its 3 'end that block the Blocker's own extension or a nucleotide sequence thereof is modified to a modified substitution selected from the group consisting of: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other modification that blocks the elongation of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from the nucleotide sequence shown in SEQ ID NO.92 or a locked nucleic acid modified by other fluorescent groups or quenching groups at the 5 'end and/or the 3' end of the nucleotide sequence or modified by the nucleotide sequence, and the locked nucleic acid is replaced by the following modified substitutions: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other fluorescent or quenching groups are selected from: FAM, HEX, VIC, ROX, cy3, cy5, cy5.5, cy7, alexa Fluor 488, AMCA, aquaPhluor 593, allo 425, atto 590, BODIPY FL, JOE, R110, NED, pacific Blue, quasar 570, quasar 670, TAMRA, FITC, TET, texas red, yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, dabcyl, eclipse; more preferably, the 5' end of the additional fluorescent group or quenching group is selected from: FAM, VIC, HEX, ROX, CY-5 and CY5.5; the other fluorophore or quencher group at the 3' end is selected from the group consisting of: BHQ1, BHQ2, MGB;

(9) The upstream primer for detecting EGFR 19del mutation is selected from the nucleotide sequence shown in any one of SEQ ID NO. 93-95; the downstream primer is selected from nucleotide sequences shown in any one of SEQ ID NO. 96-98; EGFR 19del Blocker is selected from any one of the nucleotide sequences shown in SEQ ID No.99-101 or a locked nucleic acid having other modifications blocking the Blocker's own extension at its 3' end or a nucleotide sequence thereof is modified to a modified substitution selected from the group consisting of: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other modification that blocks the elongation of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from any one of the nucleotide sequences shown in SEQ ID NO.102 or a locked nucleic acid modified by other fluorescent groups or quenching groups at the 5 'end and/or the 3' end of the nucleotide sequence or modified by the nucleotide sequence, and the locked nucleic acid is selected from the following modified substitutions: hexitol nucleic acids, 2' -O-methylated oligonucleotides, peptide nucleic acid modifications; preferably, the other fluorescent or quenching groups are selected from: FAM, HEX, VIC, ROX, cy3, cy5, cy5.5, cy7, alexa Fluor 488, AMCA, aquaPhluor 593, allo 425, atto 590, BODIPY FL, JOE, R110, NED, pacific Blue, quasar 570, quasar 670, TAMRA, FITC, TET, texas red, yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, dabcyl, eclipse; more preferably, the 5' end of the additional fluorescent group or quenching group is selected from: FAM, VIC, HEX, ROX, CY-5 and CY5.5; the other fluorophore or quencher group at the 3' end is selected from the group consisting of: BHQ1, BHQ2, MGB;

Optionally, the detection probe and/or blocking probe blocker is with or without modification.

In some embodiments of the present disclosure, the detection probe and/or blocking probe blocker is with or without modification.

In some embodiments of the disclosure, the detection reagent or kit further comprises an internal reference comprising an internal reference detection probe, an internal reference upstream primer, and an internal reference downstream primer.

In some embodiments of the present disclosure, the reference upstream primer is selected from the nucleotide sequences set forth in any one of SEQ ID NOS.33-35.

In some embodiments of the present disclosure, the internal reference downstream primer is selected from the nucleotide sequences set forth in any one of SEQ ID NOS.36-38.

In some embodiments of the present disclosure, the reference detection probe comprises the nucleotide sequence set forth in SEQ ID No. 39.

In some embodiments of the present disclosure, the detection probe and/or blocking probe blocker has a modification.

In some embodiments of the disclosure, the modification is selected from one or more of a nucleic acid modification, a peptide nucleic acid modification, a phosphorothioate modification, a ddC, an inverted dT, an MGB, a quencher modification, or a fluorophore modification.

In some embodiments of the disclosure, the modification is one or more of a locked nucleic acid modification, phosphorothioate modification, ddC, inverted dT, or MGB modification.

In some embodiments of the present disclosure, the probe is modified at the 5 'end with a fluorescent group and/or modified at the 3' end with a quenching group.

In some embodiments of the present disclosure, the fluorescent group is selected from one of the following: FITC, TET, JOE, R110, FAM, CY-5, CY-5.5, HEX, VIC, ROX or CY-3.

In some embodiments of the present disclosure, the quenching group is selected from one of the following: TAMRA, BHQ-1, BHQ-2, dabcyl or MGB.

In another aspect, the present disclosure provides a method for multiplex digital PCR detection of gene mutations that can simultaneously detect at least 2 mutation sites in one PCR sample, the mutations being located at the same target or at different targets, the detection method comprising:

(1) Obtaining DNA from a sample to be tested;

(3) Droplet generation, PCR amplification and chip reading;

in some embodiments of the disclosure, the DNA is free DNA.

In some embodiments of the disclosure, the sample to be tested is selected from one or more of tumor cells, blood, plasma, pleural effusion, peritoneal effusion, saliva, urine, tissue, or fetal early detection samples.

In some embodiments of the disclosure, the sample to be tested is a blood sample, a plasma sample, a tissue sample, or a cell sample.

In some embodiments of the disclosure, the blood sample is a peripheral blood sample.

In some embodiments of the disclosure, the sample is selected from one or more of lung cancer, colorectal cancer, or breast cancer samples.

In some embodiments of the disclosure, the genetic mutation detection is directed to a genetic detection prior to targeted therapy.

Examples

The technical scheme of the present disclosure is further described below by means of specific embodiments. It should be apparent to those skilled in the art that the examples are merely provided to aid in the understanding of the present disclosure and should not be construed as a specific limitation on the present disclosure.

