WO2019066621A1 - Composition for detecting ras/braf mutations, and kit comprising same - Google Patents

Composition for detecting ras/braf mutations, and kit comprising same Download PDF

Info

Publication number
WO2019066621A1
WO2019066621A1 PCT/KR2018/011645 KR2018011645W WO2019066621A1 WO 2019066621 A1 WO2019066621 A1 WO 2019066621A1 KR 2018011645 W KR2018011645 W KR 2018011645W WO 2019066621 A1 WO2019066621 A1 WO 2019066621A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
primer
group
probe
ras
Prior art date
Application number
PCT/KR2018/011645
Other languages
French (fr)
Korean (ko)
Inventor
신영기
김성수
조상래
문영호
김지은
강병일
류다연
Original Assignee
주식회사 젠큐릭스
재단법인 록원바이오융합연구재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 젠큐릭스, 재단법인 록원바이오융합연구재단 filed Critical 주식회사 젠큐릭스
Publication of WO2019066621A1 publication Critical patent/WO2019066621A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • composition for RAS / BRAF mutation detection and kit comprising the same
  • the present invention relates to a composition for detecting RAS / BRAF mutation and a kit comprising the same, and more particularly to a kit for detecting RAS / BRAF mutation and a kit for detecting RAS / BRAF mutation will be.
  • Cancer refers to a group of abnormal cells caused by continuous division and proliferation by destroying the balance between cell division and death by various causes, and is also called a tumor or neoplasm. It generally develops in more than 100 parts of the body, including organs, white blood cells, bones, lymph nodes, etc., and develops into serious symptoms through the phenomenon of invasion into surrounding tissues and metastasis to other organs.
  • Cancer therapy is being developed continuously, and dozens of therapies for various cancers currently used in clinical trials are available.
  • clinicians are suffering from two difficulties. First, it takes a few weeks for the treatment to show its therapeutic effect, and it does not know beforehand what treatments are effective for individual patients. In other words, the therapeutic effects of anticancer drugs can not be judged within a few days, but they gradually appear over several weeks, so it takes a long time to judge the prescription drug to be ineffective. If the treatment is inadequate, then it is considered to be a different type of treatment, and if the clinician does not select the appropriate treatment for the patient at the time of initiation of the treatment, The disease progresses, recurrence, and prognosis.
  • the second difficulty is that there are a large number of patients who do not show any treatment in the treatment.
  • cetuximab a treatment for colorectal cancer
  • cetuximab a treatment for colorectal cancer
  • patients with colorectal cancer / rectal cancer can prevent unnecessary treatment with precise molecular diagnostic tests that identify mutations that do not have antinomies in the therapeutic drug before they are prescribed. Therefore, if the treatment response to the therapeutic agent and its side effects can be predicted in advance, it will be possible to lower the dropout and the compliance of the drug due to the wrong selection of the drug by preselecting the appropriate drug for the patient. It will also avoid the time it takes for the drug to take effect and the risk of side effects that the patient may experience.
  • the RAS gene is a gene identified as a viral cancer gene (v-RAS) of rodent retrovirus.
  • v-RAS viral cancer gene
  • K-RAS gene K-RAS 4A, K-RAS 4B, H-RAS and N-RAS.
  • Mutations in the RAS gene occur intensively at codons 12, 13, and 61, and when mutations occur, they become resistant to GAP-mediated GTP hydrolysis and remain activated.
  • the mutation of K-RAS occurs in about 90% of pancreatic cancer, about 50% of colon cancer, and about 30% of non-smalle lung cancers, and the N-RAS mutation is found in colon cancer 4% (Samowitz WS et al., Cancer Epidemiol. Biomarkers Prev. 9: 1193-7, 2000).
  • Mutations in the K-RAS and N-RAS genes are known to be highly correlated with short survival due to anti-EGFR therapy, anti-EEG deficiency and serotyping.
  • the BRAF gene is a subtype of the RAF (Raf Kinase) gene, which is involved in cell division and differentiation.
  • RAF is one of mitogen-activated protein kinases that mediate intracellular signal transduction, and A-RAF, B -RAF, and C-RAF. It has become famous.
  • the V600E mutation of B-RAF and C-RAF is known to be closely related to various types of cancer such as melanoma, colon cancer, and gastrointestinal cancer.
  • RAS or BRAF mutations in colorectal cancer patients have a low anti-EGFR therapeutic response. Therefore, an effective and rapid detection method of RAS or BRAF gene mutation is required to find an optimal therapeutic approach.
  • an object of the present invention is to provide a primer and a probe set composition for detecting RAS / BRAF mutation. It is another object of the present invention to provide a kit for RAS / BRAF mutation detection comprising a primer and a probe set composition for RAS / BRAF mutation detection. It is another object of the present invention to provide a use of a set of polynucleotides for producing a preparation for RAS / BRAF mutation detection. Another object of the present invention is
  • the present invention provides a primer and a probe set composition for RAS / BRAF mutation detection.
  • the present invention provides a kit for detecting RAS / BRAF mutations comprising a primer for detecting RAS / BRAF mutation and a probe set composition.
  • the present invention provides the use of a set of polynucleotides for producing a preparation for RAS / BRAF mutation detection.
  • compositions of the invention may preferably be for predicting the responsiveness of the treatment to RAS or BRAF drugs.
  • RAS or BRAF is an EGFR downstream effector and is the primary resistance marker for the therapeutic effect of anti-EGFR mAb.
  • RAS or BRAF have a significant impact on the optimization of treatment for patients with metastatic colorectal cancer (CRC). Approximately 50 to 60 percent of colorectal cancers develop a mutation in the RAS or BRAF gene, and these patients do not benefit from anti - EGFR therapy. All CRC patients who are considered to be using anti-EGFR therapy in current clinical practice should be tested for RAS. And BRAF mutation detection and if RAS or BRAF mutation is detected, the patient should be treated with cetuximab or pani tumumab ) Treatment.
  • the anti-EGFR therapies may preferably be, but are not limited to, cerulcim or panitumum, Vemurafenib or Dabrafenib.
  • therapeutically responsive can be defined as " responsive " to a therapeutic agent if the growth rate of the cancer is inhibited as a result of contact with the therapeutic agent as compared to growth in the absence of the therapeutic agent. If the growth rate of cancer is not suppressed or suppressed to a very low extent as a result of contact with the therapeutic agent compared to growth without contact with the therapeutic agent, it can be defined as " non-bioagonistic "
  • the growth of cancer can be measured in a variety of ways, including by measuring the size of the tumor or the expression of tumor markers that are appropriate for the tumor type.
  • antinomy &quot may indicate an increase in the survival time on a significant survival curve
  • " non-hepatobiliary " scale may include an additional criterion . ≪ / RTI >
  • the cancer of the present invention may be, but not limited to, pancreatic cancer, head and neck cancer, colon cancer, non-small cell lung cancer, and the treatment response to cancer treatment agent may be therapeutic response to EGFR inhibitor.
  • primer in the present invention means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerase such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis at appropriate temperature and pH conditions.
  • the primer is a deoxyribonucleotide and is a single strand.
  • the primers used in the present invention may include natural ly occurring d MP (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides.
  • primers may also include ribonucleotides.
  • the primer should be long enough to allow priming of the elongation product in the presence of the polymerizer.
  • the suitable length of the primer is determined by a number of factors, such as the temperature, the application, and the source of the primer, but is typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form a stable, stationary complex with the template.
  • annealing or " prism” means that the oligodeoxynucleotide or nucleic acid is apposited to the template nucleic acid, which polymerizes the nucleotide to polymerize the template nucleic acid, To form nucleic acid molecules.
  • probe is a kind of taqman probe used for quantitative PCR.
  • a fluorescent material HEX, VIC, FAM dye
  • BHQ1 can be used as a quencher on the 3 'side of all the probes.
  • TaqMan probe is generally the 5 'end with a fluorophore and 3' ends with the one tagging material quencher ol igonucleot ide 0!
  • the TaqMan probe does not produce fluorescence even when light is applied due to the presence of a quencher at the 3 'end of the probe.
  • Taq DNA polymerase in the following extension step When the TaqMan probe is cleaved by the 5 ' ⁇ 3' exonuc lease activity on the template, the fluorescent substance is separated from the probe and the inhibition by the quencher is released and the fluorescence is emitted. Is quantitatively released.
  • the probe is characterized by being bonded to a fluorescent material, more preferably HEX (hexachlorofluorescein), FAM (fluorescein amidi te), EverGreen And the fluorescent dye is bonded.
  • the probe since the probe is combined with FAM, HEX fluorescent dye (fluorescent substance) or EvaGreen fluorescent dye, it can be performed by measuring fluorescence thereon. This process can be performed by a commercially available detector (for example, Droplet Reader from biorad), which detects the droplet fluorescence signal of each sample in the corresponding instrument and calculates the number of positive and negative droplets Counting can be completed automatically by analysis.
  • HEX fluorescent dye fluorescent substance
  • EvaGreen fluorescent dye fluorescent dye
  • This process can be performed by a commercially available detector (for example, Droplet Reader from biorad), which detects the droplet fluorescence signal of each sample in the corresponding instrument and calculates the number of positive and negative droplets Counting can be completed automatically by analysis.
  • probes to be added to the PCR reaction solution and probes to be added to the standard PCR reaction solution for detection may be respectively associated with different fluorescent materials.
  • One aspect of the present invention provides a kit for detecting RAS / BRAF gene mutation comprising a primer and a probe set of the present invention.
  • Another aspect of the present invention provides a RAS / BRAF gene mutation detection fusion kit comprising the primer and the probe set of the present invention.
  • kits for detecting RAS / BRAF gene mutation which is essentially composed of the primer and the probe set of the present invention.
  • the kit also features an oligomer (blocker) designed to prevent non-specifi- cally binding probes for mutation detection using a sequence corresponding to the mutation site to reduce background noise.
  • the kit of the present invention can preferably be used for the detection of mutations of RAS / BRAF by PCR reaction using the primer / probe set of the present invention.
  • the kit of the present invention may further comprise tools and / or reagents known in the art used for PCR or detection thereof.
  • the kit of the present invention may further include tubes, well plates, instructions for describing how to use, and the like to be used to fuse each component as needed.
  • the kit of the present invention may be a research use only (RUO) or an in vitro diagnostic kit (IVD) kit.
  • the IVD kit also includes the IVD_CDx (in vitro companion diagnostics) kit.
  • the kit of the present invention is used in a qPCR (quantitative tat ive PCR) or a droplet digital PCR method.
  • the template applicable to the kit of the present invention can be used without restriction as long as mutation detection of RAS / BRAF is necessary and PCR reaction is possible.
  • the template is a cell-free DNA (cfDNA) , DNA isolated from ctDNA (circulat ing tumor DNA) or formalin fixed paraffin embedded (FFPE) tissue derived from circulating tumor cells (CTC) (Complementary DNA) synthesized by reverse transcription from NA is used as a template.
  • CfDNA circulating in human plasma has been studied in a variety of physiological and pathological conditions such as inflammatory disorders, oxidative stress and malignant tumors. The precise mechanism involved in the release of cfDNA into the bloodstream is unclear, but seems likely to be a synergistic effect of apoptosis, cellular necrosis and active release from cells. CfDNA circulating through blood vessels is a potentially useful biomarker.
  • the biomarker can be detected easily and rapidly without deteriorating the quality of life because the biomarker can be easily detected from the patient's blood.
  • the kit of the present invention can be used as a template for DNA isolated from blood-separated CKX cycling tumor cells or cDNA synthesized by reverse transcription from RA derived from CTC.
  • CTC is a tumor cell found in the peripheral blood of a malignant tumor patient.
  • CTC plays an important role in the process of metastasis, CTC is considered to be crucial in the study and diagnosis of cancer, but the number of circulating tumor cells in the peripheral blood is very rare, and dozens or fewer A need exists for a detection system that requires a degree of sensitivity to detect tumor cells of the tumor.
  • the tissue obtained from the patient after biopsy is usually fixed with formalin (formaldehyde) or the like.
  • formalin formalin
  • the immobilized biological sample is generally dehydrated and embedded in a solid support such as paraffin, and the sample thus prepared is called an FFPE sample.
  • the term " paraffin " in the present invention refers to the embedding medium of a biological sample used in all interpretations including morphological, immunohistochemical and enzymatic histochemical analysis. That is, the paraffin in the present invention may be a petroleum-based paraffin wax, and may be any one selected from the group consisting of all kinds of petroleum-based paraffin waxes (for example, Petroleum-based paraffin wax refers to a mixture of hydrocarbons that are solid at room temperature and derived from petroleum.
