KR102353064B1 - Composition for detecting copy number variation of HER2 and kit comprising the same - Google Patents

Abstract

The present invention relates to a primer and probe set composition for detecting CNV of a HER2 gene and a kit comprising the same. Using the primer and probe set composition for detecting CNV according to the present invention, it is possible to predict the prognosis or risk of mutation in cancer patients expressing HER2, and it is possible to provide information necessary for targeted treatment of cancer. It can be usefully used for the purpose of providing clues for future treatment directions, including cancer, and for monitoring cancer metastasis or recurrence.

Description

Composition for detecting copy number variation of HER2 and kit comprising the same

The present invention relates to a composition for detecting HER2 copy number mutation and a kit comprising the same, and more particularly, to a primer for detecting HER2 copy number mutation, a probe set composition, a kit for detecting HER2 copy number mutation comprising the composition, and the composition It relates to a method of providing information necessary for prognosis evaluation of cancer, prediction of mutation risk, or targeted therapy using

Copy number variation (CNV), which corresponds to structural variation in the individual variation of the human genome, accounts for a major part of polymorphism in the human gene and is predicted to play an important role in genetic susceptibility to common diseases. come. Copy number variation is a promising structural modification beyond Single Nucleotide Polymorphism (SNP) that affects only one base. Copy number variations vary in size from ~1 kilobase to several megabases.

HER2 (Human epidermal growth factor receptor 2) is a 185 kDa cell surface glycoprotein with tyrosine kinase activity, which plays a decisive role in regulating cell growth and differentiation. HER2 is a very important biomarker in breast cancer, and overexpression of HER2 is observed in 20-30% of breast cancer patients, and it is known that breast cancer patients with this overexpression have an increased risk of metastasis and a poor prognosis. However, due to targeted therapy using Herceptin (Trastuzumab), a monoclonal antibody treatment for HER2 protein, which appeared with FDA approval in 1998, it brought about breakthrough success in the treatment of HER2-overexpressing breast cancer patients. In addition to breast cancer, HER2 amplification or overexpression has also been reported in ovarian cancer, prostate cancer, colorectal cancer, pancreatic cancer, lung cancer, and stomach cancer. Overexpression was observed with a frequency of

So far, immunohistochemistry (IHC, Immunohistochemistry) or Fluorescent in situ hybridization (FISH) has been mainly used to test for amplification or overexpression of HER2. However, in the case of fluorescence in situ hybridization, high test cost, time consumption, and expensive fluorescence microscope are required, and high correspondence between FISH and IHC has already been reported in the literature. IHC is the preferred method.

However, the examination using tissue reflects the biomarker status at the time of tissue collection, and since invasive methods (Biopsy, resection, etc.) are used to collect the tissue, there is a possibility of causing a very large risk to the patient. In addition, due to tumor heterogeneity, interpretation of results may be difficult, and it is a very big obstacle in accurate diagnosis for personalized medicine. In addition, it is a very limited method in terms of monitoring the therapeutic effect of anticancer treatment, including targeted therapy.

Currently, tissue-based testing methods such as immunohistochemical staining and fluorescence in situ hybridization are used as biomarker diagnostic methods used to select patient groups for precision medicine. Because it reflects only the state, it is very limited to follow-up the change in mutations due to the effect of the therapeutic agent. In addition, the additional biopsy is accompanied by physical and psychological pain of the patient, and an additional biopsy is not possible in 30-50% of patients with advanced cancer.

Therefore, efforts are being made to isolate biomarkers present in small amounts in blood and other body fluids obtained through a liquid biopsy method and utilize them for cancer diagnosis, prognosis, and monitoring of anticancer drug effects. In particular, biomarker testing using cell free-DNA and CTC in blood is expected to overcome tumor heterogeneity, a limitation of biopsy.

Accordingly, the inventors of the present invention developed a method for detecting HER2 CNV by combining several genes while researching a method for rapidly and quantitatively calculating HER2 CNV with a liquid biopsy-based sample, and overexpressing HER2 By demonstrating that CNV of a gene can be detected quickly, the present invention was completed by developing a kit suitable for this and a method for providing information necessary for prognostic evaluation of cancer, prediction of mutation risk, or targeted treatment using the same.

Accordingly, it is an object of the present invention to provide a standard gene set composition for detecting HER2 gene copy number mutations, characterized in that it consists of RPP30, PPIA, AP3B1 and BTF3P14 genes.

Another object of the present invention is to provide a method for determining whether the HER2 gene copy number mutation.

Another object of the present invention is to provide a primer and probe set composition for detecting HER2 copy number variation (CNV).

