KR20190038464A - The composition for detecting mutations of RAS/BRAF and the kit consisting of the compounds - Google Patents

Abstract

The present invention relates to a composition for detecting RAS/BRAF mutations and a kit comprising the same and, more specifically, to a primer and probe set composition for detecting RAS/BRAF mutations and a kit for detecting RAS/BRAF mutations comprising the composition. A method according to the present invention enables prediction of the metastasis or recurrence of cancer, as well as prediction and diagnosis of responsiveness to a therapeutic agent according to prognosis of a cancer patient, and thus can be usefully employed for the purpose of providing clues to the future course of treatment, including determination of the need for administering an anticancer therapeutic agent, and in monitoring for metastasis or recurrence of cancer.

Description

The present invention relates to a composition for detecting RAS / BRAF mutation and a kit comprising the same,

The present invention relates to a composition for detecting RAS / BRAF mutation and a kit comprising the same, and more particularly, to a primer and probe set composition for detecting RAS / BRAF mutation and a kit for detecting RAS / BRAF mutation comprising the composition .

Cancer refers to a group of abnormal cells caused by continuous division and proliferation by destroying the balance between cell division and death by various causes, and is also called a tumor or neoplasm. It generally develops in more than 100 parts of the body, including organs, white blood cells, bones, lymph nodes, etc., and develops into serious symptoms through the phenomenon of invasion into surrounding tissues and metastasis to other organs.

Cancer therapy is being developed continuously, and dozens of therapies for various cancers currently used in clinical trials are available. However, until now, clinicians are suffering from two difficulties. First, it takes several weeks for the therapeutic effect to take effect. In other words, the therapeutic effects of anticancer drugs can not be judged within a few days, but they gradually appear over several weeks, so it takes a long time to judge the prescription drug to be ineffective. If the treatment is not effective enough, the patient will be considered for other types of treatment. If the clinician can not select the appropriate treatment for the patient at the time of initiation of treatment, the time will be delayed And the prognosis of the disease.

The second difficulty is that there are a number of patients who do not respond to the treatment. For example, cetuximab, a treatment for colorectal cancer, is known to have no therapeutic effect in patients with the KRAS mutation gene. Based on these studies, patients with rectal / colorectal cancer can avoid unnecessary treatment regimens through accurate molecular diagnostic tests that identify mutations that are not responsive to therapeutic drugs before they are prescribed.

Therefore, if the therapeutic response to the therapeutic agent and its side effects can be predicted in advance, it will be possible to lower the dropout rate of the drug and improve the compliance of the drug due to the wrong selection of the drug. It will also avoid the time it takes for the drug to take effect and the risk of side effects that the patient may experience.

The RAS gene is a gene identified as a viral cancer gene (v-RAS) of rodent retrovirus. Three types of c-H-RAS1, c-K-RAS2 and N-RAS form the corresponding mammalian cell gene. On the human chromosome, it encodes a 21 kDa protein (p21), which contains 189 amino acids, which is located at 11p11.5, 12p12.1 and 1p13 and consists of four coding exons and binds guanine nucleotide and localizes in the cell membrane. There are four types of K-RAS gene: K-RAS 4A, K-RAS 4B, H-RAS and N-RAS.

Mutations in the RAS gene occur intensively at codons 12, 13, and 61, and when mutations occur, they become resistant to GAP-mediated GTP hydrolysis and remain activated. The mutation of K-RAS occurs in about 90% of pancreatic cancer, about 50% of colon cancer, about 30% of non-small cell lung cancers, and the N-RAS mutation is about 4% (Samowitz WS et al., Cancer Epidemiol. Biomarkers Prev. 9: 1193-7, 2000). Mutations in the K-RAS and N-RAS genes are known to be highly correlated with short survival due to the lack of responsiveness to the anti-EGFR therapies cetuximab and panithuimuth treatment. Thus, it can be predicted that the presence of a mutation of the K-RAS or N-RAS gene will inhibit the drug's efficacy against cetuximab or panitumum.

In addition, the BRAF gene is a subtype of RAF (Raf Kinase) gene which is involved in cell division and differentiation, and RAF is one of mitogen-activated protein kinase mediating intracellular signal transduction, and A-RAF, B- RAF, and C-RAF. Among these, the V600E mutation of B-RAF and C-RAF is known to be closely related to various types of cancer such as melanoma, colon cancer, and appendicitis.

Thus, RAS or BRAF mutations in colorectal cancer patients have low reactivity to anti-EGFR therapies. Therefore, an effective and rapid detection method of RAS or BRAF gene mutation is required to find an optimal therapeutic approach.

Accordingly, the present inventors completed the present invention by developing a kit suitable for detecting a RAS / BRAF mutation and selecting a primer / probe set capable of selecting a drug treatment strategy for cancer patients related to RAS / BRAF mutation.

It is therefore an object of the present invention to provide a primer and probe set composition for RAS / BRAF mutation detection.