  • the nucleic acid containing DNA can be isolated from commercial FFPE nucleic acid separation kits or devices utilizing it.
  • Kits / devices for separating nucleic acids from FFPE are, for example, The Ti ssue preparation system of Siemens, and VERSANT t issue preparation reagents.
  • the nucleic acid separated from the sample of the present invention preferably contains a genomic DNA
  • the composition or kit of the present invention can be preferably used for RAS / BRAF mutation detection of an automated or semi-automated method.
  • One embodiment of the present invention is a kit comprising: i) a set of polynucleotides of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2, and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24; A set of polynucleotides of the probe selected from the group consisting of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4, and the SEQ ID NO: 25 to SEQ ID NO: 27; And iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; And a set selected from the group consisting of RAS / BRAF mutation detection kit as an active ingredient.
  • a kit for detecting RAS / BRAF mutation comprising: i) a polynucleotide set of a forward primer of SEQ ID NO: 7, an inverse primer of SEQ ID NO: 8, and a probe selected from the group consisting of SEQ ID NO: 34 to SEQ ID NO: 36; And ii) a primer selected from the group consisting of the forward primer of SEQ ID NO: 9, the reverse primer of SEQ ID NO: 10, the forward primer of SEQ ID NO: 11, the reverse primer of SEQ ID NO: 12, A set selected from the group consisting of:
  • the kit also comprises a forward primer of SEQ ID NO: 13, an inverted primer of SEQ ID NO: 14, a forward primer of SEQ ID NO: 15, a reverse primer of SEQ ID NO: 16 and a polynucleotide of a probe selected from the group consisting of SEQ ID NOS:
  • a clotid set can be added as an active ingredient.
  • the present invention provides the use of a set of polynucleot
  • a set of polynucleotides selected from the group consisting of i) i) i) for producing a preparation for detecting RAS / BRAF mutation is provided.
  • sample includes blood and other liquid samples of biologic origin, biopsy specimens, solid tissue samples such as tissue culture, or cells derived therefrom. More specifically, it may be a tissue, an extract, a cell lysate, a whole blood, a plasma, a serum, a saliva, an ophthalmic solution, a cerebrospinal fluid, a sweat, a urine, a milk, a plural liquid, a synovial fluid, a peritoneal fluid and the like.
  • the sample can be obtained from an animal, preferably a mammal, and most preferably from a human.
  • the sample can also be pretreated prior to use in detection.
  • it may include filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, and the like.
  • the term "compr i sing" of the present invention is used in the same way as “contains” or “to characterize” and is used in the composition or method to refer to additional component elements or method steps not mentioned .
  • the term " consisting of " means to exclude additional elements, steps or components not otherwise mentioned.
  • the term " consis- tent ingredient of the term " as used herein is intended to encompass a range of components or steps, including component elements or steps, which do not materially affect its underlying properties, .
  • the present invention provides a primer and probe set composition for RAS / BRAF mutation detection and a kit comprising the same.
  • the method of the present invention is capable of predicting the reactivity of a cancer patient to a therapeutic agent, predicting cancer metastasis or recurrence as well as diagnosis
  • the purpose of this study was to determine the necessity of administration of anticancer drugs, to provide clues about the direction of future treatment, and to monitor the metastasis or recurrence of cancer.
  • FIG. 1 is a schematic view of a mini-clone used as a reference material.
  • FIG. 2 shows the structures (M 1 to M 8) of the RAS / BRAF mutation detection kit including the probe and the primer of the present invention, and shows the types of detectable RAS / BRAF variants for each MMX.
  • 3A to 3C are results of checking whether the RAS / BRAF mutation detection kit including the probe and the primer of the present invention can detect the RAS / BRAF mutation site, and MMX1 (FIG. 3A), MMX2 MMAS3 (FIG. 3C).
  • FIGS. 4A and 4B show the result of checking whether the RAS / BRAF mutation detection kit including the probe and the primer of the present invention can detect the RAS / BRAF mutation site, and MMX5 is included in FIG. 4A) and MMX6 The results are shown only in the NRAS mutation site.
  • FIG. 5 is a result of confirming whether or not the RAS / BRAF mutation detection kit containing the probe and the primer of the present invention can detect the RAS / BRAF mutation site.
  • FIG. 5 shows the results of detection only at the BRAF mutation site included in MMX8.
  • FIG. 6 shows false positive results for each mutation of RAS / BRAF including the probe and primer of the present invention using FFPE samples having no RAS / BRAF mutation.
  • FIG. 7A and 7B are graphs for measuring the quality of DNA extracted from FFPE samples from patients with colorectal cancer having RAS / BRAF mutations.
  • BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.
  • Example 1 Primer and probe design and selection
  • Mutation sites were identified based on the cosmic number (http: // cancer.Sanger.ac.uk) to develop biomarkers of k-Ras, n-Ras, and BRAF genes that are highly related to the incidence of colorectal cancer .
  • the exon primer of the gene was designed so that the forward primer could be overlapped with the intron primer using P rimer3 plus program and PyroMa Assay Design 2.0.
  • the Tm value of the primer was set at 50 to 60 ° C (3 ⁇ 4:% was designed to be 40-70%.)
  • the probe was designed as a taqman probe by selecting those that meet the conditions.
  • Mutant probes were attached with HEX or FAM reporter fluorescence to detect fluorescence signals according to amplification of the target gene.
  • BHQ1 was used as a quencher on the 3 'side of all probes.
  • the probes designed by the probe have allele specificity and most probes have a cosmic number, while non-specific binding can not be achieved using a sequence homologous to the mutation site to reduce the background (noise) Respectively.
  • the information of the designed primer and probe is shown in Table 1 and Table 2, respectively.
  • mini-clone To validate the designed primers and probes, and to create the standard material vector (named mini-clone) required for ddPCR performance.
  • the mini-clone was first synthesized in about 300 bp with the mutation in the exons of k-Ras, n-Ras and b-raf.
  • the synthesized DNA fragment was inserted between the universal l ink sequence of the pUC57 vector vector (see Fig. 1), and the clone was ligated into E. coli DH5 [alpha] cells Transformed.
  • ddPCR droplet digital PCR
  • Clal or Pstl restriction enzyme was added to the mini-clone for 30 minutes at 37 ° C, The product was cleaned up and stored at -20 ° C until use.
  • the detection target of the present invention exhibits mutation different depending on the PCR amplification effect.
  • Posit ive control ° 1 which is a criterion for discrimination of amplification by a specific primer / probe, is necessary.
  • Posit ive contn can be obtained by transforming a lOObp of a nucleotide of 350 bp containing a mutation of a target gene into a normal vector.
  • the Positve contr of the present invention can be used as a center of mutation in the exons of k-Ras, n-Ras and BRAF, respectively, and about 300 bp can be synthesized and inserted into pUC57 vector or pIDTSmart Amp vector.
  • Example 3 Mutation detection test using a standard substance (Miniclone)
  • BRAF Mutation Detection Kit (hereinafter referred to as 'GenesWellddrRAS / BRAF mutation test ki') can detect the RAS / BRAF mutation site using the standard material prepared above . Given the heterozygous nature of the cancer, Miniclone was spiked with 50% of wildtype gDNA and samples were prepared. The amount of DNA used in this test was 12 ng / sample, and all samples were reacted with MMX1 to MMX8, respectively, to perform ddPCR.
  • the ddPCR procedure was carried out using the QX200 TM Droplet digital PCR system (Bio-RAD, USA) of Biorad.
  • QX200 TM Droplet digital PCR system Bio-RAD, USA
  • 20 ⁇ l of the mixture was added to the 8-st irp PCR tube containing MMX1 to MMX8 mixture.
  • Ultrapurewater (NTC) and Positve controKPC were added to each tube, and the template DNA extracted from the patient sample was added lul. ion mix).
  • Information on the MMX1 to MMX8 mixture is shown in FIG.
  • the 8-Strip PCR tube cap was closed, vortexed and then spun-down and incubated at room temperature for 10 minutes.
  • the sample well of the DG cartridge prepared after the droplet generation step was subjected to a PCR reaction (Droplet Generator Oil) was added to the Droplet Generator Gasket, and Droplet was formed with the QX20 () TM Droplet Generator. Transfer the formed 40ul Droplet to a 96 well plate and cover the red line of Pierceable Foil Heat Sea KBIO-RAD, 181-4040) on the bottom of the dipstick plate and place it on a PX1 TM PCR Plate Sealer (180 ° C, 5 sec seal ing) And sealed.
  • PCR amplification was performed using Verite 96-Well Thermal Cycler, and amplified PCR products were amplified using a QX200 drolet reaker. The results were analyzed using Quant aSoft software provided by Bk-RAD.
  • the GenesWellddAS / BRAF mutation test of the present invention includes all of MMX1 through MMX8 capable of detecting RAS / BRAF mutation, and each construct can detect RAS / BRAF mutation sites ( 3 to 5).
  • the mutations for each gene can be divided into F and HEX.
  • the KRAS G12X mutation in MMX1 was identified as FAM and the KRAS G13D mutation as HEX.
  • the wild-type gene for measuring the quality of the sample was HEX of LYX4. .
  • FFPE samples of patients with the RAS / BRAF wild-type gene without the RAS / BRAF mutation were subjected to a total of 30 repeated tests, (Limit of blank, LoB) and false positivities.
  • mutant indices for KRAS G12X, G13D and Q61X were 0.8, 0.2 and 0.3, respectively, despite the presence of the RAS / BRAF mutation-free FFPE sample, and the mutant index for NRAS G12X and Q61X , And the mutant index for BRAF V600E was 0.1.
  • the quantitative detection limits of each of the mutations in the GenesWel® ddRAS / BRAF Mutation Test are shown in Table 3 below. Mutation is present when a value above the threshold value for each mutant index is derived Respectively. remind The mutant index (MI) is the ratio of the mutation to the wild type gene corresponding to each mutation.
  • Example 5 Quality Control of DNA Sample Extracted from a Patient's FFPE Samples
  • the patient's paraffin embedded methods are commonly used.
  • deamination or damage of the DNA in the patient's sample occurs due to chemical reaction and external factors, DNA quality deteriorates according to the storage period, Lt; / RTI > Therefore, DNA quality verification in samples is very important for accurate diagnosis.
  • the GenesWell ddRAS / BRAF Mutation Test introduces quality control and allows the DNA integrity number (DIN), which is the DNA integrity number (DIN) High) to improve the accuracy of diagnosis.
  • DIN DNA integrity number
  • FIG. 7A it was confirmed that the DIN value of the specimen within one year of FFPE organization was high and the quality control was stable over 500 copies (FIG. 7B).
  • FIG. 7B Example 6 Comparison of Detection Ability According to Mutation Detection Method in FFPE Samples of Patients
  • the molecular diagnostic suitability of GenesWell 's ddRAS / BRAF Mutation Test using the next generation PCR method was evaluated. To this end, using the FFPE samples of 40 patients was performed for mutation detection performance comparison test with respect to the methods or real time PCR ⁇ mwonseong method (Sanger sequencing) during the Sanger standard test of the molecular diagnosis (gold standard).
  • the GenesWell ddRAS / BRAF mutation test showed the highest mutation detection rate among the three methods, and the searing method showed the lowest detection rate.
  • the GenesWell ddRAS / BRAF Mutation Test and Sanger Inconsistent samples with sequencing showed results consistent with real-time PCR.
  • the GenesWell ddRAS / BRAF Mutation Test detects additional mutations that were not detected by real-time PCR. Therefore, the GenesWell ddRAS / BRAF Mutation Test of the present invention has a higher sensitivity than other existing molecular diagnostic methods.
  • compositions and kits of the present invention can be used for the purpose of presenting a clue to the direction of treatment in addition to judging the necessity of administration of an anticancer drug to cancer patients through anti-maleicity prediction of a cancer patient's prognosis, As shown in FIG.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a composition for detecting RAS/BRAF mutations and a kit comprising same and, more specifically, to a primer and probe set composition for detecting RAS/BRAF mutations and a kit for detecting RAS/BRAF mutations comprising the composition. A method according to the present invention enables prediction of the metastasis or recurrence of cancer, as well as prediction and diagnosis of responsiveness to a therapeutic agent according to prognosis of a cancer patient, and thus can be usefully employed for the purpose of providing clues to the future course of treatment, including determination of the need for administering an anticancer therapeutic agent, and in monitoring for metastasis or recurrence of cancer.