Another object of the present invention is to provide a kit for detecting HER2 copy number mutations comprising a primer and a probe set composition for detecting HER2 copy number mutations as active ingredients.

In order to achieve the above object, the present invention provides a standard gene set composition for detecting HER2 gene copy number mutation, characterized in that it consists of RPP30, PPIA, AP3B1 and BTF3P14 genes.

In order to achieve another object of the present invention, the present invention provides a method for determining whether HER2 gene copy number mutation.

In order to achieve another object of the present invention, the present invention provides a primer and probe set composition for detecting HER2 copy number variation (CNV).

In order to achieve another object of the present invention, the present invention provides a kit for detecting HER2 copy number mutations comprising a primer and a probe set composition for detecting HER2 copy number mutations as active ingredients.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The following references provide one skill with general definitions of several terms used herein: Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOTY (2th ed. 1994); THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (Walkered., 1988); and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY.

Hereinafter, the present invention will be described in detail.

The present invention provides a standard gene set composition for detecting HER2 copy number mutations, characterized in that it consists of RPP30, PPIA, AP3B1 and BTF3P14 genes.

In the present invention, “copy number variation (CNV)” refers to a DNA fragment showing a difference in the number of copies found by comparing two or more genomes, and is either newly generated or inherited. About 350,000 CVN loci have been reported in the human genome, and exist in a size of about 40 to 100 kb, and the CNV region occupies about 600 Mb (~2%) in the human genome. These CNVs (insertion, deletion, duplication) affect the phenotype and the development of cancer. In the process of cancer development, mutations in specific genes do not come all at once, but come in several stages. For example, in the stage of colorectal cancer, mutations of several genes occur in normal cells, resulting in mucosal hyperproliferation and polyps (adenoma), and then through mutations in major cancer suppressor genes, colorectal cancer finally develops. Major genes are involved in each cancer type, and if you only know the mutation of these genes, you can know the stage of cancer progression. In addition to this, even in cancers of the same organ, all gene mutations are different (heterogeneity), so the prognosis, treatment, and recurrence of cancer can be applied differently according to these differences.

On the other hand, the determination of whether or not copy number mutation in the present invention is determined by measuring the copy number of a gene to be detected for copy number mutation in a sample (preferably a sample isolated from a human) and a standard gene set in the present invention, and comparing the magnification This can be done by

Therefore, the present invention

(a) determining the copy number of the HER2 gene and the standard gene set consisting of the RPP30, PPIA, AP3B1 and BTF3P14 genes in the sample;

(b) calculating an average value of the copy number of each gene of the standard gene set; and

(c) calculating a value by dividing the copy number of the HER2 gene by the average value calculated in step (b),

It provides a method of determining whether the copy number mutation of the HER2 gene is determined by comparing the value calculated in step (c) with 2 to determine whether the copy number mutation is present.

In the above method, the average value of step (b) is preferably an arithmetic average value, and is an arithmetic average value for all measured values of each gene in a standard gene set, and unmeasured or measurement errors during measurement can be excluded in calculating the average.

Determining whether the HER2 copy number mutation is present can be determined as having a copy number mutation when the calculated value in step (c) is greater than 2, and can be determined as having no copy number mutation if it is 2 or less.

In addition, when the standard gene set includes a gene located in the same chromosome as the HER2 gene, the BTF3P14 gene located in the same chromosome as the HER2 gene to prevent inaccurate discrimination due to polyploid chromosomes (polysomy) and RPP30, PPIA, and AP3B1 genes located in non-identical chromosomes, respectively, and the value obtained by dividing the copy number of the gene to be detected for copy number variation by the copy number of the gene located in the same chromosome is 1.5 to 2.5, and the copy number variation When the value obtained by dividing the copy number of the detection target gene by the number of copies of genes located in unequal chromosomes is greater than 2, it is determined that there is a copy number variation, and when it is 2 or less, it can be determined that there is no copy number variation.

On the other hand, the present invention provides a set of polynucleotides for detecting HER2, including a primer of SEQ ID NO: 2, a primer of SEQ ID NO: 3, and a probe of SEQ ID NO: 1, for detecting a copy number variation of the HER2 gene;

ii) a polynucleotide set consisting of a primer of SEQ ID NO: 5, a primer of SEQ ID NO: 6 and a probe of SEQ ID NO: 4; a polynucleotide set consisting of a primer of SEQ ID NO: 8, a primer of SEQ ID NO: 9 and a probe of SEQ ID NO: 7; a polynucleotide set consisting of a primer of SEQ ID NO: 11, a primer of SEQ ID NO: 12, and a probe of SEQ ID NO: 10; and a polynucleotide set consisting of a primer of SEQ ID NO: 14, a primer of SEQ ID NO: 15, and a probe of SEQ ID NO: 13; It provides a primer and probe set composition for detecting HER2 gene copy number variation (CNV) comprising one or more polynucleotide sets selected from the group consisting of as an active ingredient.