It is another object of the present invention to provide a kit for RAS / BRAF mutation detection comprising a primer and a probe set composition for RAS / BRAF mutation detection.

In order to achieve the above object, the present invention provides a primer and a probe set composition for RAS / BRAF mutation detection.

According to another aspect of the present invention, there is provided a kit for detecting RAS / BRAF mutation comprising a primer and a probe set composition for detecting RAS / BRAF mutation.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The following references provide one of the skills with a general definition of the terms used in the specification of the present invention: Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY (2nd ed. 1994); THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (Walkered., 1988); And Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY.

Hereinafter, the present invention will be described in detail.

I) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2 and the probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24; Ii) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27; And iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; And a set of primers and probe sets for RAS / BRAF mutation detection.

Said composition comprising: i) a polynucleotide set of a forward primer of SEQ ID NO: 7, a reverse primer of SEQ ID NO: 8 and a probe selected from the group consisting of SEQ ID NO: 34 to SEQ ID NO: 36; And ii) a forward primer of SEQ ID NO: 9, a reverse primer of SEQ ID NO: 10, a forward primer of SEQ ID NO: 11, an inverted primer of SEQ ID NO: 12 and a polynucleotide set of the probes selected from the group consisting of SEQ ID NO: 37 to SEQ ID NO: ; ≪ / RTI >

The composition may further comprise a polynucleotide set of a forward primer of SEQ ID NO: 13, an inverted primer of SEQ ID NO: 14, a forward primer of SEQ ID NO: 15, an inverted primer of SEQ ID NO: 16 and a probe selected from the group consisting of SEQ ID NO: As an active ingredient.

The compositions of the invention may preferably be for predicting the responsiveness of the treatment to RAS or BRAF drugs. RAS or BRAF is an EGFR downstream effector and is the primary resistance marker for the therapeutic effect of anti-EGFR mAb. RAS or BRAF have a significant impact on the optimization of treatment for patients with metastatic colorectal cancer (CRC). About 50 to 60 percent of colorectal cancers develop mutations in the RAS or BRAF gene and these patients do not benefit from anti-EGFR therapy. All CRC patients who are considered to be using anti-EGFR therapy in current clinical practice should be tested for RAS and BRAF mutation detection, and if RAS or BRAF mutation is detected, the patient should be treated with cetuximab or panitumumab .

The anti-EGFR therapies may preferably be cetuximab or panitumum, Vemurafenib or Dabrafenib, but are not limited thereto.

In the present invention, " therapeutic reactivity " can be defined as ' reactivity ' to a therapeutic agent if the growth rate of the cancer is inhibited as a result of contact with the therapeutic agent as compared to growth in the absence of contact with the therapeutic agent. Can be defined as " non-responsive " for a therapeutic agent unless the growth rate of the cancer is suppressed or suppressed to a very low extent as a result of contact with the therapeutic agent as compared to growth in the absence of contact with the therapeutic agent. The growth of cancer can be measured in a variety of ways, including by measuring the size of the tumor or the expression of tumor markers that are appropriate for the tumor type. In addition, the above " reactivity " may indicate an increase in survival time on a significant survival curve, and the " non-responsiveness " may be assessed using additional criteria beyond the size of the tumor, including quality of life, .

The cancer of the present invention may be, but not limited to, pancreatic cancer, head and neck cancer, colon cancer, non-small cell lung cancer, and the like.

In the present invention, the term " primer " means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis under pH conditions. Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

The primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerizing agent. The suitable length of the primer is determined by a number of factors, such as the temperature, the application, and the source of the primer, but is typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form a sufficiently stable hybrid complex with the template. The term " annealing " or " priming " means that the oligodeoxynucleotide or nucleic acid is apposited to the template nucleic acid, which polymerizes the nucleotide to form a complementary nucleic acid molecule to the template nucleic acid or a portion thereof .

In the present invention, " probe " is designed as a kind of taqman probe used for quantitative PCR. Preferably, a fluorescent material (HEX, VIC, FAM dye) is attached to the probe, and BHQ1 can be used as a quencher on the 3 'side of all the probes. The TaqMan probe is an oligonucleotide tagged with the 5 'end as a fluorescent substance and the 3' end as a quencher. The TaqMan probe specifically hybridizes to the template DNA in the annealing step, but there is a quencher at the 3 'end of the probe However, if the TaqMan probe hybridizes to the template due to the 5 '→ 3' exonuclease activity of the Taq DNA polymerase in the next step of extension, the fluorescent material is separated from the probe and is inhibited by the quencher And fluorescence is emitted quantitatively by the principle of the fluorescence emitted by the PCR reaction.

The probe of the present invention is characterized in that the probe is bound to a fluorescent material, and more preferably HEX (hexachlorofluorescein), FAM (fluorescein amidite) and EverGreen fluorescent dye are combined.