Description

【명세서】  【Specification】
【발명의 명칭】  Title of the Invention
RAS/BRAF돌연변이 검출용 조성물 및 이를 포함하는 키트 【기술분야】  Composition for RAS / BRAF mutation detection and kit comprising the same
본 발명은 RAS/BRAF 돌연변이 검출용 조성물 및 이를 포함하는 키트에 관한 것으로， 보다 상세하게는 RAS/BRAF 돌연변이 검출용 프라이머 및 프로브 세트 조성 물과 상기 조성물을 포함하는 RAS/BRAF 돌연변이 검출용 키트에 관한 것이다.  The present invention relates to a composition for detecting RAS / BRAF mutation and a kit comprising the same, and more particularly to a kit for detecting RAS / BRAF mutation and a kit for detecting RAS / BRAF mutation will be.
【배경기술】 BACKGROUND ART [0002]
본 출원은 2017년 9월 29일에 출원된 대한민국 특허출원 제 10-2017-0128335 호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다. 암이란 다양한 원인에 의해 세포의 분열과 사멸 간의 균형이 파괴됨으로써 계속적인 분열과 증식에 의해 발생한 비정상적인 세포의 집단을 의미하며， 종양 또 는 신생물이라고도 한다. 일반적으로 장기， 백혈구， 뼈, 림프절 등을 포함한 100 가지 이상의 신체의 여러 부분에 발병하며， 주변조직으로 침윤하는 현상 및 다른 기관으로 이동하는 전이를 통해 심각한 증상으로 발전한다.  This application claims priority from Korean Patent Application No. 10-2017-0128335, filed on September 29, 2017, the entire contents of which are incorporated herein by reference. Cancer refers to a group of abnormal cells caused by continuous division and proliferation by destroying the balance between cell division and death by various causes, and is also called a tumor or neoplasm. It generally develops in more than 100 parts of the body, including organs, white blood cells, bones, lymph nodes, etc., and develops into serious symptoms through the phenomenon of invasion into surrounding tissues and metastasis to other organs.
암의 치료제는 지속적으로 개발되고 있어， 현재 임상에서 사용되는 각종 암 에 대한 치료제는 수십 가지에 이르고 있다. 하지만 현재까지도 임상의들은 두 가 지의 어려움을 겪고 있는데， 첫째는 치료제가 치료 효과를 나타내기까지는 몇주 정 도의 시간이 소요되고 개개 환자들에게 효과가 있는 치료제를 미리 알 수가 없다는 것이다. 즉， 항암제의 치료 효과는 며칠 내에 판정할 수 있는 것이 아니라 수주에 걸쳐서 서서히 나타나기 때문에 처방된 약물이 효과가 없다고 판단하기까지는 오랜 시간이 걸린다는 것이다. 그 후 치료 효과가 부적절하다면 다른 종류의 치료제로 변경을 고려하는데， 결국 치료 개시 시기에 임상의가 환자에게 적절한 치료제를 선 택하지 못하였다면， 그만큼 효과적인 치료에 이르는데， 시간이 그만큼 지체하게 되 며, 병의 진행, 재발 및 예후에 치명적인 영향을 미치게 된다. 두 번째 어려움은 치료제에 치료 반웅을 보이지 않는 환자가 다수 존재하는 점이다. 예를 들어， 대장직장암 치료제인 세특시맙 (cetuximab)은 KRAS 돌연변이 유 전자가 존재하는 환자들에게서 치료효과가 없는 것으로 알려져 있다. 이러한 연구 를 바탕으로 직장 /대장암 환자들은 치료제를 처방 받기 전에 치료 약물에 반웅성을 가지지 않는 돌연변이를 확인하는 정확한 분자진단검사를 통해 불필요한 치료제 처 방을 막을 수 있다. 따라서， 치료제에 대한 치료반응과 그 부작용을 미리 예측할 수 있다면， 환 자에게 맞는 약물을 미리 선별하여 약물올 잘못 선택함으로 인하여 생기는 치료 탈 락 (dropout )를을 낮추고 약물의 순응도를 높일 수 있을 것이다. 또한 약물의 효과 가 나타나기까지 걸리는 시간과 환자가 겪을 지도 모르는 부작용의 위험을 피해 갈 수 있을 것이다. Cancer therapy is being developed continuously, and dozens of therapies for various cancers currently used in clinical trials are available. However, until now, clinicians are suffering from two difficulties. First, it takes a few weeks for the treatment to show its therapeutic effect, and it does not know beforehand what treatments are effective for individual patients. In other words, the therapeutic effects of anticancer drugs can not be judged within a few days, but they gradually appear over several weeks, so it takes a long time to judge the prescription drug to be ineffective. If the treatment is inadequate, then it is considered to be a different type of treatment, and if the clinician does not select the appropriate treatment for the patient at the time of initiation of the treatment, The disease progresses, recurrence, and prognosis. The second difficulty is that there are a large number of patients who do not show any treatment in the treatment. For example, cetuximab, a treatment for colorectal cancer, is known to have no therapeutic effect in patients with the KRAS mutation gene. These studies , Patients with colorectal cancer / rectal cancer can prevent unnecessary treatment with precise molecular diagnostic tests that identify mutations that do not have antinomies in the therapeutic drug before they are prescribed. Therefore, if the treatment response to the therapeutic agent and its side effects can be predicted in advance, it will be possible to lower the dropout and the compliance of the drug due to the wrong selection of the drug by preselecting the appropriate drug for the patient. It will also avoid the time it takes for the drug to take effect and the risk of side effects that the patient may experience.
RAS 유전자는 설치류 레트로바이러스의 바이러스암유전자 (v-RAS)로 동정된 유전자이며， 대응하는 포유류의 세포유전자로서 c-H-RASL C-K-RAS2 , N-RAS의 3종 류가 패밀리를 형성한다. 사람염색체 상에서는 각각 llpll .5, 12ρ12.1 , 1ρ13에 존 재하며 4개의 코딩액손으로 구성되며 구아닌뉴클레오티드를 결합하여 세포막 내측 에 편재하는 189개의 아미노산을 함유하는 21kDa의 단백질 (p21)을 코드한다. K-RAS 유전자는 2종류의 엑손 4가 있으므로 RAS유전자의 산물로서 K-RAS 4A, K-RAS 4B, H-RAS, N-RAS의 4종류가 존재한다. The RAS gene is a gene identified as a viral cancer gene (v-RAS) of rodent retrovirus. Three types of c-H-RASL C-K-RAS2 and N-RAS form the corresponding mammalian cell gene. On the human chromosome, they encode a 21 kDa protein (p21) containing 189 amino acids, which is composed of four coding axons and is bound to the inside of the cell membrane by binding to a guanine nucleotide, located at llpl1.5, 12ρ12.1 and 1ρ13. There are four types of K-RAS gene: K-RAS 4A, K-RAS 4B, H-RAS and N-RAS.
RAS유전자의 돌연변이는 코돈 12， 13， 61에 집중적으로 발생하며， 돌연변이 가 발생하게 되면 GAP-mediated GTP hydrolysi s에 저항성을 가지게 되어 지속적으 로 활성화된 상태를 유지하게 된다. K-RAS의 돌연변이는 췌장암의 약 90%, 대장암 의 약 50%， 비소세포성 폐암 (non-smal l cel l lung cancers)의 약 30%에서 나타나 며， N-RAS 돌연변이는 대장암에서 약 4%의 발병률을 보인다 (Samowitz WS et al .， Cancer Epidemiol . Biomarkers Prev. 9： 1193-7, 2000) . K-RAS 및 N-RAS 유전자의 돌연변이는 항 -EGFR 치료요법인 세룩시맙 및 파니투무맙 치료요법에 대한 반웅성 결여로 짧은 생존과 높은 상호 연관성이 있다고 알려져 있다. 따라서， K-RAS 또는 N-RAS 유전자의 돌연변이가 존재하면 세특시맙 또는 파니투무맙에 대한 약효가 저 해될 것올 예측할 수 있다. 또한, BRAF 유전자는 세포분열， 분화등에 관여하는 암 유전자로 RAF (Raf Kinase) 유전자의 아형으로， 상기 RAF는 세포 내 신호전달을 매개하는 미토겐 활성 화단백질 키나아제 중 하나이며， A-RAF, B-RAF, C-RAF 등 3개의 아형 (type)으로 구 성되어 있다. 이 중 B-RAF , C-RAF의 V600E 돌연변이는 흑색종， 대장암， 감상선 암 등 다양한 종류의 암 발생과 깊이 연관돼 있는 것으로 알려져 있다. 이와 같이， 대장암 환자에서의 RAS 또는 BRAF 돌연변이는 항 -EGFR 치료요법 에 대한 낮은 반웅성을 가진다. 이에 최적의 치료적 접근법을 찾기 위해 RAS 또는 BRAF유전자 돌연변이의 효과적이고 신속한 검출 방법이 요구된다. Mutations in the RAS gene occur intensively at codons 12, 13, and 61, and when mutations occur, they become resistant to GAP-mediated GTP hydrolysis and remain activated. The mutation of K-RAS occurs in about 90% of pancreatic cancer, about 50% of colon cancer, and about 30% of non-smalle lung cancers, and the N-RAS mutation is found in colon cancer 4% (Samowitz WS et al., Cancer Epidemiol. Biomarkers Prev. 9: 1193-7, 2000). Mutations in the K-RAS and N-RAS genes are known to be highly correlated with short survival due to anti-EGFR therapy, anti-EEG deficiency and serotyping. Thus, the presence of mutations in the K-RAS or N-RAS gene predicts that the efficacy against cefixime or panitumum can be impaired. The BRAF gene is a subtype of the RAF (Raf Kinase) gene, which is involved in cell division and differentiation. RAF is one of mitogen-activated protein kinases that mediate intracellular signal transduction, and A-RAF, B -RAF, and C-RAF. It has become famous. Among them, the V600E mutation of B-RAF and C-RAF is known to be closely related to various types of cancer such as melanoma, colon cancer, and gastrointestinal cancer. Thus, RAS or BRAF mutations in colorectal cancer patients have a low anti-EGFR therapeutic response. Therefore, an effective and rapid detection method of RAS or BRAF gene mutation is required to find an optimal therapeutic approach.
【발명의 상세한 설명】 DETAILED DESCRIPTION OF THE INVENTION
【기술적 과제】 이에 본 발명자들은 RAS/BRAF 돌연변이를 신속하게 검출하여 RAS/BRAF 돌연 변이와 관련된 암 환자의 약물치료 전략을 선택할 수 있는 프라이머 /프로브 세트를 발굴하고， 이에 적합한 키트를 개발함으로써 본 발명을 완성하였다. 따라서 본 발명의 목적은 RAS/BRAF 돌연변이 검출용 프라이머 및 프로브 세 트 조성물을 제공하는 것이다. 본 발명의 다른 목적은 RAS/BRAF 돌연변이 검출용 프라이머 및 프로브 세트 조성물을 포함하는 RAS/BRAF돌연변이 검출용 키트를 제공하는 것이다. 본 발명의 다른 목적은 RAS/BRAF 돌연변이 검출용 제제를 제조하기 위한 폴 리 뉴클레오티드 세트의 용도를 제공하는 것이다. 본 발명의 다른 목적은  Accordingly, the present inventors discovered a primer / probe set capable of promptly detecting a RAS / BRAF mutation and selecting a drug treatment strategy for cancer patients related to RAS / BRAF mutation, and developed a kit suitable for the primer / . Accordingly, an object of the present invention is to provide a primer and a probe set composition for detecting RAS / BRAF mutation. It is another object of the present invention to provide a kit for RAS / BRAF mutation detection comprising a primer and a probe set composition for RAS / BRAF mutation detection. It is another object of the present invention to provide a use of a set of polynucleotides for producing a preparation for RAS / BRAF mutation detection. Another object of the present invention is
(a) 시료에서 DNA를 분리하는 단계 ;  (a) separating DNA from a sample;
(b) 상기 분리된 DNA를 주형으로 하고 본 발명의 프라이머 및 프로브 세트를 이용하여 중합효소연쇄반웅 (PCR)올 실시하는 단계; 및  (b) performing the PCR using the separated DNA as a template and using the primer and the probe set of the present invention; And
(c) 상기 중합효소연쇄반웅으로 증폭된 산물을 통해， RAS/BRAF 돌연변이 유 전자를 검출하는 단계를 포함하는 RAS/BRAF 유전자 돌연변이 검출 방법을 제공하는 것이다.  (c) detecting the RAS / BRAF mutation gene through a product amplified by the polymerase chain reaction.