In the present invention, “HER2” is an abbreviation for human epidermal growth factor receptor type2, and is a gene protein having a structure very similar to that of a person involved in cell production. HER2 protein is also present in normal cells slightly and is responsible for the growth regulatory function of cells, but is known to be involved in cell proliferation or malignancy by overexpressing or activating it (The Dictionary of Life Sciences, first edition 2008, Revision 2014, Kang Young-hee).

The composition of the present invention capable of detecting copy number variation (CNV) of the HER2 gene is not limited thereto, but is used to provide information necessary for prognosis evaluation or mutation risk prediction of HER2 expressing cancer can be In addition, the composition of the present invention may be utilized to provide information necessary for targeted treatment of HER2-expressing cancer.

In the copy number detection composition of the present invention, 'cancer' means a cancer in which HER2 is expressed, and gastric cancer, breast cancer, ovarian cancer, adenocarcinoma, endometrial cancer, prostate cancer, colorectal cancer, pancreatic cancer, lung cancer, gastroesophageal cancer , may be at least one selected from the group consisting of bladder cancer, but is not limited thereto.

In the present invention, “primer” refers to an oligonucleotide, and conditions that induce the synthesis of a primer extension product complementary to the nucleic acid chain (template), that is, the presence of nucleotides and a polymerization agent such as DNA polymerase, and a suitable temperature and It can serve as the starting point of synthesis under the conditions of pH. Preferably, the primers are deoxyribonucleotides and are single-stranded. The primer used in the present invention may include naturally occurring dNMP (ie, dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. In addition, the primer may also include ribonucleotides.

The primer should be long enough to prime the synthesis of extension products in the presence of a polymerizer. A suitable length of a primer depends on a number of factors, such as temperature, application, and source of the primer, but is typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form sufficiently stable hybrid complexes with the template. The term “annealing” or “priming” refers to the apposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, wherein the apposition is a polymerase polymerizing the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof. make it

In the present invention, “probe” is designed as a kind of taqman probe used for quantitative PCR. Preferably, a fluorescent material (HEX, VIC, FAM dye) is attached to the probe, and BHQ1 may be used as a quencher on the 3' side of all probes. TaqMan probes are generally oligonucleotides tagged with a fluorescent material at the 5' end and a quencher at the 3' end. TaqMan probes specifically hybridize to template DNA in the annealing step, but because there is a quencher at the 3' end of the probe. Although it does not emit fluorescence even when light is given, when the TaqMan probe hybridized to the template is decomposed by the 5' → 3' exonuclease activity of Taq DNA polymerase in the extension step, the fluorescent material is separated from the probe and suppressed by quencher According to the principle of releasing and emitting fluorescence, fluorescence according to PCR reaction is emitted quantitatively.

In the present invention, the probe is characterized in that it is combined with a fluorescent material, and more preferably, HEX (hexachlorofluorescein), FAM (fluorescein amidite), and EverGreen fluorescent dye are combined.

Specifically, since a form in which FAM, HEX fluorescent dye (fluorescent material) or EvaGreen fluorescent dye is bound to the probe is used, it can be performed by measuring the fluorescence of these. Such a process can be performed by a commercially available detection device (eg, droplet reader from biorad), and automatically detects the droplet fluorescence signal of each sample in the device and counts the number of positive and negative droplets. analysis can be completed.

At this time, the probe added to the PCR reaction solution and the probe added to the standard PCR reaction solution for detection may be bound to different fluorescent substances, respectively.

The present invention provides a kit for detecting HER2 gene copy number variation (CNV) comprising the primer and probe set of the present invention.

The present invention provides: i) a polynucleotide set for detecting HER2 consisting of a primer of SEQ ID NO: 2, a primer of SEQ ID NO: 3, and a probe of SEQ ID NO: 1;

ii) a polynucleotide set consisting of a primer of SEQ ID NO: 5, a primer of SEQ ID NO: 6 and a probe of SEQ ID NO: 4; a polynucleotide set consisting of a primer of SEQ ID NO: 8, a primer of SEQ ID NO: 9 and a probe of SEQ ID NO: 7; a polynucleotide set consisting of a primer of SEQ ID NO: 11, a primer of SEQ ID NO: 12, and a probe of SEQ ID NO: 10; and a polynucleotide set consisting of a primer of SEQ ID NO: 14, a primer of SEQ ID NO: 15, and a probe of SEQ ID NO: 13; It provides a kit for detecting HER2 gene copy number variation (CNV) comprising at least one set of polynucleotides selected from the group consisting of as an active ingredient.