Specifically, since the probe is combined with FAM, HEX fluorescent dye (fluorescent substance) or EvaGreen fluorescent dye, it can be performed by measuring fluorescence thereon. This process can be performed by a commercially available detector (for example, Droplet Reader from biorad), which detects the droplet fluorescence signal of each sample in the apparatus, counts the number of positive and negative droplets, and automatically Analysis can be completed.

In this case, probes to be added to the PCR reaction solution and probes to be added to the standard PCR reaction solution for detection may be respectively associated with different fluorescent materials.

The present invention provides a kit for detecting RAS / BRAF gene mutation comprising a primer and a probe set of the present invention.

The kit of the present invention is characterized by further comprising an oligomer (blocker) designed to non-specifically bind the mutation detection probe using a sequence corresponding to the mutation position in order to reduce background noise.

The kit of the present invention can preferably be used for the detection of mutations of RAS / BRAF by PCR reaction using the primer / probe set of the present invention. The kit of the present invention may further comprise tools and / or reagents known in the art used for PCR or detection thereof. The kit of the present invention may further comprise a tube, a well plate, an instructional material describing a method of use and the like to be used for mixing the components as necessary.

In addition, the kit of the present invention may be a research use only (RUO) or an in vitro diagnostics (IVD) kit. IVD kits also include IVD-CDx (in vitro companion diagnostics) kits.

The kit of the present invention is used for qPCR (quantitative PCR) or droplet digital PCR method.

The template applicable to the kit of the present invention can be used without restriction as long as mutation detection of RAS / BRAF is required and PCR reaction is possible. Preferably, the template is cell-free DNA (cfDNA) DNA isolated from ctDNA (circulating tumor DNA) or formalin fixed paraffin embedded (FFPE) tissue derived from circulating tumor cells (CTC) or cDNA synthesized by reverse transcription from RNA from the tissue (complementary DNA) as a template.

CfDNA circulating in human plasma has been studied in a variety of physiological and pathological conditions such as inflammatory disorders, oxidative stress and malignant tumors. The precise mechanism involved in the release of cfDNA into the bloodstream is unclear, but seems likely to be a synergistic effect of apoptosis, cellular necrosis and active release from cells. CfDNA circulating through blood vessels is a potentially useful biomarker. DNA levels and fragmentation patterns present interesting potential for diagnostic and prognostic prediction purposes. In particular, the biomarker can be detected easily and rapidly without deteriorating the quality of life because the biomarker can be easily detected from the patient's blood.

In addition, the kit of the present invention can be used as a template for DNA isolated from blood circulating CTC (circulating tumor cell) or cDNA synthesized by reverse transcription from the CTC-derived RNA. CTC is a tumor cell found in the peripheral blood of a malignant tumor patient. Because CTC plays an important role in the process of metastasis, CTC is considered to be crucial in the study and diagnosis of cancer, but the number of circulating tumor cells in the peripheral blood is very rare, and there are fewer than a dozen There is a need for a detection system that requires a degree of sensitivity to detect tumor cells.

The tissue obtained from the patient after biopsy is usually fixed with formalin (formaldehyde) or the like. The immobilized biological sample is generally dehydrated and embedded in a solid support such as paraffin, and the sample thus prepared is called an FFPE sample. Nucleic acids in the FFPE sample, especially DNA, are present in immobilized cells and are either fragmented or cross-linked by formalin, so it is necessary to remove the paraffin and dissolve the fixed cells to elute the DNA and other nucleic acids in the cells.

In the present invention, the term " paraffin " comprehensively refers to a foraging medium of a biological sample used in all analyzes including morphological, immunohistochemical and enzymatic histochemical analysis. That is, the paraffin in the present invention may be a petroleum-based paraffin wax alone, and may be any one selected from the group consisting of all kinds of petroleum-based paraffin waxes, May be included. Herein, the petroleum paraffin wax refers to a mixture of hydrocarbons which are solid at room temperature derived from petroleum.

In general, a specimen of a cancer patient treated with FFPE is cut into a thickness of 5 to 10 μm using a rotary microtome, and then a nucleic acid containing DNA is isolated through a commercially available nucleic acid separation kit for FFPE or a device utilizing the same . Kits / devices for separating nucleic acids from FFPE include, for example, the Tissue Preparation System from Siemens and VERSANT tissue preparation reagents.

The nucleic acid isolated from the sample of the present invention is preferably a genomic DNA, more preferably a genomic DNA presumed to have a mutation.

The compositions or kits of the invention can preferably be used for RAS / BRAF mutation detection in automated or semi-automated methods. In the above, automation can be achieved by injecting a sample (sample); Relocation or movement of a substrate (e.g., tube, plate) that has been extracted, separated, or reacted; Reagent, buffer stock, replenishment; Means that all or most of the process, except equipment maintenance, takes place through means other than human (for example, a robot).