【기술적 해결방법】 상기와 같은 목적을 달성하기 위하여 , 본 발명은 RAS/BRAF 돌연변이 검출용 프라이머 및 프로브 세트 조성물을 제공한다. 본 발명의 다른 목적을 달성하기 위하여， 본 발명은 RAS/BRAF 돌연변이 검출 용 프라이머 및 프로브 세트 조성물을 포함하는 RAS/BRAF 돌연변아 검출용 키트를 제공한다. 본 발명의 다른 목적을 달성하기 위하여 , 본 발명은 RAS/BRAF 돌연변이 검출 용 제제를 제조하기 위한폴리 뉴클레오티드 세트의 용도를 제공한다. 본 발명의 다른 목적을 달성하기 위하여， [Technical Solution] In order to achieve the above object, the present invention provides a primer and a probe set composition for RAS / BRAF mutation detection. In another aspect, the present invention provides a kit for detecting RAS / BRAF mutations comprising a primer for detecting RAS / BRAF mutation and a probe set composition. In order to achieve another object of the present invention, the present invention provides the use of a set of polynucleotides for producing a preparation for RAS / BRAF mutation detection. In order to achieve another object of the present invention,
(a) 시료에서 DNA를 분리하는 단계 ;  (a) separating DNA from a sample;
(b) 상기 분리된 DNA를 주형으로 하고 본 발명의 프라이머 및 프로브 세트를 이용하여 중합효소연쇄반응 (PCR)을 실시하는 단계; 및  (b) carrying out PCR using the separated DNA as a template and using the primer and probe set of the present invention; And
(c) 상기 중합효소연쇄반웅으로 증폭된 산물을 통해， RAS/BRAF 돌연변이 유 전자를 검출하는 단계를 포함하는 RAS/BRAF 유전자 돌연변이 검출 방법을 제공한 다. 다른 정의가 없는 한， 본 명세서에 사용된 모든 기술적 및 과학적 용어는 당 업자들에 의해 통상적으로 이해되는 동일한 의미를 가진다. 다음의 참고문헌은 본 발명의 명세서에 사용된 여러 용어들의 일반적인 정의를 갖는 기술 (ski l l )의 하나 를 제공한다: Singleton et al . , DICTIONARY OF MICROBIOLOGY AND MOLECULAR BI0L0TY(2th ed. 1994)； THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHN0L0GY(Walkered. , 1988)； 및 Hale & Marh m, THE HARPER COLLINS DICTIONARY OF BIOLOGY. 이하본 발명을 상세히 설명한다. 본 발명의 일양태에서는 i ) 서열번호 1의 정방향 프라이머, 서열번호 2의 역방향 프라이머 및 서열번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로 브의 폴리뉴클레오티드 세트; ii ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역 방향 프라이머， 서열번호 3의 정방향 프라이머， 서열번호 4의 역방향 프라이머 및 서열번호 25 내지 서열번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티 드 세트; 및 iii ) 서열번호 5의 정방향 프라이머， 서열번호 6의 역방향 프라이머 및 서열번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오 티드 세트; 로 이루어진 군에서 선택된 세트를 유효성분으로 포함하는 RAS/BRAF 돌 연변이 검출용 프라이머 및 프로브 세트 조성물을 제공한다. (c) detecting a RAS / BRAF mutation gene through a product amplified by the polymerase chain reaction. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of skill in the art. The following references provide one of the techniques with a general definition of several terms used in the specification of the present invention: Singleton et al. , DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY (2nd ed., 1994), THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (1988), and Hale & Marhm, THE HARPER COLLINS DICTIONARY OF BIOLOGY. Hereinafter, the present invention will be described in detail. I) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2 and the probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24; ii) a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 An orientation primer, a forward primer of SEQ ID NO: 3, a reverse primer of SEQ ID NO: 4, and a polynucleotide set of a probe selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27; And iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; And a primer set and a probe set composition for detecting RAS / BRAF mutation.
본 발명의 다른 양태에서는 i ) 서열번호 1의 정방향 프라이머， 서열번호 2 의 역방향 프라이머 및 서열번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; ii ) 서열번호 1의 정방향 프라이머, 서열번호 2 의 역방향 프라이머， 서열번호 3의 정방향 프라이머, 서열번호 4의 역방향 프라이 머 및 서열번호 25 내지 서열번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클 레오티드 세트; 및 iii ) 서열번호 5의 정방향 프라이머， 서열번호 6의 역방향 프라 이머 및 서열번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리 뉴클레오티드 세트; 로 이루어진 군에서 선택된 세트를 유효성분으로 구성되는 RAS/BRAF돌연변이 검출용 프라이머 및 프로브 세트 조성물을 제공한다.  I) a polynucleotide set of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24; ii) a polynucleotide set of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: ; And iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; A primer set for RAS / BRAF mutation detection and a probe set composition comprising a set selected from the group consisting of SEQ ID NO:
본 발명의 또 다른 양태에서는 i ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역방향 프라이머 및 서열번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로브의 폴라뉴클레오티드 세트; ii ) 서열번호 1의 정방향 프라이머， 서열번호 2 의 역방향 프라이머, 서열번호 3의 정방향 프라이머， 서열번호 4의 역방향 프라이 머 및 서열번호 25 내지 서열번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클 레오티드 세트; 및 iii ) 서열번호 5의 정방향 프라이머， 서열번호 6의 역방향 프라 이머 및 서열번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리 뉴클레오티드 세트; 로 이루어진 군에서 선택된 세트를 유효성분으로 필수적으로 구성되는 RAS/BRAF돌연변이 검출용 프라이머 및 프로브 세트 조성물을 제공한다. 상기 조성물은 i ) 서열번호 7의 정방향 프라이머， 서열번호 8의 역방향 프 라이머 및 서열번호 34 내지 서열번호 36으로 이루어진 군에서 선택된 프로브의 폴 리뉴클레오티드 세트; 및 ii ) 서열번호 9의 정방향 프라이머, 서열번호 10의 역방 향 프라이머， 서열번호 11의 정방향 프라이머， 서열번호 12의 역방향 프라이머 및 서열번호 37 내지 서열번호 42으로 이루어진 군에서 선택된 프로브의 폴리뉴클로에 티드 세트;로 이루어진 군에서 선택된 세트를 유효성분으로 추가포함할 수 있다. 또한， 상기 조성물은 서열번호 13의 정방향 프라이머， 서열번호 14의 역방향 프라이머， 서열번호 15의 정방향 프라이머， 서열번호 16의 역방향 프라이머 및 서 열번호 43 내지 서열번호 46으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티 드 세트를 유효성분으로 추가포함할 수 있다. 본 발명의 조성물은 바람직하게는 RAS 또는 BRAF 약물에 대한 치료 반응성 (responsiveness) 예측을 위한 것일 수 있다. RAS 또는 BRAF는 EGFR 하류 이펙터이 고， 항 -EGFR 단클론항체의 치료효과 대한 1차 저항의 마커이다. RAS 또는 BRAF는 전이성 대장직장암 (colorectal cancer , CRC)환자의 치료의 최적화에 대해 상당한 영향력을 가진다. 대장직장암의 약 50~60 퍼센트가 RAS 또는 BRAF 유전자의 돌연변 이를 발현하고 있으며 이들 환자는 항 -EGFR 치료 요법에 대한 효과를 얻지 못한다. 현재 임상 실시에서 항 -EGFR 치료법 사용이 고려되는 모든 CRC 환자는 RAS .및 BRAF 유전자 변이 확인을 위한 검사가 수행되어야 하며， RAS 또는 BRAF 돌연변이가 검출 된다면 환자는 세툭시맙 또는 파니투무맙 (pani tumumab) 치료로부터 배제되어야만 한다. I) a polynucleotide set of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24; ii) a polynucleotide set of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: ; And iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; A primer set for RAS / BRAF mutation detection and a probe set composition consisting essentially of a set selected from the group consisting of RAS / BRAF mutants. Said composition comprising: i) a set of polynucleotides of a forward primer of SEQ ID NO: 7, a reverse primer of SEQ ID NO: 8 and a probe selected from the group consisting of SEQ ID NO: 34 to SEQ ID NO: 36; And ii) a primer selected from the group consisting of the forward primer of SEQ ID NO: 9, the reverse primer of SEQ ID NO: 10, the forward primer of SEQ ID NO: 11, the reverse primer of SEQ ID NO: 12, and the polynucleotide A set selected from the group consisting of: < RTI ID = 0.0 > a < / RTI > Also, the composition comprises a forward primer of SEQ ID NO: 13, an inverted primer of SEQ ID NO: 14, a forward primer of SEQ ID NO: 15, an inverted primer of SEQ ID NO: 16 and a polynucleotide of a probe selected from the group consisting of SEQ ID NOS: 43 to 46 A clotid set can be added as an active ingredient. The compositions of the invention may preferably be for predicting the responsiveness of the treatment to RAS or BRAF drugs. RAS or BRAF is an EGFR downstream effector and is the primary resistance marker for the therapeutic effect of anti-EGFR mAb. RAS or BRAF have a significant impact on the optimization of treatment for patients with metastatic colorectal cancer (CRC). Approximately 50 to 60 percent of colorectal cancers develop a mutation in the RAS or BRAF gene, and these patients do not benefit from anti - EGFR therapy. All CRC patients who are considered to be using anti-EGFR therapy in current clinical practice should be tested for RAS. And BRAF mutation detection and if RAS or BRAF mutation is detected, the patient should be treated with cetuximab or pani tumumab ) Treatment.