The kit of the present invention can be preferably used for CNV detection of the HER2 gene by a PCR reaction using the primer/probe set of the present invention. The kit of the present invention may further include tools and/or reagents known in the art for use in PCR or detection thereof. The kit of the present invention may further include, if necessary, a tube to be used for mixing each component, a well plate, instructions for use, and the like.

In addition, the kit of the present invention may be a research use only (RUO) or IVD (in vitro diagnostics) kit. IVD kits also include IVD-CDx (in vitro companion diagnostics) kits.

The kit of the present invention is used for qPCR (quantitative PCR) or droplet digital PCR method.

The template applicable to the kit of the present invention requires detection of CNV of the HER2 gene and can be used without limitation as long as PCR reaction is possible. Preferably, cell-free DNA (cfDNA) isolated from blood, circulating tumor ctDNA (circulating tumor DNA) derived from a circulating tumor cell (CTC) or DNA isolated from formalin fixed paraffin embedded (FFPE) tissue or cDNA synthesized by a reverse transcription reaction from RNA derived from the tissue ( It is characterized by using complementary DNA) as a template.

Circulating cfDNA in human plasma has been studied in a variety of physiological and pathological conditions, including inflammatory disorders, oxidative stress, and malignancies. Although the exact mechanism involved in the release of cfDNA into the bloodstream is uncertain, it appears that apoptosis, apoptosis, and active release from the cell appear to act as a whole. cfDNA circulating through blood vessels is a potentially useful biomarker. DNA levels and fragmentation patterns offer interesting possibilities for diagnostic and prognostic purposes. In particular, in that it can be easily detected in the blood of a patient, there is a usefulness in that a biomarker can be detected simply and quickly without significantly impairing the quality of life.

In addition, the kit of the present invention may use as a template DNA isolated from circulating tumor cells (CTCs) isolated from blood or cDNA synthesized from RNA-derived CTCs by reverse transcription. CTCs are tumor cells found in the peripheral blood of malignant tumor patients. Because CTCs play an important role in cancer metastasis, CTCs are considered very important in cancer research and diagnosis. However, the number of circulating tumor cells in the peripheral blood is very rare. There is a need for a detection system that requires a degree of sensitivity to detect tumor cells.

After the biopsy, the tissue obtained from the patient is usually fixed with formalin (formaldehyde) or the like. The immobilized biological sample is generally dehydrated and embedded in a solid support such as paraffin, and the prepared sample is called a FFPE sample. Nucleic acids, particularly DNA, on FFPE samples exist in fixed cells and are fragmented or cross-linked by formalin, so it is necessary to remove paraffin and lyse the fixed cells to elute nucleic acids including DNA from within the cells.

In the present invention, the term “paraffin” refers to the embedding medium of a biological sample used in all analysis including morphological, immunohistochemical and enzymatic histochemical analysis. That is, the paraffin in the present invention may be a single petroleum paraffin wax, and all other substances that can be added for the purpose of improving the quality of the embedding medium using the petroleum paraffin wax as a base material. A component may be included. Here, the petroleum paraffin wax refers to a mixture of hydrocarbons that are solid at room temperature derived from petroleum.

In general, the FFPE-treated cancer patient specimen is cut to a thickness of 5 to 10 μm with a rotary microtome, and then the nucleic acid containing DNA is isolated using a commercially available nucleic acid isolation kit for FFPE or a device utilizing the same. can Kits/devices for isolating nucleic acids from FFPE include, for example, Siemens' Tissue Preparation System and related reagents (VERSANT tissue preparation reagents).

The nucleic acid isolated from the sample of the present invention is preferably genomic DNA, more preferably genomic DNA presumed to have CNV.

The composition or kit of the present invention can be preferably used for CNV detection of the HER2 gene by an automated or semi-automated method. In the above automation, the input of the sample (sample); repositioning or moving of a substrate (eg, tube, plate) on which extraction, separation, and reaction have been completed; Addition of reagents, buffers to stock, replenishment; It means that all or most of the process except for the maintenance of equipment is done by means other than humans (eg, robots).

For reference, for the above-mentioned nucleotide work, reference may be made to the following documents (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982); Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press (1989);Deutscher, M., Guide to Protein Purification Methods Enzymology, vol. 182. Academic Press. Inc., San Diego, CA (1990); Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997); Rupp and Locker, Lab Invest. 56: A67 (1987); De Andres et al., BioTechniques 18: 42044 (1995); Held et al ., Genome Research 6:986-994 (1996); TE Godfrey et al. J. Molec. Diagnostics 2: 84-91 (2000); K. Specht et al., Am. J. Pathol. 158: 419-29 (2001)).