For reference, the above-mentioned nucleotide work can be referred to (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982); Sambrook et al. Inc., San Diego, Calif. (1990); Molecular Cloning: A Laboratory Manual, 2d Ed .; Cold Spring Harbor Laboratory Press (1989); Deutscher, M., Guide to Protein Purification Methods Enzymology, vol. 56: A67 (1987); De Andres et al., BioTechniques 18: 42044 (1995); Held et al., Et al., Current Protocols in Molecular Biology, John Wiley and Sons Diagnostic 2: 84-91 (2000); K. Specht et al., Am. J. Pathol., 158: 419-29 (2000); Genome Research 6: 986-994 (1996); TE Godfrey et al. (2001)).

I) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2 and the probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24; Ii) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27; And iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; And a set selected from the group consisting of RAS / BRAF mutation detection kit as an active ingredient.

Said kit comprising: i) a polynucleotide set of a forward primer of SEQ ID NO: 7, a reverse primer of SEQ ID NO: 8 and a probe selected from the group consisting of SEQ ID NO: 34 to SEQ ID NO: 36; And ii) a forward primer of SEQ ID NO: 9, a reverse primer of SEQ ID NO: 10, a forward primer of SEQ ID NO: 11, an inverted primer of SEQ ID NO: 12 and a polynucleotide set of the probes selected from the group consisting of SEQ ID NO: 37 to SEQ ID NO: ; ≪ / RTI >

The kit also comprises a polynucleotide set of a forward primer of SEQ ID NO: 13, a reverse primer of SEQ ID NO: 14, a forward primer of SEQ ID NO: 15, an inverted primer of SEQ ID NO: 16 and a probe selected from the group consisting of SEQ ID NO: As an active ingredient.

Thus, the present invention provides a primer and probe set composition for RAS / BRAF mutation detection and a kit comprising the same. The method of the present invention can predict the prognosis and response of the cancer prognosis to the therapeutic agent as well as the diagnosis, as well as the transition or recurrence of the cancer. Therefore, the present invention can provide a clue to the future direction of the treatment, Or for recurrence of the disease.

Fig. 1 is a schematic view of a mini-clone used as a reference material.
FIG. 2 shows the constitutions (MMX 1 to MMXX 8) of a RAS / BRAF mutation detection kit comprising a probe and a primer of the present invention, and shows the types of detectable RAS / BRAF mutations for each MMX.
FIG. 3 is a result of checking whether the RAS / BRAF mutation detection kit containing the probe and the primer of the present invention can detect the RAS / BRAF mutation site. FIG. 3 shows the results of detection of the mutation sites of MMX1 (A), MMX2 (B) and MMX3 And the results were only detected in the KRAS mutation site.
FIG. 4 shows the result of confirming whether the RAS / BRAF mutation detection kit containing the probe and the primer of the present invention can detect the RAS / BRAF mutation site. The NRAS mutation site contained in MMX5 (A) and MMX6 (B) The results are shown in Fig.
FIG. 5 is a result of confirming whether or not the RAS / BRAF mutation detection kit containing the probe and primer of the present invention can detect the RAS / BRAF mutation site. FIG. 5 shows the result of detection only in the BRAF mutation site contained in MMX8.
FIG. 6 shows False positive result values for each mutation of RAS / BRAF including a probe and a primer of the present invention using FFPE samples having no RAS / BRAF mutation.
FIG. 7 shows a method for measuring the quality of DNA extracted from FFPE samples in patients with colorectal cancer having RAS / BRAF mutation. The difference in DIN values (FIG. 7A) according to the FFPE storage period and the Quality in the GenesWell ddRAS / BRAF mutation kit control measurement (Fig. 7B).

Hereinafter, the present invention will be described in detail.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

Primer and probe design and selection

Mutations were identified based on the cosmic number (http://cancer.sanger.ac.uk) to develop biomarkers for k-Ras, n-Ras and BRAF genes, which are highly related to the onset of colorectal cancer . Primer3 plus program and PyroMa designed Assay Design 2.0 were designed so that forward can overlap with the intron part. At this time, the Tm value of the primer was set to 50 to 60 ° C, and the GC% was designed to be 40 to 70%.

The probes were designed with the taqman probe to select those that met the criteria. HEX or FAM reporter fluorescence was attached to the 5'-end of the wild and mutant probes to detect fluorescence signals according to the amplification of the gene of interest. BHQ1 was used as a quencher on the 3 'side of all probes. The probes designed by the present inventors have allele specificity and most probes have cosmic numbers. On the other hand, a blocker oligomer was prepared so as not to bind non-specifically using the sequence corresponding to the mutation site in order to reduce background (noise).

The information of the designed primer and probe is shown in Table 1 and Table 2, respectively.