Example 1: multiplex PCR detection system establishment

1. Primer, probe and blocker design

Multiplex PCR reactions typically include PCR enzymes, PCR buffers, mutation detection amplicons, internal reference amplicons, and the like. In the embodiment, the Blocker which is completely matched with the wild template is introduced, and the Tm value of the Blocker is improved through modification such as LNA, MGB and ddC, so that the ability of the Blocker to recognize base mismatch is enhanced, the Blocker is stably combined with the wild template, and amplification of the wild template is blocked. In addition, the 5 'end of the Blocker is modified by phosphorothioate to enhance the resistance to the hydrolysis activity of Taq enzyme, and the 3' end of the Blocker is modified by MGB, inverted dT or ddC to block the extension of the Blocker.

However, due to the difference in the sequence of different genes, the blocking effect of a part of the blocker on wild-type amplification is limited, and there may be cases where a part of the blocker is amplified by wild-type amplification. In the detection system, the blocker is modified by LNA, MGB, ddC and the like so that the Tm value of the blocker bound with a wild-type template is higher than that of a corresponding mutant Taqman probe. Wild type templates preferentially bind to the blocker and cannot bind to mutant Taqman probes to generate fluorescent signals. Meanwhile, LNA modification on a mutation site improves the capability of a wild type blocker for recognizing base mismatch, and the Tm of a double chain formed by combining the LNA modification with a mutation template with the base mismatch is greatly reduced and is lower than the Tm value of the double chain formed by a fluorescent probe and the mutation template; thus, the mutant templates will preferentially bind to the corresponding mutant probes to generate fluorescent signals.

Therefore, in theory, the blocker in the detection system can effectively reduce the amplification of the wild template to the detectable range of the instrument, and meanwhile, the amplification efficiency of the mutant template is not obviously affected.

Primers for detection of K-ras, B-raf, EGFR, ESR1, PIK3CA E542/E545, PIK3CA H1047 and N-ras mutations were accomplished by NCBI Blast design; the primer length is 18-25 nucleotides, the GC content of the primer is 40% -60%, and the Tm value of the primer is 55-65 ℃. The Tm values of the primers are approximately close to ensure efficient amplification of the primer pair at the same annealing temperature. The amplified product size of the primer is in the range of 100-200 bp. The blocker sequence used was designed using Snapgene software. The length of the Blocker is 15-40 bp, and the Tm value is 60-75 ℃. The individual blocker Tm values are approximately close to ensure that they maintain high blocking efficiency under the same reaction conditions. Specific probes for detecting K-ras, B-raf, EGFR, ESR1, PIK3CA E542/E545, PIK3CA H1047 and N-ras hotspot mutations, and 3' -terminal modified with quenching groups such as MGB, BHQ1, BHQ2 and the like; the 5' end of the probe is provided with FAM, HEX, CY-5, and ROX fluorescent group modification is used for detecting the amplification conditions of different amplicons. EIF2C1 is selected as an internal reference, primer probe combinations which can stably amplify non-specific products and dimers are selected, and after design is finished, each primer, each probe and each blocker are compared by NCBI Blast software, so that the specificity of each sequence is ensured. Specific detection system information is shown in Table 1. Primers, probes and a blocker for detection were diluted to 10. Mu.M.

TABLE 1 detection System sequence information

/>

Note that: "+" indicates the right base lock nucleic acid modification, and "+" indicates the right phosphorothioate modification. Taking SEQ ID No.108 as an example, A ACGTGGTGCCC +CT+CT+ATG+A+C+ CTGCTGCTGGAGAT-ddC, wherein one oxygen in the phosphodiester bond between nucleotide 1 and nucleotide 2 is replaced by sulfur to form a phosphorothioate bond, namely, the right side of nucleotide 1 is provided with thio modification; there are locked nucleic acid modifications at nucleotide numbers 13, 15, 17, 20-22.

2. Detection reaction scheme

2.1 sample pretreatment

Plasma samples: DNA was extracted using a kit QIAamp Circulating Nucleic Acid Kit (50) (Qiagen, 55114) and then added to the reaction system in an amount of 5 to 30ng.

Tissue samples: DNA was extracted using the Kit DNeasy Blood & Tissue Kit (50) (Qiagen, 69504) and then added to the reaction system in an amount of 5 to 50ng.

Cell samples: cell samples such as CTC can be added into the reaction system after being cracked or directly, and the cell quantity is 1000-10000.

2.2 configuration of the reaction System

The reaction system recipe is shown in Table 2, and the reaction system is generally configured at 35. Mu.L. Specific primers, probes and blocks are selected according to the detected mutation gene locus and quantity.

TABLE 2 reaction system

Reagent(s)	Volume (mu L)	Concentration of
			10X buffer	3.5	1X
PCR polymerase	1	1X
			Upstream primer	1.05	300nM
Downstream primer	1.05	300nM
			blocker/H ₂ O	2.1	600nM
Probe with a probe tip	0.7	200nM
			Enzyme-free water	Complement to	/
Template	1 to 12 (determined according to the template concentration)	/
			Totals to	35	/

2.3 sample application detection

The detection was performed on-machine according to the requirements of the fluorescence or digital PCR instructions, and the specific reaction conditions are shown in Table 3.

TABLE 3 reaction conditions

And (5) counting and analyzing experimental results.