상기 항 -EGFR 치료요법은 바람직하게는 세룩시맙 또는 파니투무맙， 베무라페 닙 (Vemurafenib) 또는 다브라페닙 (Dabrafenib) 일 수 있으나 이에 제한되는 것은 아니다. 본 발명에서 "치료 반응성 "은 암의 성장률이 치료제와 접촉하지 않은 경우의 성장과 비교해서 치료제와 접촉한 결과로서 억제된다면 치료제에 대해서 "반응성" 이라고 정의할 수 있다. 암의 성장률이 치료제와 접촉하지 않은 경우의 성장과 비 교해서 치료제와 접촉한 결과로서 매우 낮은 정도로 억제되거나 억제되지 않는다면 치료제에 대해서 "비반웅성"이라고 정의할 수 있다. 암의 성장은 종양의 크기 또는 그 종양 유형에 적합한 종양 마커의 발현을 측정하는 방법 등 다양한 방식으로 측 정될 수 있다. 또한 상기 "반웅성' '에는 유의미한 생존곡선상의 생존시기의 증가를 나타낼 수 있으며, "비반웅성' '의 척도는 환자의 삶의 질， 전이도 등을 비롯하여 종 양의 성장크기를 넘는 추가의 기준을 이용해서 평가될 수 있다.  The anti-EGFR therapies may preferably be, but are not limited to, cerulcim or panitumum, Vemurafenib or Dabrafenib. In the present invention, " therapeutically responsive " can be defined as " responsive " to a therapeutic agent if the growth rate of the cancer is inhibited as a result of contact with the therapeutic agent as compared to growth in the absence of the therapeutic agent. If the growth rate of cancer is not suppressed or suppressed to a very low extent as a result of contact with the therapeutic agent compared to growth without contact with the therapeutic agent, it can be defined as " non-bioagonistic " The growth of cancer can be measured in a variety of ways, including by measuring the size of the tumor or the expression of tumor markers that are appropriate for the tumor type. In addition, the above-mentioned " antinomy " may indicate an increase in the survival time on a significant survival curve, and the " non-hepatobiliary " scale may include an additional criterion . ≪ / RTI >
암 치료제에 대한 치료 반응성으로 EGFR 저해제에 대한 치료 반웅성일 수 있 으며， 이에 따라 본 발명의 암은 췌장암， 두경부암， 대장암， 비소세포성 폐암 일 수 있으나 이에 제한되는 것은 아니다. 본 발명에서 "프라이머"는 올리고뉴클레오타이드를 의미하는 것으로， 핵산쇄 (주형)에 상보적인 프라이머 연장 산물의 합성이 유도되는 조건， 즉, 뉴클레오타이 드와 DNA 중합효소와 같은 중합제의 존재, 그리고 적합한 온도와 pH의 조건에서 합 성의 개시점으로 작용할 수 있다. 바람직하게는， 프라이머는 디옥시리보뉴클레오타 이드이며 단일쇄이다. 본 발명에서 이용되는 프라이머는 자연 (natural ly occurr ing) d MP (즉， dAMP, dGMP, dCMP 및 dTMP) , 변형 뉴클레오타이드 또는 비-자 연 뉴클레오타이드를 포함할 수 있다. 또한, 프라이머는 리보뉴클레오타이드도 포 함할 수 있다. 프라이머는, 중합제의 존재 하에서 연장 산물의 합성을 프라이밍시킬 수 있 을 정도로 층분히 길어야 한다. 프라이머의 적합한 길이는 다수의 요소， 예컨대， 온도， 응용분야 및 프라이머의 소스 (source)에 따라 결정되지만 전형적으로 15-30 뉴클레오타이드이다. 짧은 프라이머 분자는 주형과 층분히 안정된 흔성 복합체를 형성하기 위하여 일반적으로 보다 낮은 온도를 요구한다. 용어 "어닐링" 또는 "프 라이 ¾ "은 주형 핵산에 올리고디옥시뉴클레오타이드 또는 핵산이 병치 (apposi t ion) 되는 것을 의미하며， 상기 병치는 중합효소가 뉴클레오타이드를 중합시켜 주형 핵 산또는 그의 일부분에 상보적인 핵산 분자를 형성하게 한다. 본 발명에서 "프로브"는 정량적 PCR에 이용되는 taqman probe의 일종으로 디 자인된 것이다. 바람직하게는 프로브에는 형광 물질 (HEX, VIC, FAM dye)를 부착하 였으며， 모든 프로브의 3 '쪽에는 퀀쳐 (quencher )로 BHQ1이 이용될 수 있다. TaqMan probe는 일반적으로 5 ' 말단을 형광 물질로， 3 ' 말단을 quencher 물질로 tagging한 ol igonucleot ide0! 1^ , TaqMan probe는 anneal ing step에서 template DNA에 특이적 으로 hybridizat ion하지만， probe의 3 ' 말단에 quencher가 있기 때문에 빛을 주어 도 형광을 발하지 못하지만， 다음 과정인 extension step에서 Taq DNA polymerase 가 가지고 있는 5 '→3 ' exonuc lease 활성에 의해， 주형에 hybr idi zat ion한 TaqMan probe가 분해되면 형광물질이 probe로부터 분리되어 quencher에 의한 억제가 해제 되고 형광을 발하게 되는 원리에 의해서 PCR 반응에 따른 형광이 정량적으로 발하 게 된다. 본 발명에서 프로브는 형광물질과 결합되어 있는 것을 특징으로 하며， 보다 바람직하게는 HEX(hexachlorof luorescein) , FAM( f luorescein amidi te) , EverGreen 형광염료가 결합되는 것을 특징으로 한다. The cancer of the present invention may be, but not limited to, pancreatic cancer, head and neck cancer, colon cancer, non-small cell lung cancer, and the treatment response to cancer treatment agent may be therapeutic response to EGFR inhibitor. The term " primer " in the present invention means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerase such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis at appropriate temperature and pH conditions. Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include natural ly occurring d MP (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, primers may also include ribonucleotides. The primer should be long enough to allow priming of the elongation product in the presence of the polymerizer. The suitable length of the primer is determined by a number of factors, such as the temperature, the application, and the source of the primer, but is typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form a stable, stationary complex with the template. The term " annealing " or " prism " means that the oligodeoxynucleotide or nucleic acid is apposited to the template nucleic acid, which polymerizes the nucleotide to polymerize the template nucleic acid, To form nucleic acid molecules. In the present invention, " probe " is a kind of taqman probe used for quantitative PCR. Preferably, a fluorescent material (HEX, VIC, FAM dye) is attached to the probe, and BHQ1 can be used as a quencher on the 3 'side of all the probes. TaqMan probe is generally the 5 'end with a fluorophore and 3' ends with the one tagging material quencher ol igonucleot ide 0! The TaqMan probe does not produce fluorescence even when light is applied due to the presence of a quencher at the 3 'end of the probe. However, Taq DNA polymerase in the following extension step When the TaqMan probe is cleaved by the 5 '→ 3' exonuc lease activity on the template, the fluorescent substance is separated from the probe and the inhibition by the quencher is released and the fluorescence is emitted. Is quantitatively released. In the present invention, the probe is characterized by being bonded to a fluorescent material, more preferably HEX (hexachlorofluorescein), FAM (fluorescein amidi te), EverGreen And the fluorescent dye is bonded.
구체적으로 프로브에 FAM, HEX 형광염료 (형광물질) 또는 EvaGreen 형광염료 가 결합된 형태를 사용하였으므로 이들에 대한 형광을 측정하는 것에 의해서 수행 될 수 있다. 이와 같은 과정은 상용의 검출장치 (예를 들어， biorad사의 Droplet Reader)에 의해서 수행될 수 있으며， 해당 장치내에서 각각의 샘플의 droplet 형광 신호를 각각 감지 및 posi t ive와 negat ive droplet의 수를 세어 자동으로 분석까지 완료될 수 있다.  Specifically, since the probe is combined with FAM, HEX fluorescent dye (fluorescent substance) or EvaGreen fluorescent dye, it can be performed by measuring fluorescence thereon. This process can be performed by a commercially available detector (for example, Droplet Reader from biorad), which detects the droplet fluorescence signal of each sample in the corresponding instrument and calculates the number of positive and negative droplets Counting can be completed automatically by analysis.
이 때 검출을 위해서 PCR 반응 용액에 첨가되는 프로브 및 표준 PCR 반응 용 액에 첨가되는 프로브는 각각 상이한 형광물질과 결합되어 있을 수 있다. 본 발명의 일 양태는 본 발명의 프라이머 및 프로브 세트를 포함하는 RAS/BRAF 유전자 돌연변이 검출용 키트를 제공한다.  At this time, probes to be added to the PCR reaction solution and probes to be added to the standard PCR reaction solution for detection may be respectively associated with different fluorescent materials. One aspect of the present invention provides a kit for detecting RAS / BRAF gene mutation comprising a primer and a probe set of the present invention.
본 발명의 다른 양태는 본 발명의 프라이머 및 프로브 세트로 구성되는 RAS/BRAF 유전자돌연변이 검출융 키트를 제공한다.  Another aspect of the present invention provides a RAS / BRAF gene mutation detection fusion kit comprising the primer and the probe set of the present invention.
본 발명의 또 다른 양태는 본 발명의 프라이머 및 프로브 세트로 필수적으로 구성되는 RAS/BRAF유전자 돌연변이 검출용 키트를 제공한다. 본 발명의 상기. 키트는 background(noise)를 줄이기 위해 돌연변이 위치에 상응하는 서열을 이용하여 돌연변이 검출용 프로브가 non— speci f ic 하게 binding 하지 못하도록 디자인 한 ol igomer(blocker)를 추가적으로 포함하는 것을 특징으로 한다. 본 발명의 키트는 바람직하게는 본 발명의 프라이머 /프로브 세트를 이용한 PCR 반응에 의한 RAS/BRAF의 돌연변이의 검출에 이용될 수 있다. 본 발명의 키트는 PCR 이나 이의 검출에 사용되는 당 업계에 공지된 도구 및 /또는 시약을 추가로 포 함할 수 있다. 본 발명의 키트는 필요에 따라 각 성분들을 흔합하는데 사용될 튜 브， 웰 폴레이트， 사용방법을 기재한지시자료 등을 추가로 포함할 수 있다. 아울러, 본 발명의 키트는 RU0(research use only) 또는 IVD( in vitro diagnost ics) 키트일 수 있다. IVD 키트에는 IVD_CDx( in vi tro companion diagnost ics) 키트도 포함된다. 본 발명의 키트는 qPCR (quant i tat ive PCR) 또는 droplet digi tal PCR 방법 에 사용되는 것이다. 본 발명의 키트에 적용 가능한 주형은 RAS/BRAF의 돌연변이 검출이 필요하 며， PCR 반응이 가능한 것이라면 제한 없이 사용될 수 있으나, 바람직하게는 혈액 에서 분리된 무세포 DNA(cel l-free DNA, cfDNA) , 순환종양세포 (circulat ing tumor cel l , CTC)로부터 유래된 ctDNA (circulat ing tumor DNA) 또는 포르말린 고정 파라 핀 포매 (formal in f ixed paraff in embedded. FFPE) 조직에서 분리된 DNA 또는 상기 조직 유래의 NA로부터 역전사 반응에 의해 합성된 cDNA( complementary DNA)를 주 형으로 하는 것을 특징으로 한다. 인간 혈장에서 순환하는 cfDNA는 염증성 장애， 산화 스트레스 및 악성 종양 등의 다양한 생리학적 및 병리학적 병태들에서 연구되고 있다. cfDNA의 혈류 방출 과 관련된 정확한 기전은 불확실하지만， 아마도 세포자살， 세포괴사 및 세포로부터 의 능동적인 방출이 종합적으로 작용하는 것으로 보인다. 혈관을 통해 순환하는 cfDNA는 잠재적으로 유용한 바이오마커이다. DNA 수준과 단편화 패턴은 진단 및 예 후 예측 목적으로 홍미로운 가능성을 제시한다. 특히 환자의 혈액에서 간단히 검출 할 수 있다는 점에서 삶의 질을 크게 훼손하지 않고 간편하고 신속하게 바이오마커 를 검출할 수 있다는 유용성이 있다. 아울러， 본 발명의 키트는 혈액에서 분리된 CKXci rculat ing tumor cel l )에 서 분리된 DNA 또는 상기 CTC 유래의 R A로부터 역전사 반응에 의해 합성된 cDNA를 주형으로 할 수 있다. CTC는 악성 종양 환자의 말초혈액에서 발견되는 종양세포이 다. CTC가 암전이 과정에서 중요한 역할을 하기 때문에 CTC는 암의 연구， 진단 등 에 있어서 매우 중요하게 여겨지고 있으나， 말초혈액 내 순환종양세포 존재 수가 매우 드물어， 수백만 개 이상의 정상 혈구세포에 섞여 있는 수십 개 이하의 종양세 포를 검출할수 있는 정도의 민감도가요구되는 검출 시스템이 필요하다. 생검 후 환자에게서 얻은 조직은 통상적으로 포르말린 (포름알데히드) 등에 의해서 고정화한다. 고정화한 생물학적 샘플은 일반적으로 탈수시키고， 파라핀 등 의 고체 지지체에 포매하며 , 이렇게 제조된 시료를 FFPE 시료라고 한다. FFPE 시료 상의 핵산， 특히 DNA는 고정된 세포에 존재하고， 단편화 되어 있거나 포르말린에 의해 교차 결합되어 있으므로 파라핀을 제거하고 고정된 세포를 용해하여 DNA를 비 롯한 핵산을 세포 내에서 용출시킬 필요가 있다. 본 발명에 있어서 용어 '파라핀'은 형태학적， 면역조직화학적 및 효소조직화 학적인 해석을 포함하는 모든 해석에 있어서 사용되는 생체시료의 포매 매체를 포 괄적으로 말하는 것이다. 즉， 본 발명에 있어서의 파라핀은 석유계 파라핀 왁스 단 체 (單體)여도 되고， 당해 석유계 파라핀 왁스를 기제 (基齊 로 하여， 포매 매체의 품질향상 등의 목적으로 첨가될 수 있는 모든 다른 성분을 포함한 것이어도 된다. 여기서, 석유계 파라핀 왁스는 석유에 유래하는 상온에서 고형인 탄화수소류의 흔 합물을 말한다. · 일반적으로 FFPE 처리된 암 환자의 검체 시료를 회전식 미세톱 (rotary microtome)으로 5~10 μ πι 의 두께로 절단한 다음 상용의 FFPE 용 핵산 분리 키트 또 는 이를 활용하는 장치를 퉁해 DNA를 포함하는 핵산을 분리할 수 있다. FFPE에서 핵산을 분리하는 키트 /장치는 예를 들어 지멘스사의 Ti ssue Preparat ion System 및 이와 관련된 시약 (VERSANT t issue preparat ion reagents)을 들 수 있다. 본 발명의 시료에서 분리되는 핵산은 바람직하게는 게놈 DNA이며， 더 바람직 하게는 돌연변이를 보유하고 있을 것으로 추정되는 게놈 DNA이다. 본 발명의 조성물 또는 키트는 바람직하게는 자동화 또는 반자동화된 방법의 RAS/BRAF 돌연변이 검출에 이용될 수 있다. 상기에서 자동화는 샘플 (시료)의 투입; 추출， 분리， 반웅이 완료된 기재 (예를 들어, 튜브， 플레이트)의 재배치 또는 이동; 시약， 버퍼의 스톡 (stock)에의 투입， 보층; 장비의 유지관리를 제외한 전부 또는 대부분 과정이 인간 이외의 수단 (예를 들어， 로봇)을 통해서 이루어지는 것을 의미 한다. 참고로， 상기에서 언급한 뉴클레오티드 작업에는 다음의 문헌을 참조할 수 있다 (Maniat is et al . , Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor , N.Y. (1982)； Sambrook et al . , Molecular Cloning: A Laboratory Manual , 2d Ed. , Cold Spring Harbor Laboratory Press(1989)； Deutscher , M. , Guide to Protein Puri f icat ion Methods Enzymology, vol . 182. Academic Press . Inc. , San Diego, CA(1990)； Ausubel et al . , Current Protocols of Molecul r Biology, John Wi ley and Sons (1997)； Rupp and Locker , Lab Invest . 