Primer name Sequence Seq. No. KC-F11 TAAGGCCTGCTGAAAATGACT One KC1-R9 TCTGAATTAGCTGTATCGTCAAGG 2 KC16-F15 TGAGGGACCAGTACATGAGGA 3 KC16-R17 AACCCACCTATAATGGTGAATATCTTC 4 KC16-F3 CAGGATTCCTACAGGAAGCAAGT 5 KC16-R15 CAGTCCTCATGTACTGGTCCCT 6 NC23-F4 CCCCCAGGATTCTTACAGAAA 7 NC23-R4 CCTGTCCTCATGTATTGGTCTCTC 8 NC39-F8 TTAGGGAGCAGATTAAGCGAGTA 9 NC39-R10 TTCGTGGGCTTGTTTTGTATC 10 NC1-F6 GGTTCTTGCTGGTGTGAAATGACT 11 NC1-R6 TCTGGATTAGCTGGATTGTCAGTG 12 BC1-F1 GAAGACCTCACAGTAAAAATAGGTG 13 BC1-R3 ATCCAGACAACTGTTCAAACTGAT 14 BC9-F1 GTTCTAACAGGCACCAGAAGTC 15 BC9-R1 GTCCAGTCATCAATTCATACAGA 16

Information of the primer

Primer name Sequence Seq. No. KP2 TGGAGCTGATGGCGTAGGCA 17 KP4 TGGAGCTGTTGGCGTAGGCA 18 KP5 TGGAGCTAGTGGCGTAGGCAA 19 KP7 TGGAGCTTGTGGCGTAGGCA 20 KP36 TGGTAGTTGGAGCTTTTGGCG 21 K-ex2-B3 TGGAGCTGGTGGCGTAGGC 22 KP8 TGGAGCTGGTGACGTAGGCA 23 K-KC12-B3 GTAGTTGGAGCTGGTGCCGTAG 24 KP14-1 TGGTAGTTGGAGCTGGTATCGTAGGC 25 K-ex2-B3 TGGAGCTGGTGGCGTAGGC 26 KP16-2 AGGGCTTTCTTTGTGTATTTGCCA 27 KP17 CGACACAGCAGGTCACGAGGA 28 KP21-2 TCGACACAGCAGGTAAAGAGGA 29 KP23 CGACACAGCAGGTCCAGAGGA 30 KP37-1 CACAGCAGGTCGTGAGGAGTACA 31 KP38-1 ACACAGCAGGTGTAGAGGAGTACAGT 32 K-ex3-B3 ACACAGCAGGTCAAGAGGAGTACAGT 33 NP24-1 CTGGATACAGCTGGAAAAGAAGAGTACA 34 NP25-1 TGGATACAGCTGGACGAGAAGAGTAC 35 N-ex3-B2 TGGATACAGCTGGACAAGAAGAGTACA 36 NP39-1 CTCGGATGATGTACCTATGGTGCT 37 NP2-2 TGGTTGGAGCAAGTGGTGTTG 38 NP3-2 TGGTTGGAGCATGTGGTGTTG 39 NP5-2 TGGTTGGAGCAGATGGTGTTG 40 NP6-1 TGGTTGGAGCAGTTGGTGTTG 41 N-ex2-B2 GTTGGAGCAGGTGGTGTTGG 42 BP2-1 TGGTCTAGCTACAGAGAAATCTCGAT 43 BP3 CTAGCTACAGAAAAATCTCGATGGAG 44 B-C7-B2 TGGTCTAGCTACAGCGAAATCTCGATG 45 BP9 TGCAAGATAAAAATCCATACAGCTTTC 46

Probe information

The prepared primer and probe were combined to construct a kit for RAS / BRAF mutation detection.

≪ Example 2 >

Manufacture of standard materials

To verify the primers and probes designed, standard material vectors (named as mini-clones) were constructed to perform the ddPCR. The mini-clone was first synthesized in about 300 bp with the mutation in the exons of k-Ras, n-Ras and b-raf. The synthesized DNA fragment was inserted between the universal link sequence of the pUC57 vector vector (see FIG. 1), and the clone was transformed into E. coli DH5α cells.

In order to maximize the efficiency of ddPCR (droplet digital PCR) by linearizing mini-clones present in circular form or super-coiled form, ClaI or Pst1 restriction enzyme was reacted with mini-clone at 37 ° C for 30 minutes. up and stored at -20 ° C until use.

The detection target of the present invention exhibits a variation depending on the PCR amplification efficiency. Positive control, which is a criterion for discrimination of amplification by a specific primer / probe, is required. Positive control can be obtained by transforming a normal vector with a nucleotide ranging from 100 bp to 350 bp including the mutation of the gene of interest. Preferably, the positive control according to the present invention can be used by inserting the pUC57 vector or the pIDTSmart Amp vector by synthesizing about 300 bp of the mutation center of each exon of k-Ras, n-Ras and BRAF.

≪ Example 3 >

Mutation detection test using standard substance (Miniclone)

The standard material prepared above was used to determine whether the RAS / BRAF mutation detection kit (hereinafter referred to as "GenesWell ddRAS / BRAF mutation test kit") of the present invention can detect the RAS / BRAF mutation site. Given the heterozygous nature of cancer, Miniclone was prepared by spiking at 50% with wildtype gDNA. The amount of DNA used in this test was 12 ng / sample, and all samples were reacted with MMX1 to MMX8, respectively, to perform ddPCR.