The 'sample' of the present invention includes blood and other liquid samples of biological origin, biopsy samples, solid tissue samples such as tissue culture, or cells derived therefrom. More specifically, for example, but not limited thereto, tissue, extract, cell lysate, whole blood, plasma, serum, saliva, ocular fluid, cerebrospinal fluid, sweat, urine, milk, ascites fluid, synovial fluid, peritoneal fluid, etc. may be. The sample may be obtained from an animal, preferably a mammal, and most preferably from a human. In addition, the sample may be pretreated prior to use for detection. For example, it may include filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, and the like. Preferably, it may be a circulating tumor cell (CTC), blood, formalin fixed paraffin embedded (FFPE), cell-free DNA (cfDNA), fresh sample, etc. obtained from a patient, most preferably obtained from a patient It may be blood or formalin fixed paraffin embedded (FFPE), and as described above, genomic DNA or DNA estimated to contain CNV may be isolated from the sample and used for CNV detection of the HER2 gene.

As described above, the detection method of the present invention can detect the CNV of the HER2 gene by qPCR (quantitative PCR) or digital PCR method.

Accordingly, the present invention provides a primer and probe set composition for detecting CNV of the HER2 gene and a kit comprising the same. The method of the present invention can predict the prognosis or risk of mutation in HER2-expressing cancer patients, and can provide information necessary for targeted treatment of cancer. It can be usefully used for presenting purposes and monitoring for metastasis or recurrence of cancer.

1 shows a primer and probe selection experiment for detecting CNV of the HER2 gene.
2 and 3 show the expected CNV detection results in the HER2 amplification cell line.
4 shows the results of the interference reaction experiment and CNV values.
5 shows the results of measuring the LOB value by confirming the CNV value after repeating the interference reaction between the standard material and the human gDNA sample.
6 shows the results of LOB values according to 20 FFPE samples.
7 is a result of repeating the LOD experiment to determine the minimum concentration detected by serially diluting human gDNA and the amount of input DNA of a standard material.
8 is a result of repeating the LOD experiment to determine the minimum concentration detected by serially diluting the amount of human gDNA in the SKBR3 cell line with HER2 amplification.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and thus the content of the present invention is not limited thereto.

Example 1: Selection of primers and probes for HER2 CNV detection

A 300bp gene including mutations was synthesized in the pUC57-Amp vector, and a total 3kb clone was prepared. After transformation and culture, maxi-prep was performed, and the entire sequence was confirmed through M13F and M13R primers. The purified DNA was digested using Hind Ⅲ restriction enzyme, and linearized DNA was confirmed as a result of electrophoresis. Two forward primers and three reverse primers were designed, and a selection experiment was carried out using a total of four pairs of primers and one probe as shown in [Fig. 1].

Example 2: Reference gene verification for HER2 CNV detection

For a total of four reference genes established for CNV detection of the HER2 gene, an investigation of integrity (integrity, integrity, and suitability as an actual reference) was performed using the TCGA (The Cancer Genome Atlas) database. At this time, RNase P (Ribonuclease P) and LINE-1 (Long Interspersed Element-1) were excluded from the analysis because they were not in the TCGA database.

In more detail, the presence of deep deletion, truncating mutation, and missense mutation was analyzed.

As a result of the analysis, except for TERT (telomerase reverse transcriptase) and GUSB (canine beta-glucuronidase gene), it was confirmed that the remaining genes were stably expressed in 11 representative carcinomas. Information on the reference gene selected based on this is as follows.

Reference gene 1 is a reference gene selected by extracting from known document 1 (Cancer Sci 105 (2014) 1032-1039), and is described in the Internal amplification control (IAC) list like Reference gene2. It is also located on chromosome 10 and has 7,243 mutations (based on ENST00000371703.7). Among the total 7,243 mutations, there was no pathogenic mutation, so it was selected as a reference gene.

Reference gene 2 is one of the house keeping gene candidate groups in the known document 2 (BMC Molecular Biology. 2009), which is selected by selecting one located in the same chromosomal location as c-MET, and is known as a general gene used for standardization. It is also located on chromosome 7 and has 14,775 mutations (based on ENST00000310581.9). Of the total 14,775 mutations, 47 pathogenic mutations exist, but these mutations have extremely rare frequencies (<0.0001), so they were selected as reference genes.