Example 2: blocker blocking efficiency test in fluorescent PCR platform

1. Experimental procedure

(1) Extracting DNA of a cell line Calu-1 as a K-ras gene positive template; extracting DNA of a cell line HT-29 as a B-raf gene positive template; extracting DNA of a cell line NCI-H1975 as EGFR T790M and EGFR L858R gene positive templates; extracting DNA of a cell line HCC827 as an EGFR 19del positive template; synthetic plasmid 014 (SEQ ID No.117, synthesized by Kirschner Co., ltd.) as PIK3CA H1047L mutation positive, synthetic plasmid 017 (SEQ ID No.118, synthesized by Kirschner Co., ltd.) as PIK3CA E542K mutation positive, synthetic plasmid 011 (SEQ ID No.116, synthesized by Kirschner Co., ltd.) as ESR 1D 538G mutation positive plasmid, synthetic plasmid 028 (SEQ ID No.119, synthesized by Kirschner Co., ltd.) as Nras Q61K mutation positive; DNA of the cell line HEK-923 was extracted as a negative template.

(2) The DNA extracted in step (1) was diluted to 3 ng/. Mu.L, and a wild-type template and a mutant template at the corresponding detection sites were prepared according to Table 4, respectively.

Table 4 Module for each experimental group

(3) PCR reaction

The experimental group 1 selects the upstream and downstream primers of K-ras and K-ras Probe, and detects the amplification condition and CT value of the wild-type template and mutant template of K-ras gene under the conditions of Calu-1Blocker and no Blocker respectively.

The experimental group 2 selects the upstream and downstream primers of B-raf and B-raf Probe, and detects the amplification condition and CT value of the wild type template and mutant template of B-raf gene under the conditions of B-raf blocking device and non-blocking device respectively.

The experimental group 3 selects EGFR T790M upstream and downstream primer and EGFR Probe, and detects the amplification condition and CT value of EGFR wild type template and mutant template under different conditions (EGFR T790M Blocker1 exists, blocker 1106 exists and Blocker does not exist).

Experiment group 4 selects EGFR L858R upstream and downstream primers and EGFR L858R Probe, and detects amplification conditions and CT values of EGFR L858R gene wild type template and mutant type template under EGFR L858R blocker and no blocker conditions respectively.

Experiment group 5 selects EGFR 19del upstream and downstream primers and EGFR 19del Probe, and detects amplification conditions and CT values of EGFR 19del gene wild type templates and mutant templates under EGFR 19del blocking and non-blocking conditions respectively.

The experimental group 6 selects upstream and downstream primers of PIK3CA H1047L and probes of PIK3CA H1047L, and detects the amplification condition and CT value of the PIK3CA H1047L gene wild type template and mutant template under the conditions of PIK3CA H1047L blocking device and no blocking device respectively.

The experimental group 7 selects the upstream and downstream primers of the PIK3CA E542 and the PIK3CA E542 Probe, and detects the amplification condition and CT value of the PIK3CA E542 gene wild type template and mutant template under the conditions of PIK3CA E542 blocker and non-blocker.

Experiment group 8 selects ESR 1D 538G upstream and downstream primers and ESR 1D 538G probes, and detects the amplification conditions and CT values of the ESR 1D 538G gene wild-type template and mutant template under the conditions of ESR 1D 538G blocker and no blocker, respectively.

The experimental group 9 selects the upstream and downstream primers of N-ras Q61K and N-ras Q61K Probe, and detects the amplification condition and CT value of the wild-type template and mutant template of the N-ras Q61K gene under the conditions of N-ras Q61K blocker and no blocker respectively.

Specific primer, probe and blocker information are shown in Table 5.

TABLE 5 primer probes and blocker information in this example

A PCR reaction solution was prepared according to Table 2, in which the volume of the template was 5. Mu.L.

The reaction procedure is shown in Table 6.

Table 6 reaction procedure

2. Experimental results

The amplification curve results for each experimental group are shown in FIGS. 1-4 and tables 7-9.

TABLE 7 test results for test groups 1-3

Note that: "NoCt" means that the sample is not amplified. "/" indicates no addition.

Table 8 test set 4-6 results

TABLE 9 test set 7-9 test results

/>

The experimental group 1K-ras blocker test results are shown in FIG. 1, and as can be seen from FIG. 1, the addition of a blocker in a wild-type template effectively blocks the amplification of the wild-type template, but has no effect on the amplification of a mutant template.

The test results of the experiment group 2B-raf blocker are shown in fig. 2, and as can be seen from fig. 2, in the wild type template, the addition of the blocker effectively blocks the amplification of the wild type template, but has no influence on the amplification of the mutant template, and the Ct value is increased after the addition of the blocker in the mutant sample because the mutation frequency of the cell B-raf is 20%.

Experimental group 3EGFR T790M blocker the results of the test are shown in fig. 3, and it can be seen from fig. 3 that the addition of the blocker effectively blocked wild-type amplification but had no effect on the amplification of mutant templates in wild-type templates compared to the blocker-control group.

The blocking effect of the blocking device-1106 in the experimental group 3 is shown in fig. 4, and as can be seen from fig. 4, the blocking effect is poor and the blocking effect is not satisfactory because the blocking device-1106 cannot effectively block the amplification of EGFR T790M wild type template.

The experimental results of experimental groups 4-9 show that the blocking efficiency of the wild type template can be effectively reduced by the screened blocking device, the mutant amplification and the detection of the mutant template by the probe are not influenced, and the blocking device can be used for the subsequent combination research.

3. Conclusion of the experiment

From the above experimental results, it is found that the appropriate blocker can effectively reduce the blocking efficiency of the wild-type template, and does not affect the mutant amplification and detection of the mutant template by the probe. The blocking effect of experimental group 3EGFR T790M blocker was not very desirable, i.e., a small amount of wild-type amplification was observed after the addition of the blocker, but the signal was greatly diminished. The blocker-1106 is unstable in combination with a wild type template, cannot effectively block amplification of an EGFR T790M wild type template, has poor blocking effect and does not meet the requirements.