The ddPCR procedure was carried out using the Biorad QX200 ™ Droplet digital PCR system (Bio-RAD, USA). Sample preparation was performed by mixing 20 μl each of 8-stirp PCR tubes containing MMX1 to MMX8 mixture. Ultrapure water (NTC), positive control (PC), and 1 μl of template DNA extracted from the patient sample were added to each tube. ). Information on the MMX1 to MMX8 mixture is shown in FIG.

The 8-Strip PCR tube cap was closed, vortexed and then spun-down and incubated at room temperature for 10 minutes. Then, 70ul of Droplet generation oil was added to the sample well of the DG cartridge prepared in the droplet generation step, and the droplet generation oil was added to the oil well. The droplet was then transferred to the droplet generator gasket and transferred to the QX200 ™ Droplet Generator Droplet was formed. Transfer the formed 40ul Droplet to a 96-well plate, cover the plate with the red line of the Pierceable Foil Heat Seal (BIO-RAD, 181-4040) down, place it in the PX1 ™ PCR Plate Sealer (180 ° C, Sealing. PCR amplification was performed using Veriti 96-Well Thermal Cycler, and the amplified PCR products were amplified using a QX200 drolet reaker. Results analysis was performed with QuantaSoft software provided by Bio-RAD.

The GenesWell ddRAS / BRAF mutation test of the present invention includes all of MMX1 to MMX8 capable of detecting RAS / BRAF mutation, and each construct can detect RAS / BRAF mutation site 5). Mutations for each gene can be distinguished by FAM and HEX. For example, the KRAS G12X mutation in MMX1 was classified as FAM and the KRAS G13D mutation was classified as HEX. The wild-type gene for measuring the quality of the sample was HEX of MMX4.

In addition, studies have shown that the presence of k-Ras and n-Ras mutations in colorectal cancer patients does not have the therapeutic effect of the EGFR inhibitors cetuximab and panitumum, which are used as therapeutic agents, but the Raf inhibitor bemulafenib , And it is known that dabrabenib drugs have a high therapeutic effect.

<Example 4>

Clinical cut-off settings for quantitative detection in clinical samples

For the quantitative limit setting of the GenesWell ddRAS / BRAF mutation test of the present invention, FFPE samples of patients with the RAS / BRAF wild type gene without the RAS / BRAF mutation were subjected to a total of 30 repeated tests, and the Limit of each mutation blank, LoB) and false positive numbers were analyzed.

As a result, mutant indices for KRAS G12X, G13D and Q61X were 0.8, 0.2 and 0.3, respectively, despite the presence of the RAS / BRAF mutation-free FFPE sample, and the mutant index for NRAS G12X and Q61X , And the mutant index for BRAF V600E was 0.1. We limited this to false positives. Based on these false positive results, the quantitative detection limits of each of the mutations in the GenesWell ddRAS / BRAF Mutation Test are shown in Table 3 below, and it was judged that a mutation was present when a value exceeding the threshold value for each mutation index was derived . The mutant index (MI) refers to a mutation rate relative to a wild-type gene corresponding to each mutation.

MMX Mutation Mutant index Hit rate (%) MMX1 KRAS G12X 1.1 100 KRAS G13D 1.1 100 MMX2 KRAS G13X 0.7 100 MMX3 KRAS Q61X 1.0 100 MMX5 NRAS Q61X 0.7 100 MMX6 NRAS G12X 0.6 100 MMX8 BRAF V600E 0.6 100

&Lt; Example 5 >

Quality control of DNA samples extracted from patient's FFPE samples

In order to preserve cancer tissues from patients for long term, paraffin embedded methods are commonly used. However, in the process of converting the tissue into FFPE, deamination or damage occurs in the DNA of the patient due to chemical reaction and external factors, DNA quality deteriorates according to the storage period, Lt; / RTI &gt; Therefore, it is very important to confirm the DNA quality in the sample for accurate diagnosis.

The GenesWell ddRAS / BRAF Mutation Test introduces quality control and allows the DNA integrity number (DIN), which is the DNA integrity number (DIN) High) to improve the accuracy of diagnosis. As shown in FIG. 7A, it was confirmed that the DIN value of the specimen within one year of FFPE organization was high and the quality control was stable over 500 copies (FIG. 7B).

&Lt; Example 6 >

Comparison of Detection Ability According to Mutation Detection Method in FFPE Samples of Patients

The molecular diagnostic suitability of GenesWell ddRAS / BRAF Mutation Test using the next generation PCR method was evaluated. For this purpose, 40 mutant FFPE samples were subjected to a mutagen detection test for the sanger sequencing method or the real-time PCR method, which is a gold standard of molecular diagnostics.