Reference gene 3 is a selected reference gene extracted from known document 3 (PLOS ONE | DOI:10.1371 / journal. pone.0146784 January 14, 2016) and is described as a gene used for copy number variation. It is also known as a reference gene suitable for the experimental technique for the kit. It is also located on chromosome 5 and has 67,275 mutations (based on ENST00000255194.10). Of the total 67,275 mutations, 12 pathogenic mutations exist, but these mutations have extremely rare frequencies (<0.0001), so they were selected as reference genes.

Regarding the criteria for judging the pathogenic mutation of the reference gene to be used in this study, the clinical information (Clin. Sig.) of each gene provided by Ensembl (http://ensembl.org) is “pathogenic”, “likely pathogenic”, A case that corresponds to “likely benign~pathogenic” and the corresponding mutation has a frequency (gmaf_freq) of 0.01 or higher was determined as a pathogenic mutation.

In addition, for the detection of HER2 CNV, one additional reference gene (BTF3P14) was investigated for integrity (integrity, suitability as an actual reference) using the TCGA database.

Example 3: Confirmation of a panel for detection of HER2 CNV

A stable panel capable of detecting HER2 CNV was completed through a reference gene mixing experiment and interference reaction (Table 1, panel named MMX). Four reference genes were selected and the target HER2 was determined to be exon24. In this case, the probes and primers in Table 2 below were used for CNV detection.

MMX Detection Channel One HER2 Target (ch.17) FAM Reference 1 HEX 2 Reference 2 FAM Reference 3 HEX 3 Reference 4 FAM

MMX Gene Name Sequence SEQ ID NO: One ERBB2 ERBB2 WTP1 CCAAAGCCAACAAAGAAATCT One ERBB2 F1 GGGGAGAATGTGAAAATTCCA 2 ERBB2 WR1 AGAGGGTGGAGGGGCTTA 3 RPP30 RPP30-1 P1 GGAATTGTCAAACTGACTCCTTTTCC 4 RPP30-1 F1 ATTTTAGGATGTTTTTCGCATCTG 5 RPP30-1 R1 TGGCAGAATTTGTTCCTATGC 6 2 PPIA PPIA P2 TTGGATGGCAAGCATGTGGT 7 PPIA F3 GTTGCCAGTCATAGTGATTGTTC 8 PPIA R3 GGCCTCCACAATATTCATGC 9 AP3B1
(type 2) AP3B1 P4 CAGCAGTGAGGACTCCTCCA 10 AP3B1 F4 AAGTGGAGAACAAGGCGAAA 11 AP3B1 R4 CCGTCCACTCTCACTGTCCT 12 3 BTF3P14 BT P1 GACACAGCAGCTGATGGAAA 13 BT F1 CAGTGATCCGCTTTAACAATCCT 14 BT R1 GTCTGCATCTCACCGGCTTAA 15

CNV normalization was calculated based on the average copy number of four reference genes (Equation 1). At this time, it was decided that CNV was present when CNV was 2 or more.

Through the CNV calculation value through the copy average value of a number of verified reference genes, it is possible to calculate a CNV value with better reliability than the reliability of the CNV calculation value calculated for one basic gene. In addition, it was determined that the reliability of known reference genes could be minimized due to the combination of reference genes with different chromosomal locations.

[Equation 1]

Judgment method using reference gene

인 경우, HER2에 CNV가 있다고 판단.

, it is judged that there is CNV in HER2.

In addition, an additional calculation method was introduced to confirm the polysomy of HER2 (Equation 2). When the CNV is calculated based on the reference gene located on the same chromosome, if the CNV value is close to 2 and the CNV value of the other three reference genes is 2 or more (expected CNV > 4), polysomy is said to be present. judged.

[Equation 2]

Determination method using reference gene when confirming polysomy

In this case, it is judged that there is polysomy.

It was confirmed that a positive value was obtained as a result of an experiment using a panel confirmed in the SKBR3 cell line (DNA), which is known to have HER2 amplification.

Example 4: confirmed Verification of the panel

Pre-analysis verification was performed for each confirmed MMX panel, and the presence or absence of an interference reaction was first checked through cross-reaction. Specimens were identified as standard materials.

Interference reaction test results and CNV values are shown in FIG. 4 .

In addition, as a result of repeated experiments 7 or more times with a standard material and a known human gDNA sample, it was confirmed that a stable LOB (lateral organ boundary) value was detected with a CNV value of 2 fold as shown in FIG. 5 .

In addition, as shown in [Fig. 6], it was confirmed that the CNV value was 2> through the normal FFPE Sample (N=20), and the LOB value was detected.

In addition, a limit of detection (LOD) experiment was performed to determine the minimum concentration detected by serially diluting the amount of human gDNA input DNA.