Example 3: internal reference primer screening

Primers were designed using NCBI Blast, wherein the primer sequences are shown in Table 10.

TABLE 10 sequence information

	Specific sequence	SEQ ID NO.
			EIF2C1 FP1	TCTTTGGTGATCGCAAGCCT	33
EIF2C1 RP1	GCTTGGTTCTACCCCAGACC	36
			EIF2C1 FP2	CTGGGCACATGAGCAACCTA	34
EIF2C1 RP2	CACACGCGGTACTTCCTCTT	37
			EIF2C1 FP3	AAATCCCCTTGGGGTATGCTC	35
EIF2C1 RP3	CACGCGGTACTTCCTCTTCAT	38

1. Internal reference primer screening for stable and non-specific amplification and dimer of product

1.1 Experimental procedure

(1) 15 ng of HEK-293 cell genomic DNA was extracted as a sample and no enzyme water was used as a blank.

(2) Setting three temperature gradients of 56 ℃,59 ℃ and 62 ℃, judging the quantity and the specificity of amplified products according to a melting curve after amplification, and screening out internal reference primers which have stable product quantity and no specific amplification and dimer.

(3) Reagents were prepared as shown in Table 11, and the procedure is shown in Table 12.

Table 11 reactant formulation

Reagent(s)	Volume (mu L)	Concentration of
			10X buffer	3.5	1X
PCR polymerase	1	1X
			Upstream primer	1.05	300nM
Downstream primer	1.05	300nM
			Evagreen	3.5	2X
Enzyme-free water	Complement to	—
			Template	5	15ng

TABLE 12 reaction conditions

1.2 experimental results

Amplification curves for three pairs of internal reference primers at different annealing temperatures are shown in FIGS. 5-7. As can be seen from FIGS. 5-7, the FP1/RP1 primer pair had very little product at different temperatures, while the FP2/RP2 primer pair had stable product and no non-specific peaks, and the FP3/RP3 primer pair had reduced product at 62℃and no non-specific peaks.

1.3 conclusion of experiments

The annealing temperature test shows that the FP1/RP1 primer pair has low product quantity; the FP2/RP2, FP3/RP3 primer pair requires a further determination of the amplification efficiency under the reaction conditions.

2. Internal reference primer amplification efficiency test

In summary, the amplification efficiency of the FP2/RP2, FP3/RP3 primer pairs was further tested.

The reaction template is subjected to gradient dilution, HEK-293 cell genome DNA of which gradient samples 1-4 are 100ng, 20ng, 4ng and 0.8ng respectively, reagent preparation is shown in a table 11, reaction conditions are shown in a table 13, and primer amplification efficiency is calculated after a curve is drawn for obtaining template amplification Ct values of different gradients.

TABLE 13 reaction procedure

The amplification efficiency test results of the FP2/RP2, FP3/RP3 primer pair are shown in FIG. 8, wherein the amplification efficiency of FP2/RP2 is 103% and the amplification efficiency of FP3/RP3 is 93%.

In view of the fact that the amplification efficiency of the FP2/RP2 primer pair is higher than that of the FP3/RP3 primer pair, the FP2/RP2 primer pair is selected as an internal reference primer in the detection system.

Example 4: multiplex blocker-PCR reaction on fluorescent PCR platform

This example uses a fluorescent PCR platform to test the specificity of a multiplex PCR reaction with the addition of a blocker. And verifying whether each detection target is mutually interfered or not under the multi-blocker-PCR reaction.

1. Experimental procedure

(1) Extracting DNA of a cell line NCI-H1975 as an EGFR gene positive template; extracting DNA of a cell line HT-29 as a B-raf gene positive template; extracting DNA of a cell line Calu-1 as a K-ras gene positive template; DNA of the cell line HEK-923 was extracted as a negative template. Specific information is shown in Table 14.

Table 14 template information table

Template	Mutation type	Mutation frequency
			NCI-H1975	EGFR T790M	80％
HT-29	B-raf V600E	20％
			Calu-1	K-ras G12C	80％
HEK-293	Wild type	/
			Enzyme-free water	Blank space	/

(2) The DNA extracted in step (1) was diluted to 3 ng/. Mu.L for use, and primers, probes and a blocker for detection were shown in Table 15, and reaction solutions were prepared according to the formulations of Table 16, respectively. A control group without adding a Blocker is arranged in each experimental group, other components of the control group are consistent with those of the experimental group, only the Blocker corresponding to the mutant gene is not added, and the same volume of nuclease-free water is used for supplementing the volume.

TABLE 15 sequence information

TABLE 16 reaction system

/>

(3) The reaction procedure is shown in Table 6.

2. Experimental results

The amplification curves for each experimental group are shown in FIGS. 9-13.

The NCI-H1975 cell line extracted DNA detection results are shown in FIG. 9, and the experiment group without blocking by adding a blocker, and the probe is combined with a wild type template for amplification, so that all mutation detection fluorescent channels have signals; in the experiment group with the addition of the blocker, only EGFR mutation and an internal reference fluorescent channel are detected to have signals, which indicates that the sample is positive to EGFR T790M mutation, and the fact is consistent.

The result of DNA extraction detection of HT29 cell line is shown in FIG. 10, and in the experimental group without blocking by adding a blocker, the probe is amplified by combining with a wild-type template, so that all mutation detection fluorescent channels have signals; in the experimental group to which the blocking device was added, only the B-raf mutation and the internal fluorescent channel were detected and signaled. There is a small amount of amplified signal in the ROX channel (EGFR), but the signal is greatly reduced. The assay may be due to competition by the blocker, the probability of binding of the probe to the wild-type template is greatly reduced, and the signal is greatly reduced below the positive threshold line.