As shown in Table 4, GenesWell ddRAS / BRAF mutation test showed the highest mutation detection rate among the three methods, and singer sequencing method showed the lowest detection rate. In addition, the inconsistent samples from the GenesWell ddRAS / BRAF Mutation Test and the Sanger Sequencing were consistent with real-time PCR. Furthermore, the GenesWell ddRAS / BRAF Mutation Test detects additional mutations that were not detected by real-time PCR. Therefore, the GenesWell ddRAS / BRAF Mutation Test of the present invention has a higher sensitivity than other existing molecular diagnostic methods.

As described above, the compositions and kits of the present invention can be used for predicting the response of a cancer patient to a therapeutic agent, determining the necessity of administration of an anticancer drug to cancer patients, providing a clue to the direction of future treatment, Can be usefully used for the monitoring.

<110> Gencurix Inc.          Logone Bio Convergence Research Foundation <120> The composition for detecting mutations of RAS / BRAF and the kit          consisting of the compounds <130> NP17-0090P <150> KR 10-2017-0128335 <151> 2017-09-29 <160> 46 <170> KoPatentin 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KC1-F11 Primer <400> 1 taaggcctgc tgaaaatgac t 21 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> KC1-R9 Primer <400> 2 tctgaattag ctgtatcgtc aagg 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KC16-F15 Primer <400> 3 tgagggacca gtacatgagg a 21 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> KC16-R17 Primer <400> 4 aacccaccta taatggtgaa tatcttc 27 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> KC16-F3 Primer <400> 5 caggattcct acaggaagca agt 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> KC16-R15 Primer <400> 6 cagtcctcat gtactggtcc ct 22 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NC23-F4 Primer <400> 7 cccccaggat tcttacagaa a 21 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NC23-R4 Primer <400> 8 cctgtcctca tgtattggtc tctc 24 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NC39-F8 Primer <400> 9 ttagggagca gattaagcga gta 23 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NC39-R10 Primer <400> 10 ttcgtgggct tgttttgtat c 21 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NC1-F6 Primer <400> 11 ggttcttgct ggtgtgaaat gact 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NC1-R6 Primer <400> 12 tctggattag ctggattgtc agtg 24 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> BC1-F1 Primer <400> 13 gaagacctca cagtaaaaat aggtg 25 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BC1-R3 Primer <400> 14 atccagacaa ctgttcaaac tgat 24 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BC9-F1 Primer <400> 15 gttctaacag gcaccagaag tc 22 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BC9-R1 Primer <400> 16 gtccagtcat caattcatac aga 23 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KP2 Probe <400> 17 tggagctgat ggcgtaggca 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KP4 Probe <400> 18 tggagctgtt ggcgtaggca 20 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KP5 Probe <400> 19 tggagctagt ggcgtaggca a 21 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KP7 Probe <400> 20 tggagcttgt ggcgtaggca 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KP36 Probe <400> 21 tggtagttgg agcttttggc g 21 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> K-ex2-B3 Probe <400> 22 tggagctggt ggcgtaggc 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KP8 Probe <400> 23 tggagctggt gacgtaggca 20 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> K-KC12-B3 Probe <400> 24 gtagttggag ctggtgccgt ag 22 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> KP14-1 Probe <400> 25 tggtagttgg agctggtatc gtaggc 26 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> K-ex2-B3-2 Probe <400> 26 tggagctggt ggcgtaggc 19 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> KP16-2 Probe <400> 27 agggctttct ttgtgtattt gcca 24 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KP17 Probe <400> 28 cgacacagca ggtcacgagg a 21 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> KP21-2 Probe <400> 29 tcgacacagc aggtaaagag ga 22 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KP23 Probe <400> 30 cgacacagca ggtccagagg a 21 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> KP37-1 Probe <400> 31 cacagcaggt cgtgaggagt aca 23 <210> 32 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> KP38-1 Probe <400> 32 acacagcagg tgtagaggag tacagt 26 <210> 33 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> K-ex3-B3 Probe <400> 33 acacagcagg tcaagaggag tacagt 26 <210> 34 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> NP24-1 Probe <400> 34 ctggatacag ctggaaaaga agagtaca 28 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> NP25-1 Probe <400> 35 tggatacagc tggacgagaa gagtac 26 <210> 36 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> N-ex3-B2 Probe <400> 36 tggatacagc tggacaagaa gagtaca 27 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NP39-1 Probe <400> 37 ctcggatgat gtacctatgg tgct 24 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NP2-2 Probe <400> 38 tggttggagc aagtggtgtt g 21 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NP3-2 Probe <400> 39 tggttggagc atgtggtgtt g 21 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NP5-2 Probe <400> 40 tggttggagc agatggtgtt g 21 <210> 41 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NP6-1 Probe <400> 41 tggttggagc agttggtgtt g 21 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> N-ex2-B2 Probe <400> 42 gttggagcag gtggtgttgg 20 <210> 43 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> BP2-1 Probe <400> 43 tggtctagct acagagaaat ctcgat 26 <210> 44 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> BP3 Probe <400> 44 ctagctacag aaaaatctcg atggag 26 <210> 45 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> B-C7-B2 Probe <400> 45 tggtctagct acagcgaaat ctcgatg 27 <210> 46 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BP9 Probe <400> 46 tgcaagataa aaatccatac agctttc 27