The CNV value was detected by averaging the number of copies derived through three repeated experiments, and the CNV value was set to 2, and the results are shown in [Fig. 7].

As a result of detecting the CNV values for the four reference genes, it was confirmed that the minimum concentration (LOD) stably detected was 0.1 ng/well.

In addition, an LOD experiment was conducted to determine the minimum concentration detected by serially diluting the amount of gDNA in the SKBR3 cell line with HER2 amplification. The CNV value was detected by averaging the number of copies through three repeated experiments, and the results are shown in [Fig. 8].

The CNV value was detected by averaging the number of copies derived through repeated experiments 3 times, and when the CNV value for 4 reference genes was 0.1ng/well, CNV calculation is possible, but the number of copies of the reference gene is It showed a more shaky value than when only human gDNA was added, and the stable minimum detection concentration (LOD) was found to be 0.2ng/well.

Example 5: Evaluation of clinical applicability

To evaluate the applicability of clinical samples, it was confirmed whether the HER2 gene CNV detection kit according to the present invention could detect actual CNV even at a size of 200 bp. Through this, it was indirectly confirmed whether CNV could be detected in cfDNA in blood.

SKBR3 (ERBB2, CNV breast cancer cell line gDNA) was fragmented to a cfDNA size of 200 bp and used for ddPCR. For dilution, MCF7 (breast cancer cell line gDNA without CNV, CNV=1) and promega WT gDNA (CNV=2) were used, and the results are shown in [Table 3] and [Table 4].

dilution vol SKBR3 MCF7 Expected CNV One 0 23.38 S1 One 0.1 20.23 S2 One One 10.07 S3 One 1.55 7.99 S4 One 2.55 5.98 S5 One 5 3.99

dilution vol SKBR3 gDNA prediction CNV One 0 23.38 S1 One 0.1 19.55 S2 One 0.9 9.88 S3 One 1.4 7.98 S4 One 2.45 6.00 S5 One 5.5 4.04

Similarly, HER2 CNV was successfully observed in DNA fragmented to cfDNA size. This means that the data proves that HER2 CNV can be observed in cfDNA of blood later.

In addition, it was confirmed to what ratio CNV was detected when human gDNA was mixed with a cell line known to have CNV (SKBR3, Breast cancer cell line). DNA was extracted from a cell line known to have CNV, the concentration was fixed, and diluted with a CNV-free standard material and cell line gDNA.

As a result, it was confirmed that the degree of CNV (CNV>4) was detected up to 20-25% when an amount of 3.3ng input DNA was added.

As described above, the composition and kit for detecting HER2 gene CNV according to the present invention can not only detect CNV of the HER2 gene, but also predict the prognosis or risk of mutation in cancer patients through this, and information necessary for targeted treatment of cancer This can be usefully used for the purpose of providing clues for the direction of future treatment, including determining the need for anticancer drug administration, and for monitoring cancer metastasis or recurrence.

<110> Logone Bio Convergence Research Foundation <120> Composition for detecting copy number variation of HER2 and kit comprising the same <130> NP20-0021 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ERBB2 WTP1 <400> 1 ccaaagccaa caaagaaatc t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ERBB2 F1 <400> 2 ggggagaatg tgaaaattcc a 21 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ERBB2 WR1 <400> 3 agagggtgga ggggctta 18 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> RPP30-1 P1 <400> 4 ggaattgtca aactgactcc ttttcc 26 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RPP30-1 F1 <400> 5 attttaggat gtttttcgca tctg 24 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RPP30-1 R1 <400> 6 tggcagaatt tgttcctatg c 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPIA P2 <400> 7 ttggatggca agcatgtggt 20 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PPIA F3 <400> 8 gttgccagtc atagtgattg ttc 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPIA R3 <400> 9 ggcctccaca atattcatgc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AP3B1 P4 <400> 10 cagcagtgag gactcctcca 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AP3B1 F4 <400> 11 aagtggagaa caaggcgaaa 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AP3B1 R4 <400> 12 ccgtccactc tcactgtcct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BT P1 <400> 13 gacacagcag ctgatggaaa 20 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BT F1 <400> 14 cagtgatccg ctttaacaat cct 23 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BT R1 <400> 15 gtctgcatct caccggctta a 21

Claims (18)