The DNA detection results of Calu-1 cell line extraction are shown in FIG. 11, and the experiment group without blocking by adding a blocker, the probe and the wild type template are combined and amplified, so that all mutation detection fluorescent channels have signals; the blocking er panel was added and only the K-ras mutation and internal fluorescent channel were detected. The ROX channel has a small amount of amplified signal, but the signal is greatly reduced.

The result of DNA detection extracted by HEK-293 cell line is shown in FIG. 12, and an experimental group blocked by a blocking device is not added, and the probe is combined with a wild template for amplification, so that all mutation detection fluorescent channels have signals; the blocking er experimental group was added and only the reference fluorescent channel had a signal. The ROX channel has a small amount of amplified signal, but the signal is greatly reduced.

The NTC (non-enzymatic water blank) detection results are shown in FIG. 13, in which the FAM channel for detecting K-ras in the experimental group without the addition of a blocker showed significant non-specific amplification, but the non-specific amplification disappeared after the addition of a blocker. This shows that the specificity of the reaction system can be effectively improved by adding a blocking device.

3. Conclusion of the experiment

In conclusion, the fluorescence PCR is used for testing that the reactions of multiple blocking devices are not interfered with each other, the blocking device of each detection target can effectively block the amplification of a wild template, the amplification of a mutant template is not influenced, and the function of reducing the non-specific signal generated by the combination of a mutant probe and the wild template can be achieved.

Example 5 blocker blocking efficiency test of digital PCR platform

In the embodiment, the digital PCR system biodigital blue of Shanghai small turtle science and technology Co., ltd is used, the system is 4-5 paths of fluorescent channels, 96 samples can be processed in parallel, and the number of effective liquid drops of a chip is 2-20 ten thousand. The control group without adding a Blocker is arranged, other components of the control group are consistent with those of the experimental group, the K-ras Blocker, the B-raf Blocker and the EGFR Blocker are not added, and the same volume of nuclease-free water is used for supplementing the volume.

1. Experimental procedure

(1) Extracting DNA of a cell line NCI-H1975 as an EGFR gene positive template; extracting DNA of a cell line HT-29 as a B-raf gene positive template; extracting DNA of a cell line Calu-1 as a K-ras gene positive template; the cell line HEK-923 was extracted as a wild-type template. The specific information of the template is shown in table 14.

(2) The DNA extracted in step (1) was diluted to 3 ng/. Mu.l, respectively, and primers, probes and a blocker for detection were shown in Table 15, and reaction solutions were prepared according to the formulations of Table 16, respectively. And setting a control group without adding a Blocker in each experimental group, wherein other components of the control group are consistent with those of the experimental group, the blocking group without adding a corresponding mutant gene is adopted, and the same volume of nuclease-free water is used for supplementing the volume.

(3) And opening a chip sample injection program according to the requirements of a digital PCR sample injection instrument on an operation instruction, and completing chip sample injection. The reaction procedure is shown in Table 6.

2. Experimental results

The results of the digital PCR for each experimental group are shown in FIGS. 14-17 and Table 17.

The results of the digital PCR assay for DNA extracted from the sample Calu-1 cell line are shown in FIG. 14, which is an 80% K-ras G12C mutant, braf, EGFR wild type. In addition to the FAM channel and the internal CY-5 channel for K-ras mutation, the VIC and ROX channels for B-raf EGFR were also shown to be nonspecific signals in the blocker-control group, and only the FAM signal and the internal CY-5 signal for K-ras mutation were detected in the blocker+ experimental group.

Sample HT-29 cell line DNA digital PCR assay results are shown in FIG. 15, which is a 20% B-raf V600E mutant, K-ras, EGFR wild type. In the blocker-control group, in addition to the VIC channel and the internal CY-5 channel for detecting B-raf mutation, the FAM and ROX channels of K-ras and EGFR were also shown to be nonspecific signals, and in the blocker+ experimental group, only the VIC signal and the internal CY-5 signal for detecting B-raf mutation were detected.

The results of the digital PCR assay for DNA extracted from NCI-H1975 cell line are shown in FIG. 16, which shows the 80% EGFR T790M mutant, K-ras, B-raf wild type. In addition to the ROX channel and the internal CY-5 channel, which detect EGFR mutations, the FAM and VIC channels, which detect K-ras and B-raf, also exhibited non-specific signals in the blocker-control group, and only the signal to detect EGFR mutations and the internal CY-5 signal in the blocker+ experimental group.

The results of digital PCR detection of DNA extracted from HEK-293 cell line are shown in FIG. 17, and the samples are K-ras, B-raf and EGFR wild type. In the blocker-control group, in addition to the internal reference CY-5 channel, non-specific signals were also present in the FAM, VIC and ROX channels of K-ras, B-raf and EGFR, and in the blocker+ experimental group, only the internal reference CY-5 signal was present.

The NTC (enzyme-free water blank) assay results are shown in FIG. 18, with no signal at all channels.

Table 17 blocking rate for each experimental group

/>

Note that: the CY5 channel is the reference channel in this example, so the blocking rate is not calculated. The detection result shows that the copy concentration of the internal reference primer group under the Bl+/Bl-is equivalent, and the concentration reaches the internal reference standard.

3. Conclusion of the experiment

The multiple mutation detection reaction system is verified on a digital PCR platform, and the result shows that the addition of the blocker can effectively block wild type amplification and reduce wild type non-specific signals.

Example 6 multiplex PCR detection System for use in simulated clinical sample detection

In order to verify the accuracy and sensitivity of the multiple PCR detection system of the present disclosure, the present embodiment selects an analog clinical sample for digital PCR detection, and specific experimental steps and results are as follows.