56： A67(1987) ; De Andres et al . , BioTechniques 18: 42044(1995)； Held et al . , Genome Research 6:986-994(1996)； T.E. Godfrey et al . J . Molec . Diagnost ics 2： 84-91(2000)； K. Specht et al . , Am. J . Pathol . 158： 419- 29(2001) ) . 본 발명의 일 양태는 i ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역방 향 프라이머 및 서열번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; Π ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역방향 프라이머， 서열번호 3의 정방향 프라이머, 서열번호 4의 역방향 프라이머 및 서열 번호 25 내지 서열번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 및 iii ) 서열번호 5의 정방향 프라이머, 서열번호 6의 역방향 프라이머 및 서 열번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티 드 세트; 로 이루어진 군에서 선택된 세트를 유효성분으로 포함하는 RAS/BRAF 돌연 변이 검출용 키트를 제공한다. Another aspect of the present invention provides a kit for detecting RAS / BRAF gene mutation, which is essentially composed of the primer and the probe set of the present invention. Lt; / RTI & gt ; The kit also features an oligomer (blocker) designed to prevent non-specifi- cally binding probes for mutation detection using a sequence corresponding to the mutation site to reduce background noise. The kit of the present invention can preferably be used for the detection of mutations of RAS / BRAF by PCR reaction using the primer / probe set of the present invention. The kit of the present invention may further comprise tools and / or reagents known in the art used for PCR or detection thereof. The kit of the present invention may further include tubes, well plates, instructions for describing how to use, and the like to be used to fuse each component as needed. In addition, the kit of the present invention may be a research use only (RUO) or an in vitro diagnostic kit (IVD) kit. The IVD kit also includes the IVD_CDx (in vitro companion diagnostics) kit. The kit of the present invention is used in a qPCR (quantitative tat ive PCR) or a droplet digital PCR method. The template applicable to the kit of the present invention can be used without restriction as long as mutation detection of RAS / BRAF is necessary and PCR reaction is possible. Preferably, the template is a cell-free DNA (cfDNA) , DNA isolated from ctDNA (circulat ing tumor DNA) or formalin fixed paraffin embedded (FFPE) tissue derived from circulating tumor cells (CTC) (Complementary DNA) synthesized by reverse transcription from NA is used as a template. CfDNA circulating in human plasma has been studied in a variety of physiological and pathological conditions such as inflammatory disorders, oxidative stress and malignant tumors. The precise mechanism involved in the release of cfDNA into the bloodstream is unclear, but seems likely to be a synergistic effect of apoptosis, cellular necrosis and active release from cells. CfDNA circulating through blood vessels is a potentially useful biomarker. DNA levels and fragmentation patterns suggest promising possibilities for diagnosis and prediction. In particular, the biomarker can be detected easily and rapidly without deteriorating the quality of life because the biomarker can be easily detected from the patient's blood. In addition, the kit of the present invention can be used as a template for DNA isolated from blood-separated CKX cycling tumor cells or cDNA synthesized by reverse transcription from RA derived from CTC. CTC is a tumor cell found in the peripheral blood of a malignant tumor patient. Because CTC plays an important role in the process of metastasis, CTC is considered to be crucial in the study and diagnosis of cancer, but the number of circulating tumor cells in the peripheral blood is very rare, and dozens or fewer A need exists for a detection system that requires a degree of sensitivity to detect tumor cells of the tumor. The tissue obtained from the patient after biopsy is usually fixed with formalin (formaldehyde) or the like. The immobilized biological sample is generally dehydrated and embedded in a solid support such as paraffin, and the sample thus prepared is called an FFPE sample. Nucleic acids, particularly DNA, on the FFPE sample are present in immobilized cells and are either fragmented , It is necessary to remove the paraffin and dissolve the fixed cells to elute the DNA-containing nucleic acid in the cells. The term " paraffin " in the present invention refers to the embedding medium of a biological sample used in all interpretations including morphological, immunohistochemical and enzymatic histochemical analysis. That is, the paraffin in the present invention may be a petroleum-based paraffin wax, and may be any one selected from the group consisting of all kinds of petroleum-based paraffin waxes (for example, Petroleum-based paraffin wax refers to a mixture of hydrocarbons that are solid at room temperature and derived from petroleum. In general, samples of cancer patients treated with FFPE are mixed with a rotary microtome After cutting to a thickness of 5 to 10 μπι, the nucleic acid containing DNA can be isolated from commercial FFPE nucleic acid separation kits or devices utilizing it. Kits / devices for separating nucleic acids from FFPE are, for example, The Ti ssue preparation system of Siemens, and VERSANT t issue preparation reagents. The nucleic acid separated from the sample of the present invention preferably contains a genomic DNA The composition or kit of the present invention can be preferably used for RAS / BRAF mutation detection of an automated or semi-automated method. (Eg, tubes, plates); the loading of reagents, buffers into stocks, laminates; all or part of the equipment except for the maintenance of the equipment; Most processes are performed by means other than human (for example, a robot). For reference, the above-mentioned nucleotide work can be referred to the following documents (Maniat is et al., Molecular Cloning: A (1982); Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed. , ≪ / RTI > Guide to Protein Purification < RTI ID = 0.0 > ion Methods Enzymology, vol. 182. Academic Press. Inc. , San Diego, CA (1990); Ausubel et al. , Current Protocols in Molecular Biology, John Wiley and Sons (1997); Rupp and Locker, Lab Invest. 56: A67 (1987); De Andres et al. , BioTechniques 18: 42044 (1995); Held et al. , Genome Research 6: 986-994 (1996); TE Godfrey et al. J. Molec. Diagnostics 2: 84-91 (2000); K. Specht et al. , Am. J. Pathol. 158: 419-29 (2001)). One embodiment of the present invention is a kit comprising: i) a set of polynucleotides of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2, and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24; A set of polynucleotides of the probe selected from the group consisting of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4, and the SEQ ID NO: 25 to SEQ ID NO: 27; And iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; And a set selected from the group consisting of RAS / BRAF mutation detection kit as an active ingredient.
본 발명의 다른 양태는 i ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역 방향 프라이머 및 서열번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로브 의 폴리뉴클레오티드 세트; Π ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역방 향 프라이머， 서열번호 3의 정방향 프라이머， 서열번호 4의 역방향 프라이머 및 서 열번호 25 내지 서열번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 및 iii ) 서열번호 5의 정방향 프라이머， 서열번호 6의 역방향 프라이머 및 서 열번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티 드 세트; 로 이루어진 군에서 선택된 세트를 유효성분으로 구성되는 RAS/BRAF 돌연 변이 검출용 키트를 제공한다.  I) a set of polynucleotides of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2, and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24; Π) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27; And iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; And a kit for detecting RAS / BRAF mutation in which the selected set is an active ingredient.
본 발명의 또 다른 양태는 i ) 서열번호 1의 정방향 프라이머 , 서열번호 2의 역방향 프라이머 및 서열번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로 브의 폴리뉴클레오티드 세트; ii ) 서열번호 1의 정방향 프라이머, 서열번호 2의 역 방향 프라이머， 서열번호 3의 정방향 프라이머， 서열번호 4의 역방향 프라이머 및 서열번호 25 내지 서열번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티 드 세트; 및 iii) 서열번호 5의 정방향 프라이머, 서열번호 6의 역방향 프라이머 및 서열번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오 티드 세트; 로 이루어진 군에서 선택된 세트를 유효성분으로 필수적으로 구성되는Another embodiment of the present invention is a kit comprising: i) a set of polynucleotides of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2, and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24; ii) the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4, and the polynucleotide of the probe selected from the group consisting of SEQ ID NO: set; And iii) the forward primer of SEQ ID NO: 5, the reverse primer of SEQ ID NO: 6, and the polynucleotide of the probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: TED set; Lt; RTI ID = 0.0 > constituent < / RTI > consisting essentially of the active ingredient
RAS/BRAF 돌연변이 검출용 키트를 제공한다. 상기 키트는 i ) 서열번호 7의 정방향 프라이머， 서열번호 8의 역방향 프라 이머 및 서열번호 34 내지 서열번호 36으로 이루어진 군에서 선택된 프로브의 폴리 뉴클레오티드 세트; 및 ii ) 서열번호 9의 정방향 프라이머， 서열번호 10의 역방향 프라이머, 서열번호 11의 정방향 프라이머， 서열번호 12의 역방향 프라이머 및 서 열번호 37 내지 서열번호 42으로 이루어진 군에서 선택된 프로브의 폴리뉴클로에티 드 세트;로 이루어진 군에서 선택된 세트를 유효성분으로 추가포함할 수 있다. 또한， 상기 키트는 서열번호 13의 정방향 프라이머， 서열번호 14의 역방향 프라이머， 서열번호 15의 정방향 프라이머, 서열번호 16의 역방향 프라이머 및 서 열번호 43 내지 서열번호 46으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티 드 세트를 유효성분으로 추가포함할 수 있다. 또한， 본 발명은 RAS/BRAF 돌연변이 검출용 제제를 제조하기 위한 폴리 뉴클 레오티드 세트의 용도를 제공한다. A kit for detecting RAS / BRAF mutation is provided. Said kit comprising: i) a polynucleotide set of a forward primer of SEQ ID NO: 7, an inverse primer of SEQ ID NO: 8, and a probe selected from the group consisting of SEQ ID NO: 34 to SEQ ID NO: 36; And ii) a primer selected from the group consisting of the forward primer of SEQ ID NO: 9, the reverse primer of SEQ ID NO: 10, the forward primer of SEQ ID NO: 11, the reverse primer of SEQ ID NO: 12, A set selected from the group consisting of: The kit also comprises a forward primer of SEQ ID NO: 13, an inverted primer of SEQ ID NO: 14, a forward primer of SEQ ID NO: 15, a reverse primer of SEQ ID NO: 16 and a polynucleotide of a probe selected from the group consisting of SEQ ID NOS: A clotid set can be added as an active ingredient. In addition, the present invention provides the use of a set of polynucleotides for producing a preparation for RAS / BRAF mutation detection.