A standard gene set composition for detecting HER2 copy number mutations, characterized in that it consists of RPP30, PPIA, AP3B1 and BTF3P14 genes.
(a) measuring the copy number of the HER2 gene and the standard gene set consisting of the RPP30, PPIA, AP3B1 and BTF3P14 genes in the sample;
(b) calculating an average value of the copy number of each gene of the standard gene set; and
(c) calculating a value by dividing the copy number of the HER2 gene by the average value calculated in step (b),
A method for determining whether the copy number of the HER2 gene is mutated, wherein the value calculated in step (c) is compared with 2 to determine whether the copy number is mutated.
The method according to claim 2, wherein the average value of step (b) is an arithmetic average value.
The method according to claim 2, wherein determining whether the copy number variation exists is to determine that there is a copy number variation when the calculated value in step (c) is greater than 2, and when it is 2 or less, it is determined that there is no copy number variation. How to characterize.
The method according to claim 2, wherein the standard gene set comprises a BTF3P14 gene located in the same chromosome as the HER2 gene and RPP30, PPIA, and AP3B1 genes located in a non-identical chromosome, respectively,
The value obtained by dividing the copy number of the HER2 gene by the number of copies of the gene located in the same chromosome is 1.5 to 2.5, and the value obtained by dividing the copy number of the HER2 gene by the number of copies of the gene located in the non-identical chromosome is greater than 2 A method characterized in that it is determined that there is a number variation, and if it is 2 or less, it is determined that there is no copy number variation.
i) a polynucleotide set for detecting HER2 consisting of a primer of SEQ ID NO: 2, a primer of SEQ ID NO: 3, and a probe of SEQ ID NO: 1; and
ii) a polynucleotide set consisting of a primer of SEQ ID NO: 5, a primer of SEQ ID NO: 6 and a probe of SEQ ID NO: 4; a polynucleotide set consisting of a primer of SEQ ID NO: 8, a primer of SEQ ID NO: 9, and a probe of SEQ ID NO: 7; a polynucleotide set consisting of a primer of SEQ ID NO: 11, a primer of SEQ ID NO: 12, and a probe of SEQ ID NO: 10; and a polynucleotide set consisting of a primer of SEQ ID NO: 14, a primer of SEQ ID NO: 15, and a probe of SEQ ID NO: 13; a primer and probe set composition for detecting HER2 gene copy number variation (CNV) comprising as an active ingredient.
The primer and probe set composition according to claim 6, wherein the detection of the HER2 gene copy number variation (CNV) is for prognostic evaluation of cancer or predicting the risk of mutation.
The primer and probe set composition according to claim 6, wherein the detection of the HER2 gene copy number variation (CNV) is for providing information necessary for targeted treatment of cancer.
The method of claim 7 or 8, wherein the cancer is at least one selected from the group consisting of gastric cancer, breast cancer, ovarian cancer, adenocarcinoma, endometrial cancer, prostate cancer, colorectal cancer, pancreatic cancer, lung cancer, gastroesophageal cancer, and bladder cancer. A primer and probe set composition comprising
The primer and probe set composition according to claim 6, wherein the probe is bound to a fluorescent material.
The primer and probe set composition according to claim 10, wherein the fluorescent material is at least one selected from the group consisting of VIC, HEX, FAM, and EverGreen dye.
A kit for detecting HER2 gene copy number variation (CNV) comprising the primer and probe set composition according to claim 6 as an active ingredient.
The kit according to claim 12, wherein the kit is a research use only (RUO) or in vitro diagnostic (IVD) kit.
i) a polynucleotide set for detecting HER2 consisting of a primer of SEQ ID NO: 2, a primer of SEQ ID NO: 3, and a probe of SEQ ID NO: 1; and
ii) a polynucleotide set consisting of a primer of SEQ ID NO: 5, a primer of SEQ ID NO: 6 and a probe of SEQ ID NO: 4; a polynucleotide set consisting of a primer of SEQ ID NO: 8, a primer of SEQ ID NO: 9, and a probe of SEQ ID NO: 7; a polynucleotide set consisting of a primer of SEQ ID NO: 11, a primer of SEQ ID NO: 12, and a probe of SEQ ID NO: 10; and a polynucleotide set consisting of a primer of SEQ ID NO: 14, a primer of SEQ ID NO: 15, and a probe of SEQ ID NO: 13; a kit for detecting HER2 gene copy number variation (CNV) comprising as an active ingredient.
The kit according to claim 14, wherein the kit is used in qPCR (quantitative PCR) or digital PCR method.
The kit according to claim 14, wherein the kit uses cfDNA (cell-free DNA) isolated from blood as a template.
The kit according to claim 14, wherein the kit uses, as a template, DNA isolated from formalin fixed paraffin embedded (FFPE) tissue or cDNA (complementary DNA) synthesized by reverse transcription from RNA derived from the tissue.
The kit according to claim 14, wherein the kit uses DNA isolated from circulating tumor cells (CTC) isolated from blood or cDNA (complementary DNA) synthesized by reverse transcription from the CTC-derived RNA as a template. .

Images