1. Experimental procedure

(1) Extracting DNA of a cell line NCI-H1975 as an EGFR gene positive template; extracting DNA of a cell line HT-29 as a B-raf gene positive template; extracting DNA of a cell line Calu-1 as a K-ras gene positive template; DNA of the cell line HEK-923 was extracted as a negative template. Specific mutation frequencies are shown in Table 14, diluted to 3.5 ng/. Mu.L for use.

(2) The primers, probes and the blocker used for the detection are shown in Table 15, and the reaction solutions were prepared according to the formulations shown in Table 16.

(3) Samples containing 5%,0.5%,0.25%,0.1% K-ras G12C, B-raf V600E, EGFR T790M mutation were prepared and added to the reaction system of step (2), respectively.

(4) And opening a chip sample injection program according to the requirements of a digital PCR sample injection instrument on an operation instruction, and completing chip sample injection. The reaction procedure is shown in Table 6.

2. Experimental results

The test results are shown in Table 18. As can be seen from Table 18, in the multi-mutant gene detection, the multiplex PCR detection system of the present disclosure only detected the signal of FAM channel in the sample of 5% K-ras G12C mutation, which was consistent with the actual situation and the mutation ratio was 6.67%. In addition, the gradient of the K-ras G12C mutation samples with 5%,0.5%,0.25% and 0.1% of gradient dilution is reduced, which indicates that the multiplex PCR detection system disclosed by the invention has better specificity and higher sensitivity while maintaining the accuracy. Similarly, the detection results of the B-raf V600E, EGFR T790M mutant samples also have the same characteristics.

Table 18 simulation of clinical sample test results

/>

Example 7 multiplex PCR detection System for cfDNA sample detection of clinical samples

In order to further verify the detection accuracy of the multiple PCR detection system for clinical samples, the cfDNA of the clinical samples is selected for digital PCR detection in the embodiment, and specific experimental steps and results are as follows.

1. Experimental procedure

(1) 10ml of fresh whole blood samples of 10 clinical patients were collected, of which 1 was K-ras G12C positive mutation (number 5), 1 was EGFR T790M positive mutation (number 6), and the remaining 8 were K-ras G12C, EGFR T790M, B-raf negative samples; the samples were collected and centrifuged at 700g for 10min at 4℃and the supernatant carefully transferred to a fresh 15ml centrifuge tube; centrifuging the supernatant in the centrifuge tube for 10min at 15000g at 4 ℃, and carefully transferring the supernatant into a new 15ml centrifuge tube to obtain a separated plasma sample;

(2) Extracting cfDNA of the plasma sample of step (1) according to the instructions using QIAamp Circulating Nucleic Acid Kit (Qiagen, 55114) and determining the concentration for use;

(3) Diluting cfDNA extracted in the step (1) to 3 ng/. Mu.L respectively for later use, wherein primers, probes and a blocker used for detection are shown in a table 15, and reaction solutions are prepared according to the formula of a table 16 respectively;

2. Experimental results

The results of the digital PCR for each experimental group are shown in Table 19. As can be seen from Table 19, in the detection of a plurality of mutant genes in a plurality of samples, only the signal of FAM channel was detected in sample No. 5, wherein the mutation ratio of K-ras G12C was 0.38%, and only the signal of ROX channel was detected in sample No. 6, wherein the mutation ratio of EGFR T790M was 1.09%, and the above detection results were consistent with the actual conditions. The detection system disclosed by the invention has good specificity, and the coincidence rate of the result reaches 100%. The detection system can be used for detecting clinically relevant samples in the future.

TABLE 19 cfDNA detection results of clinical samples

Example 8 multiplex digital PCR detection System for Gene detection in Lung cancer patients

During the treatment of non-small cell lung cancer patients, EGFR/K-RAS/B-raf/PIK3CA gene mutation detection is usually required to be used as a screening reference for drug selection and drug resistance reasons. The multiple digital PCR detection system disclosed by the disclosure can be also used for detecting the mutant gene combination, and screening and determining the mutant gene type and the mutation proportion of the patient with lung cancer. The primer probe combinations and the blocking devices selected in this example are shown in Table 20.

Table 20

1. Experimental procedure

(1) Taking DNA of a Calu-1 cell line as a K-ras G12C gene mutation positive template; extracting DNA of HT-29 cell line as B-raf V600E gene mutation positive template; synthetic plasmid 014 (SEQ ID NO.117, synthesized by Kirschner Biotechnology Co., ltd.) was used as a positive template for the PIK3CA H1047L gene mutation; extracting DNA of a cell line NCI-H1975 as EGFR L858R/T790M gene mutation positive template; extracting DNA of a cell line HCC827 as EGFR 19del gene mutation positive template; DNA of the cell line HEK-293 was extracted as a negative template. Specific information is shown in tables 21 and 22.

Table 21 template information table

Template	Mutation type
		NCI-H1975	EGFR L858R/T790M mutant
Calu-1	K-ras G12C mutant
		HT-29	B-raf V600E mutant
Plasmid 014	PIK3CA H1047L mutant
		HCC827	EGFR 19del mutant forms
HEK-293	Wild type of the above gene

(2) Preparation of a simulation sample: mixing the negative template extracted in the step (1) with the positive template according to mutation frequencies in a table to obtain samples 1-6. Specific information is shown in Table 22.