바람직하게는， RAS/BRAF 돌연변이 검출용 제제를 제조하기 위한 하기 i ) 내 지 i i i )으로 이루어진 군에서 선택된 폴리 뉴클레오티드 세트의 용도를 제공한다. i ) 서열번호 1의 정방향 프라이머, 서열번호 2의 역방향 프라이머 및 서열 번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트;  Preferably, the use of a set of polynucleotides selected from the group consisting of i) i) i) for producing a preparation for detecting RAS / BRAF mutation is provided. i) a polynucleotide set of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24;
ii ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역방향 프라이머， 서열번 호 3의 정방향 프라이머， 서열번호 4의 역방향 프라이머 및 서열번호 25 내지 서열 번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 및  ii) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27; And
iii ) 서열번호 5의 정방향 프라이머， 서열번호 6의 역방향 프라이머 및 서열 번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트. 본 발명의 다른 목적을 달성하기 위하여，  iii) the polynucleotide set of the forward primer of SEQ ID NO: 5, the reverse primer of SEQ ID NO: 6, and the probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: In order to achieve another object of the present invention,
(a) 시료에서 DNA를 분리하는 단계 ;  (a) separating DNA from a sample;
(b) 상기 분리된 DNA를 주형으로 하고 본 발명의 프라이머 및 프로브 세트를 이용하여 중합효소연쇄반응 (PCR)을 실시하는 단계; 및 (b) Using the separated DNA as a template, the primer and the probe set of the present invention (PCR) using the primers; And
(c) 상기 중합효소연쇄반응으로 증폭된 산물을 통해， RAS/BRAF 돌연변이 유 전자를 검출하는 단계를 포함하는 RAS/BRAF 유전자 돌연변이 검출 방법을 제공한 다. 본 발명의 상기 '시료' 는 혈액 및 생물학적 기원의 기타 액상 시료， 생검 표본， 조직 배양과 같은 고형 조직 시료 또는 이로부터 유래된 세포가 포함된다. 보다 구체적으로 예를 들면 이에 한정되지는 않으나 조직， 추출물, 세포 용해물, 전혈， 혈장， 혈청, 침, 안구액， 뇌척수액， 땀， 뇨， 젖, 복수액, 활액， 복막액 등일 수 있다. 상기 시료는 동물， 바람직하게는 포유동물로부터 수득될 수 있으며， 가장 바람직하게는 인간으로부터 수득될 수 있다. 또한 상기 시료는 검출에 사용하기 전 에 전처리할 수 있다. 예를 들어， 여과， 증류, 추출， 농축， 방해 성분의 불활성화 , 시약의 첨가 등을 포함할 수 있다. 바람직하게는 환자로부터 획득한 CTC, cfDNA, 혈액， FFPE( formal in f ixed paraf f in embedded) , 신선한 표본 (fresh sample) 등일 수 있으며， 가장 바람직하게는 환자로부터 획득한 조직, 혈액 또는 FFPE( formal in f ixed paraf f in embedded)일 수 있고， 전술한 바와 같이 상기 시료로부터 게놈 DNA 또는 돌연변이를 보유하고 있을 것으로 추정되는 DNA를 분리하여 RAS/BRAF 유전자 돌연변이 검출에 사용할 수 있다. 본 발명의 용어 '〜을 포함하는 (compr i sing) ' 이란 '함유하는' 또는 '특징 으로 하는' 과 동일하게 사용되며， 조성물 또는 방법에 있어서， 언급되지 않은 추 가적인 성분 요소 또는 방법 단계 등을 배제하지 않는다. 용어 '〜로 구성되는 (consi st ing of )' 이란 별도로 기재되지 않은 추가적인 요소， 단계 또는 성분 등을 계외하는 것을 의미한다. 용어 '필수적으로 구성되는 (consi st ing essent ial ly of ) ' 이란 조성물 또는 방법의 범위에 있어서, 기재된 성분 요소 또는 단계와 더불어 이의 기본적인 특성에 실질적으로 영향을 미치지 않는 성분 요소 또는 단계 등을 포함하는 것을 의미한다.  (c) detecting the RAS / BRAF mutation gene through the product amplified by the polymerase chain reaction. The "sample" of the present invention includes blood and other liquid samples of biologic origin, biopsy specimens, solid tissue samples such as tissue culture, or cells derived therefrom. More specifically, it may be a tissue, an extract, a cell lysate, a whole blood, a plasma, a serum, a saliva, an ophthalmic solution, a cerebrospinal fluid, a sweat, a urine, a milk, a plural liquid, a synovial fluid, a peritoneal fluid and the like. The sample can be obtained from an animal, preferably a mammal, and most preferably from a human. The sample can also be pretreated prior to use in detection. For example, it may include filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, and the like. Preferably CTC, cfDNA, blood, FFPE, fresh sample, etc. obtained from the patient, and most preferably the tissue, blood or FFPE obtained from the patient in f ixed paraf f in embedded) and can be used to detect RAS / BRAF gene mutations by isolating DNA that is presumed to have genomic DNA or mutations from the sample as described above. The term "compr i sing" of the present invention is used in the same way as "contains" or "to characterize" and is used in the composition or method to refer to additional component elements or method steps not mentioned . The term " consisting of " means to exclude additional elements, steps or components not otherwise mentioned. The term " consis- tent ingredient of the term " as used herein is intended to encompass a range of components or steps, including component elements or steps, which do not materially affect its underlying properties, .
【유리한 효과】 【Advantageous effect】
따라서, 본 발명은 RAS/BRAF 돌연변이 검출용 프라이머 및 프로브 세트 조성 물과 이를 포함하는 키트를 제공한다. 본 발명의 방법은 암 환자 예후의 치료제에 대한 반응성 예측， 진단뿐만 아니라 암의 전이 또는 재발에 대한 예측이 가능하므 로 항암치료제의 투여 필요성 판단을 비롯하여 향후 치료의 방향에 대한 단서를 제 시하는 목적 및 암의 전이 또는 재발에 대한 모니터링 하는 데에 유용하게 이용될 수 있다. Thus, the present invention provides a primer and probe set composition for RAS / BRAF mutation detection and a kit comprising the same. The method of the present invention is capable of predicting the reactivity of a cancer patient to a therapeutic agent, predicting cancer metastasis or recurrence as well as diagnosis The purpose of this study was to determine the necessity of administration of anticancer drugs, to provide clues about the direction of future treatment, and to monitor the metastasis or recurrence of cancer.
【도면의 간단한 설명】 BRIEF DESCRIPTION OF THE DRAWINGS
도 1은 표준물질로사용되는 mini-clone의 모식도롤 나타낸 도면이다. 도 2은 본 발명의 프로브 및 프라이머를 포함하는 RAS/BRAF 돌연변이 검출 키트의 구성 (M 1 내지 8)을 나타낸 것으로， 각 MMX 별 검출 가능한 RAS/BRAF 변 이의 종류를 나타낸 것이다. 도 3a 내지 도 3c는 본 발명의 프로브 및 프라이머를 포함하는 RAS/BRAF변이 검출 키트가 RAS/BRAF mutation site를 검출할 수 있는지 여부를 확인한 결과이며， MMX1 (도 3a), MMX2(도 3b), MMX3(도 3c)에 포함되는 KRAS mutation site에서만 검 출한 결과를 나타낸 것이다. 도 4a 및 도 4b는 본 발명의 프로브 및 프라이머를 포함하는 RAS/BRAF 변이 검출 키트가 RAS/BRAF mutation site를 검출할 수 있는지 여부를 확인한 결과이며, MMX5도 4a)와 MMX6(도 4b)에 포함되는 NRAS mutation site에서만 검출한 결과를 나타낸 것이다. 도 5는 본 발명의 프로브 및 프라이머를 포함하는 RAS/BRAF 변이 검출 키트 가 RAS/BRAF mutation site를 검출할 수 있는지 여부를 확인한 결과이며， MMX8에 포함되는 BRAF mutation site에서만 검출한 결과를 나타낸 것이다. 도 6는 RAS/BRAF 변이를 가지고 있지 않은 FFPE 샘플을 이용하여 본 발명의 프로브 및 프라이머를 포함하는 RAS/BRAF에 대한 각 돌연변이별 false positive 결 과값을 확인한 것이다. 도 7a 및 도 7b는 RAS/BRAF 변이를 가지고 있는 대장직장암 환자의 FFPE 샘 플로부터 추출한 DNA의 quality를 측정방법에 대한 것이며， FFPE 보관기간에 따른 DIN 값의 차이 (도 7a)와 GenesWell ddRAS/BRAF Mutation kit 내의 Quality control 측정치 (도 7b)를 나타낸 것이다. 【발명의 실시를 위한 형태】 이하본 발명을 상세히 설명한다. Fig. 1 is a schematic view of a mini-clone used as a reference material. FIG. 2 shows the structures (M 1 to M 8) of the RAS / BRAF mutation detection kit including the probe and the primer of the present invention, and shows the types of detectable RAS / BRAF variants for each MMX. 3A to 3C are results of checking whether the RAS / BRAF mutation detection kit including the probe and the primer of the present invention can detect the RAS / BRAF mutation site, and MMX1 (FIG. 3A), MMX2 MMAS3 (FIG. 3C). FIGS. 4A and 4B show the result of checking whether the RAS / BRAF mutation detection kit including the probe and the primer of the present invention can detect the RAS / BRAF mutation site, and MMX5 is included in FIG. 4A) and MMX6 The results are shown only in the NRAS mutation site. FIG. 5 is a result of confirming whether or not the RAS / BRAF mutation detection kit containing the probe and the primer of the present invention can detect the RAS / BRAF mutation site. FIG. 5 shows the results of detection only at the BRAF mutation site included in MMX8. FIG. 6 shows false positive results for each mutation of RAS / BRAF including the probe and primer of the present invention using FFPE samples having no RAS / BRAF mutation. FIGS. 7A and 7B are graphs for measuring the quality of DNA extracted from FFPE samples from patients with colorectal cancer having RAS / BRAF mutations. The differences in the DIN values (FIG. 7A) and the GenesWell ddRAS / BRAF Quality in mutation kit control measurement (Fig. 7B). BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.
단， 하기 실시예는 본 발명을 예시하는 것일 뿐， 본 발명의 내용이 하기 실 시예에 한정되는 것은 아니다. 실시예 1 ： 프라이머 및 프로브 디자인 및 선발  However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples. Example 1: Primer and probe design and selection
대장직장암의 발병과 관련성이 높은 유전자인 k-Ras, n-Ras, BRAF의 바이오 마커를 개발하기 위해 cosmic번호 (http: //cancer. Sanger. ac.uk)를 기반으로 하여 돌연변이 위치를 확인하였다. 유전자의 exon별 프라이머를 Primer3 plus 프로그램 과 PyroMa가 Assay Design 2.0을 사용하여 forward가 intron부분과 overlapping될 수 있도록 디자인하였다. 이 때， 프라이머의 Tm값은 50~60°C로 하였으며 (¾:%는 40-70%로 디자인하였다. 프로브는 조건을 충족하는 것들을 선별하여 taqman probe로 디자인하였다. 야생형 (wild)과 돌연변이 (Mutant) 프로브의 5'-end 에는 HEX 또는 FAM reporter fluorescence를 부착하여 대상 유전자의 증폭에 따라 형광시그널이 검출 가능하도 록 하였다. 모든 프로브의 3' 쪽에는 quencher로 BHQ1을 사용하였다. 본 발명자들 에 의해 디자인된 프로브는 allele specific을 갖고 있으며 대부분의 프로브들이 cosmic 번호를 가지고 있다. 한편， background(noise)를 줄이기 위해 돌연변이 위 치에 상웅하는 서열을 이용하여 non-specific하게 결합하지 못하도톡 blocker oligomer를 제작하였다. Mutation sites were identified based on the cosmic number (http: // cancer.Sanger.ac.uk) to develop biomarkers of k-Ras, n-Ras, and BRAF genes that are highly related to the incidence of colorectal cancer . The exon primer of the gene was designed so that the forward primer could be overlapped with the intron primer using P rimer3 plus program and PyroMa Assay Design 2.0. At this time, the Tm value of the primer was set at 50 to 60 ° C (¾:% was designed to be 40-70%.) The probe was designed as a taqman probe by selecting those that meet the conditions. Mutant probes were attached with HEX or FAM reporter fluorescence to detect fluorescence signals according to amplification of the target gene. BHQ1 was used as a quencher on the 3 'side of all probes. The probes designed by the probe have allele specificity and most probes have a cosmic number, while non-specific binding can not be achieved using a sequence homologous to the mutation site to reduce the background (noise) Respectively.
디자인된 프라이머와프로브의 정보를 각각 표 1 및 표 2에 나타냈다.  The information of the designed primer and probe is shown in Table 1 and Table 2, respectively.
<표 1> Pr imer name Sequence Seq . No .<Table 1> Pr imer name Sequence Seq. No.
KC-F11 TAAGGCCTGCTGAAAATGACT 1 C1-R9 TCTGAAmGCTGTATCGTCAAGG 2 C16-F15 TGAGGGACCAGTACATGAGGA 3KC-F11 TAAGGCCTGCTGAAAATGACT 1 C1-R9 TCTGAAmGCTGTATCGTCAAGG 2 C16-F15 TGAGGGACCAGTACATGAGGA 3
KC16-R17 MCCCACCTATAATGGTGAATATCTTC 4KC16-R17 MCCCACCTATAATGGTGAATATCTTC 4
KC16-F3 CAGGATTCCTACAGGAAGCAAGT 5KC16-F3 CAGGATTCCTACAGGAAGCAAGT 5
KC16-R15 CAGTCCTCATGTACTGGTCCCT 6KC16-R15 CAGTCCTCATGTACTGGTCCCT 6
NC23-F4 CCCCCAGGATTCTTACAGAAA 7NC23-F4 CCCCCAGGATTCTTACAGAAA 7
NC23-R4 CCTGTCCTCATGTA TGGTCTCTC 8NC23-R4 CCTGTCCTCATGTA TGGTCTCTC 8
NC39-F8 TTAGGGAGCAGATTAAGCGAGTA 9NC39-F8 TTAGGGAGCAGATTAAGCGAGTA 9
NC39-R10 TTCGTGGGCTTGTTTTGTATC 10NC39-R10 TTCGTGGGCTTGTTTTGTATC 10
NC1-F6 GGTTCTTGCTGGTGTGAAATGACT - 11NC1-F6 GGTTCTTGCTGGTGTGAAATGACT-11
NC1-R6 TCTGGAmGCTGGATTGTCAGTG 12NC1-R6 TCTGGAmGCTGGATTGTCAGTG 12
BC1-F1 GAAGACCTCACAGTAAAAATAGGTG 13BC1-F1 GAAGACCTCACAGTAAAAATAGGTG 13
BC1-R3 ATCCAGACAACTGTTCAAACTGAT 14BC1-R3 ATCCAGACAACTGTTCAAACTGAT 14
BC9-F1 GTTCTAACAGGCACCAGAAGTC 15BC9-F1 GTTCTAACAGGCACCAGAAGTC 15
BC9-R1 GTCCAGTCATCAATTCATACAGA 16 프라이머의 정보 BC9-R1 GTCCAGTCATCAATTCATACAGA 16 Information on primers
<표 2> <Table 2>
Primer name Sequence Sea . No . Primer name Sequence Sea. No.