Claims (16)

I) a polynucleotide set of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24;
Ii) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27; And
Iii) a polynucleotide set of the forward primer of SEQ ID NO: 5, the reverse primer of SEQ ID NO: 6, and the probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; Wherein the set comprises a set selected from the group consisting of: &lt; RTI ID = 0.0 &gt; RAS / BRAF &lt; / RTI &gt;
The composition of claim 1, wherein the composition comprises
I) a polynucleotide set of the forward primer of SEQ ID NO: 7, the reverse primer of SEQ ID NO: 8 and the probe selected from the group consisting of SEQ ID NO: 34 to SEQ ID NO: 36; And
Ii) a polynucleotide set of the forward primer of SEQ ID NO: 9, the reverse primer of SEQ ID NO: 10, the forward primer of SEQ ID NO: 11, the reverse primer of SEQ ID NO: 12 and the probe selected from the group consisting of SEQ ID NO: 37 to SEQ ID NO: 42; Wherein the set comprises a set selected from the group consisting of: &lt; RTI ID = 0.0 &gt; RAS / BRAF &lt; / RTI &gt;
The composition according to claim 1, wherein the composition comprises a forward primer of SEQ ID NO: 13, a reverse primer of SEQ ID NO: 14, a forward primer of SEQ ID NO: 15, a reverse primer of SEQ ID NO: 16 and a probe selected from the group consisting of SEQ ID NO: Wherein the polynucleotide set of the primer and probe set for RAS / BRAF mutation detection is further added as an active ingredient.
3. The primer and probe set composition of claim 1, wherein said RAS / BRAF mutation detection is for predicting the responsiveness to EGFR inhibitors.
5. The primer and probe set composition of claim 4, wherein the EGFR inhibitor is cetuximab, panitumumab, Vemurafenib or Dabrafenib.
2. The primer and probe set composition according to claim 1, wherein the probe is bound to a fluorescent material.
The primer and probe set composition according to claim 6, wherein the fluorescent material is at least one selected from the group consisting of VIC, HEX, FAM, and EverGreen dyes.
A kit for detecting RAS / BRAF mutation comprising the primer and probe set composition according to any one of claims 1 to 3 as an active ingredient.
The kit according to claim 8, wherein the kit is a research use only (RUO) or an in vitro diagnostic (IVD) kit.
I) a polynucleotide set of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24;
Ii) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27; And
Iii) a polynucleotide set of the forward primer of SEQ ID NO: 5, the reverse primer of SEQ ID NO: 6, and the probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; Wherein the kit comprises a set selected from the group consisting of: &lt; RTI ID = 0.0 &gt; RAS / BRAF &lt; / RTI &gt;
11. The apparatus of claim 10, wherein the kit
I) a polynucleotide set of the forward primer of SEQ ID NO: 7, the reverse primer of SEQ ID NO: 8 and the probe selected from the group consisting of SEQ ID NO: 34 to SEQ ID NO: 36; And
Ii) a polynucleotide set of the forward primer of SEQ ID NO: 9, the reverse primer of SEQ ID NO: 10, the forward primer of SEQ ID NO: 11, the reverse primer of SEQ ID NO: 12 and the probe selected from the group consisting of SEQ ID NO: 37 to SEQ ID NO: 42; Wherein the set comprises a set selected from the group consisting of: &lt; RTI ID = 0.0 &gt; RAS / BRAF &lt; / RTI &gt;
The kit according to claim 10, wherein the kit comprises a forward primer of SEQ ID NO: 13, an inverse primer of SEQ ID NO: 14, a forward primer of SEQ ID NO: 15, a reverse primer of SEQ ID NO: 16 and a probe selected from the group consisting of SEQ ID NO: Wherein the polynucleotide set of the RAS / BRAF mutation is added as an active ingredient.
13. The kit according to any one of claims 8 to 12, wherein the kit is used for qPCR (quantitative PCR) or digital PCR.
The kit according to any one of claims 8 to 12, wherein the kit comprises cfDNA (cell-free DNA) separated from blood as a template.
The kit according to any one of claims 8 to 12, wherein the kit comprises DNA isolated from formalin fixed paraffin embedded (FFPE) tissue or complementary DNA synthesized by reverse transcription from the tissue-derived RNA as a template .
13. The kit according to any one of claims 8 to 12, wherein the kit comprises complementary DNA synthesized by reverse transcription from DNA isolated from CTC (circulating tumor cells) isolated from blood or from CTC-derived RNA And a mold.

Images