Table 22 simulation sample

Sample numbering	Mutation type	Mutation frequency
			1	Wild type (HEK-293 gDNA)	0
2	K-ras G12C(Calu-1/HEK-293)	5％
			3	B-raf V600E(HT29/HEK-293)	5％
4	PIK3CA H1047L (plasmid 014/HEK-293)	5％
			5	L858R/T790M(NCI-H1975/HEK-293)	5％
6	19del(HCC827/HEK-293)	5％

(3) Diluting the sample obtained in the step (2) to 3.5 ng/. Mu.L for later use, respectively preparing reaction solutions by using primers, probes and a blocker for detection in tables 23 and 24 according to the formulas of tables 23 and 24, and verifying the detection results of the multiple digital PCR detection system in samples 1-6.

TABLE 23 tube 1 reaction System

TABLE 24 tube 2 reaction system

Reagent(s)	Volume (mu L)	Concentration of
			10X buffer	3.5	1X
PCR polymerase	1	-
			EGFR L858R FP	1.05	300nM
EGFR L858R RP	1.05	300nM
			EGFR L858R blocker	2.1	600nM
EGFR L858R probe	0.7	200nM
			EGFR 19del FP	1.05	300nM
EGFR 19del RP	1.05	300nM
			EGFR 19del blocker	2.1	600nM
EGFR 19del Probe	0.7	200nM
			EGFR T790M FP	1.05	300nM
EGFR T790M RP	1.05	300nM
			EGFR T790M blocker	2.1	600nM
EGFR T790M Probe	0.7	200nM
			EIF2C1 FP	1.05	300nM
EIF2C1 RP	1.05	300nM
			EIF2C1 Probe	0.7	200nM
Enzyme-free water	Complement to	--
			Template	5	15ng DNA

(4) The reaction procedure is shown in Table 6.

2. Experimental results

The results of the digital PCR for each experimental group are shown in table 25 and fig. 19 and 20. As can be seen from Table 25 and FIGS. 19 and 20, the detection results of samples 1 to 6 are consistent with the actual mutation of the samples in the present detection system. The detection system can be used for detecting clinically relevant samples in the future.

Table 25

Example 9 multiplex digital PCR detection System for Gene detection in colorectal cancer patients

Medical guidelines recommend that metastatic or recurrent bowel cancer require detection of RAS (KRAS/NRAS), B-RAF mutations. The multiplex digital PCR detection system disclosed by the disclosure can be also used for detecting the mutant gene combination, and screening and determining the mutant genes and the mutation proportion of colorectal cancer patients. The primer probe combinations and the blocking devices selected in this example are shown in Table 26.

Table 26

1. Experimental procedure

(1) Extracting DNA of a Calu-1 cell line as a K-ras G12C gene mutation positive template; extracting DNA of HT-29 cell line as B-raf V600E gene mutation positive template; synthetic plasmid 028 was used as a positive template for mutation of the N-ras Q61K gene; DNA of the cell line NCI-H1975 was extracted as a negative template. Specific information is shown in Table 27.

Table 27 template information table

	Mutation type
		NCI-H1975	K-ras/B-raf/N-ras wild-type
Calu-1	K-ras G12C mutant
		HT-29	B-raf V600E mutant
Plasmid 028	N-ras Q61K mutant

(2) Preparation of a simulation sample: mixing the negative template extracted in the step (1) with the positive template according to mutation frequencies in a table to obtain samples 1-4; specific information is shown in Table 28.

Table 28 simulation sample

(3) And (3) respectively diluting the sample obtained in the step (2) to 3.5 ng/. Mu.L for later use, wherein primers, probes and a blocker for detection are shown in a table 29, respectively preparing reaction solutions according to the formula of the table 29, and verifying the expression condition of the multiplex digital PCR detection system in samples 1-4.

Table 29 reaction System

Reagent(s)	Volume (mu L)	Concentration of
			10X buffer	3.5	1X
PCR polymerase	1	-
			K-ras FP	1.05	300nM
K-ras RP	1.05	300nM
			K-ras blocker	2.1	600nM
K-ras Probe	0.7	200nM
			B-raf FP	1.05	300nM
B-raf RP	1.05	300nM
			B-raf blocker	2.1	600nM
B-raf Probe	0.7	200nM
			N-ras FP	1.05	300nM
N-ras RP	1.05	300nM
			N-ras blocker	2.1	600nM
N-ras Probe	0.7	200nM
			EIF2C1 FP	1.05	300nM
EIF2C1 RP	1.05	300nM
			EIF2C1 Probe	0.7	200nM
Enzyme-free water	Complement to
			Template	5	15ng DNA

(4) The reaction procedure is shown in Table 6.

2. Experimental results

The results of digital PCR for each experimental group are shown in table 30 and fig. 21. As can be seen from table 30 and fig. 21, the detection results of samples 1, 2 and 3 are in accordance with the actual conditions under the present detection system. The detection system can be used for detecting clinically relevant samples in the future.

Table 30

Detection channel	Detection site	Sample 1	Sample 2	Sample 3	Sample 4
						FAM	K-ras	63.232	0	0	0
VIC	B-raf	0	91.037	0	0
						ROX	N-ras	0	0	52.073	0
CY-5	Internal reference	735.727	632.57	641.789	727.054
						Results	--	K-ras mutant positivity	B-raf mutant positivity	N-ras mutant positivity	K-ras/B-raf/N-ras negative

Example 10 multiplex digital PCR detection System for gene detection in breast cancer patients

Considering that common mutant genes in breast cancer patients comprise ESR1/PIK3CA, the multiple digital PCR detection system disclosed by the disclosure can be also used for detecting the combination of the mutant genes, and screening and determining the mutant genes and the mutation proportion of the mutant genes of the breast cancer patients. The primer probe combinations and the blocking devices selected in this example are shown in Table 31.

Table 31

/>

1. Experimental procedure

(1) Synthetic plasmid 011 (SEQ ID No.116, synthesized by Kirschner Biotechnology Co., ltd.) was used as ESR D538G gene mutation positive template; synthetic plasmid 014 was used as a positive template for PIK3CA H1047L gene mutation; DNA of the cell line NCI-H1975 was extracted as a negative template. Specific information is shown in Table 32.

Table 32 template information table

Template	Mutation type
		NCI-H1975	ESR1/PIK3CA wild type
Plasmid 011	ESR 1D 538G mutant
		Plasmid 014	PIK3CA H1047L mutant

(2) Preparation of a simulation sample: mixing the negative template extracted in the step (1) with the positive template according to mutation frequencies in a table to obtain samples 1-3; specific information is shown in Table 33.

Table 33 simulation sample

Sample numbering	Mutation type	Mutation frequency
			1	ESR 1D 538G (plasmid 011/NCI-H1975)	5％
2	PIK3CA H1047L (plasmid-014/NCI-H1975)	5％
			3	Wild type (NCI-H1975 gDNA)	0

(3) And (3) respectively diluting the sample obtained in the step (2) to 3.5 ng/. Mu.L for later use, wherein primers, probes and a blocker for detection are shown in a table 34, respectively preparing reaction solutions according to the formula of the table 34, and verifying the expression condition of the multiplex digital PCR detection system in samples 1-3.

TABLE 34 reaction system

(4) The reaction procedure is shown in Table 6.

2. Experimental results

The results of digital PCR for each experimental group are shown in Table 35 and FIG. 22. As can be seen from table 35 and fig. 22, the detection results of samples 1, 2 and 3 are in accordance with the actual conditions under the present detection system. The detection system can be used for detecting clinically relevant samples in the future.

Table 35

Detection channel	Detection site	Sample 1	Sample 2	Sample 3
					FAM	ESR1	44.772	0	0
VIC	PIK3CA H1047/E542	0	60.861	0
					CY-5	Internal reference	1532.465	1623.548	1520.079
Results	--	ESR1 mutant	PIK3CA mutant	ESR1/PIK3CA wild type

Given the variability of the combination of mutant genes, the multiplex digital PCR detection system of the present disclosure is ideally suited for detecting arbitrary combinations of the above mutant genes.

The foregoing examples represent only a few embodiments of the present disclosure, which are described in more detail and are not to be construed as limiting the scope of the invention. It should be noted that variations and modifications can be made by those skilled in the art without departing from the spirit of the disclosure, which are within the scope of the disclosure. Accordingly, the scope of protection of the present disclosure should be determined by the following claims.

Claims

1. A multiplex digital PCR detection reagent or detection kit for detecting a genetic mutation comprising a detection primer, a wild-type blocking probe blocker, and a detection probe for a corresponding target, wherein the detection primer for the corresponding target comprises an upstream primer and a downstream primer, and the target is selected from any one of K-ras, B-raf, EGFR, ESR1, PIK3CA, and N-ras, or any combination thereof.

2. The detection reagent or detection kit of claim 1, wherein the detection primer, wild-type blocking probe blocker, and detection probe of the corresponding target are selected from any one of the following groups or any combination thereof:

3. The detection reagent or detection kit of claim 1 or 2, wherein the kit further comprises an internal reference comprising an internal reference detection probe, an internal reference upstream primer, and an internal reference downstream primer;

preferably, the internal reference upstream primer is selected from the nucleotide sequences shown in any one of SEQ ID NOS.33 to 35;

preferably, the internal reference downstream primer is selected from the nucleotide sequences set forth in any one of SEQ ID NOS.36-38;

preferably, the reference detection probe comprises the nucleotide sequence shown in SEQ ID NO. 39.

4. A detection reagent or kit according to any one of claims 1 to 3 wherein the detection probe and/or blocker probe blocker has a modification;

preferably, the modification is selected from one or more of a nucleic acid modification, a peptide nucleic acid modification, a phosphorothioate modification, a ddC, an inverted dT, an MGB, a quencher modification or a fluorophore modification;

more preferably, the modification is one or more of a locked nucleic acid modification, phosphorothioate modification, ddC, inverted dT or MGB modification.

5. The detection reagent or detection kit of any one of claims 1 to 4, wherein the probe is modified at the 5 'end with a fluorescent group and/or modified at the 3' end with a quenching group;

Preferably, the fluorophore is selected from one of the following: FITC, TET, JOE, R110, FAM, CY5, CY5.5, HEX, VIC, ROX or CY3;

preferably, the quenching group is selected from one of the following: TAMRA, BHQ-1, BHQ-2, dabcyl or MGB.

6. A method for multiplex digital PCR detection of gene mutations that can simultaneously detect at least 2 mutation sites in one PCR sample, said mutations being at the same target or at different targets, comprising:

(1) Obtaining DNA from a sample to be tested;

(2) Mixing the DNA obtained in step (1), the detection primer of the corresponding target of any one of claims 1-5, a detection probe, a blocker, and optionally an internal reference;

(3) Droplet generation, PCR amplification and chip reading;

preferably, the DNA is free DNA.

7. The method of claim 6, wherein the sample to be tested is selected from one or more of tumor cells, blood, plasma, pleural effusion, peritoneal effusion, saliva, urine, tissue, or fetal pre-test sample;

preferably, the sample to be tested is a blood sample, a plasma sample, a tissue sample or a cell sample;

Preferably, the blood sample is a peripheral blood sample.

8. The method of claim 5 or 6, wherein the sample is selected from one or more of lung, colorectal or breast cancer samples.

9. Use of a detection reagent or a detection kit according to any one of claims 1 to 5 and/or a method according to any one of claims 6 to 8 for multiplex gene mutation detection.

10. The use of claim 9, wherein the gene mutation detection is a gene detection prior to targeted therapy.