KP2 TGGAGCTGATGGCGTAGGCA 17  KP2 TGGAGCTGATGGCGTAGGCA 17
KP4 TGGAGCTGTTGGCGTAGGCA 18  KP4 TGGAGCTGTTGGCGTAGGCA 18
KP5 TGGAGCTAGTGGCGTAGGCAA 19  KP5 TGGAGCTAGTGGCGTAGGCAA 19
KP7 TGGAGCTTGTGGCGTAGGCA 20  KP7 TGGAGCTTGTGGCGTAGGCA 20
KP36 TGGTAGTTGGAGCTTTTGGCG - 21  KP36 TGGTAGTTGGAGCTTTTGGCG - 21
K-ex2-B3 TGGAGCTGGTGGCGTAGGC 22  K-ex2-B3 TGGAGCTGGTGGCGTAGGC 22
KP8 TGGAGCTGGTGACGTAGGCA 23  KP8 TGGAGCTGGTGACGTAGGCA 23
K-KC12-B3 GTAGTTGGAGCTGGTGCCGTAG 24  K-KC12-B3 GTAGTTGGAGCTGGTGCCGTAG 24
KP14-1 TGGTAGTTGGAGCTGGTATCGTAGGC 25  KP14-1 TGGTAGTTGGAGCTGGTATCGTAGGC 25
K-ex2-B3 TGGAGCTGGTGGCGTAGGC 26  K-ex2-B3 TGGAGCTGGTGGCGTAGGC 26
KP16-2 AGGGCTTTCITTGTGTAnTGCCA 27  KP16-2 AGGGCTTTCITTGTGTAnTGCCA 27
KP17 CGACACAGCAGGTCACGAGGA 28  KP17 CGACACAGCAGGTCACGAGGA 28
KP21-2 TCGACACAGCAGGTAAAGAGGA 29  KP21-2 TCGACACAGCAGGTAAAGAGGA 29
KP23 CGACACAGCAGGTCCAGAGGA 30  KP23 CGACACAGCAGGTCCAGAGGA 30
KP37-1 CACAGCAGGTCGTGAGGAGTACA 31  KP37-1 CACAGCAGGTCGTGAGGAGTACA 31
KP38-1 ACACAGCAGGTGTAGAGGAGTACAGT 32  KP38-1 ACACAGCAGGTGTAGAGGAGTACAGT 32
K-ex3-B3 ACACAGCAGGTCAAGAGGAGTACAGT 33  K-ex3-B3 ACACAGCAGGTCAAGAGGAGTACAGT 33
NP24-1 CTGGATACAGCTGGAAAAGAAGAGTACA 34  NP24-1 CTGGATACAGCTGGAAAAGAAGAGTACA 34
NP25-1 TGGATACAGCTGGACGAGAAGAGTAC 35  NP25-1 TGGATACAGCTGGACGAGAAGAGTAC 35
N-ex3-B2 TGGATACAGCTGGACAAGAAGAGTACA 36  N-ex3-B2 TGGATACAGCTGGACAAGAAGAGTACA 36
NP39-1 CTCGGATGATGTACCTATGGTGCT 37  NP39-1 CTCGGATGATGTACCTATGGTGCT 37
NP2-2 TGGTTGGAGCAAGTGGTGTTG 38  NP2-2 TGGTTGGAGCAAGTGGTGTTG 38
NP3-2 TGGTTGGAGCATGTGGTGTTG 39 NP3-2 TGGTTGGAGCATGTGGTGTTG 39
P5-2 TGGTTGGAGCAGATGGTGTTG 40 - P5-2 TGGTTGGAGCAGATGGTGTTG 40 -
NP6-1 TGGTTGGAGCAGTTGGTGTTG 41 NP6-1 TGGTTGGAGCAGTTGGTGTTG 41
N-ex2-B2 GTTGGAGCAGGTGGTGTTGG 42  N-ex2-B2 GTTGGAGCAGGTGGTGTTGG 42
BP2-1 TGGTCTAGCTACAGAGAAATCTCGAT 43  BP2-1 TGGTCTAGCTACAGAGAAATCTCGAT 43
BP3 CTAGCTACAGAAAAATCTCGATGGAG 44  BP3 CTAGCTACAGAAAAATCTCGATGGAG 44
B-C7-B2 TGGTCTAGCTACAGCGAAATCTCGATG 45  B-C7-B2 TGGTCTAGCTACAGCGAAATCTCGATG 45
BP9 TGCAAGATAAAAATCCATACAGCTTTC 46  BP9 TGCAAGATAAAAATCCATACAGCTTTC 46
프로브의 정보 상기 제작된 프라이머와 프로브를 조합하여 RAS/BRAF 돌연변이 검출용 키트 를 구성하였다. 실시예 2 ： 표준 물질의 제작 Information on probes A kit for detecting RAS / BRAF mutation was constructed by combining the prepared primers and probes. Example 2: Preparation of standard material
디자인된 프라이머와 프로브를 검증하기 위해， 그리고 ddPCR 수행에 필요한 표준물질 백터 (mini-clone으로 명명)를 제작하였다. mini-clone의 제작과정은 먼저 k-Ras , n-Ras , b-raf의 각각 exon에서 돌연변이가 일어난 구간을 가운데로 하여 약 300bp을 합성하였다. 합성된 DNA 단편은 pUC57 vector 백터의 universal l ink sequence 사이에 삽입 (도 1. 참조)하고, 제작된 clone은 대장균 DH5 α 세포에 형질 전환 (transformat ion) 시켰다. circular form 또는 super—coi led form으로 존재하는 mini—clone을 선형화시 켜 ddPCR(droplet digital PCR)시 효율을 극대화시키기 위하여 mini-clone에 Clal 또는 Pstl 제한효소를 37°C에서 30분간 반웅하고, 반웅산물은 clean up 과정을 거 친 후 -20°C에서 사용 전까지 보관하였다. 본 발명의 검출 대상은 PCR증폭 효을에 따라 변이가 다르게 나타난다. 이에 특이적인 프라이머 /프로브에 의한 증폭여부의 판별을 위한 기준인 Posit ive control °1 필요하다. Posit ive contn)l은 대상 유전자의 변이를 포괄하는 lOObp 내 지 350bp의 뉴클레오티드가 통상의 백터에 형질전환된 것을 이용할 수 있다. 바람 직하게는 본 발명의 Posit ive contr 은 k-Ras , n-Ras , BRAF의 각각 exon에서 돌연 변이가 일어난 구간 중심으로 하여 약 300bp을 합성하여 pUC57 vector 또는 pIDTSmart Amp 백터에 삽입하여 사용할 수 있다. 실시예 3 ： 표준물질 (Miniclone)을 활용한 돌연변이 검출 시험 To validate the designed primers and probes, and to create the standard material vector (named mini-clone) required for ddPCR performance. The mini-clone was first synthesized in about 300 bp with the mutation in the exons of k-Ras, n-Ras and b-raf. The synthesized DNA fragment was inserted between the universal l ink sequence of the pUC57 vector vector (see Fig. 1), and the clone was ligated into E. coli DH5 [alpha] cells Transformed. In order to maximize the efficiency of ddPCR (droplet digital PCR) by linearizing a mini-clone present in a circular form or a super-coi led form, Clal or Pstl restriction enzyme was added to the mini-clone for 30 minutes at 37 ° C, The product was cleaned up and stored at -20 ° C until use. The detection target of the present invention exhibits mutation different depending on the PCR amplification effect. Posit ive control ° 1, which is a criterion for discrimination of amplification by a specific primer / probe, is necessary. Posit ive contn) can be obtained by transforming a lOObp of a nucleotide of 350 bp containing a mutation of a target gene into a normal vector. Desirably, the Positve contr of the present invention can be used as a center of mutation in the exons of k-Ras, n-Ras and BRAF, respectively, and about 300 bp can be synthesized and inserted into pUC57 vector or pIDTSmart Amp vector. Example 3: Mutation detection test using a standard substance (Miniclone)
본 발명의 RAS/BRAF 변이 검출 키트 (이하 'GenesWel l ddRAS/BRAF mutat ion test ki t '라 함)가 RAS/BRAF mutat ion site를 검출할 수 있는지 알아보기 위해 상 기 제작한 표준물질을 이용하였다. 또한 cancer의 특징 중의 하나인 이형접항성 (heterozygote)을 감안하여 Miniclone을 야생형 (wi ldtype)인 gDNA와 50%로 스파이 킹 (spiking)하여 샘플을 준비하였다. 본 시험에 사용된 DNA양은 12 ng/샘플 이며 모든 샘플들은 MMX1 내지 MMX8과 각각 반응시켜 ddPCR을 수행하였다.  BRAF Mutation Detection Kit (hereinafter referred to as 'GenesWellddrRAS / BRAF mutation test ki') can detect the RAS / BRAF mutation site using the standard material prepared above . Given the heterozygous nature of the cancer, Miniclone was spiked with 50% of wildtype gDNA and samples were prepared. The amount of DNA used in this test was 12 ng / sample, and all samples were reacted with MMX1 to MMX8, respectively, to perform ddPCR.
ddPCR 과정은 바이오라드 사의 QX200™ Droplet digital PCR system (Bio- RAD, USA)을 이용하여 진행되었다. 샘플 준비는 MMX1 내지 MMX8 mixture가 있는 8- st irp PCR tube에 20 ul씩 분주하였고 각 튜브에 Ultrapurewater(NTC)， Posit ive controKPC) , 환자 검체로부터 추출한 template DNA를 lul씩 넣어 PCR 반웅 흔합물 (react ion mix)을 만들었다. 상기 MMX1 내지 MMX8 mixture에 대한 정보는 하기 도 2에 기재하였다.  The ddPCR procedure was carried out using the QX200 ™ Droplet digital PCR system (Bio-RAD, USA) of Biorad. In order to prepare the sample, 20 μl of the mixture was added to the 8-st irp PCR tube containing MMX1 to MMX8 mixture. Ultrapurewater (NTC) and Positve controKPC were added to each tube, and the template DNA extracted from the patient sample was added lul. ion mix). Information on the MMX1 to MMX8 mixture is shown in FIG.
8-Strip PCR튜브 캡을 닫고 볼텍싱 (vortexing) 한 후 스핀 -다운 (Spin-down) 하였고 실온에서 10분간 인큐베이션 ( Incubat ion)하였다. 이후 액적 생성 (Droplet generat ion) 단계로 준비된 DG 카트리지 (cartridge)의 샘플 wel l에는 PCR 반응 흔 합물을， oi l wel l에는 액적 생성 오일 (Droplet generat ion oi l )을 70ul씩 넣고 Droplet Generator Gasket에 장착하여 QX20()TM Droplet Generator로 Droplet을 형 성시켰다. 형성된 40ul Droplet을 96 wel l plate로 옮기고 Pierceable Foi l Heat SeaKBIO-RAD, 181-4040)의 붉은색 선이 아래로 가도톡 plate위에 덮고 PX1TM PCR Plate Sealer(180°C , 5초 seal ing)에 넣고 밀봉 (Seal ing)하였다. PCR 증폭과정은 Ver it i 96-Wel l Thermal Cycler를 이용하였고, 증폭된 PCR산물은 QX200 drolet reaker를 사용하여 증폭된 신호를 검출하였다. 결과분석은 Bk)-RAD 가 제공하는 Quant aSo ft software로 수행하였다. The 8-Strip PCR tube cap was closed, vortexed and then spun-down and incubated at room temperature for 10 minutes. The sample well of the DG cartridge prepared after the droplet generation step was subjected to a PCR reaction (Droplet Generator Oil) was added to the Droplet Generator Gasket, and Droplet was formed with the QX20 () TM Droplet Generator. Transfer the formed 40ul Droplet to a 96 well plate and cover the red line of Pierceable Foil Heat Sea KBIO-RAD, 181-4040) on the bottom of the dipstick plate and place it on a PX1 ™ PCR Plate Sealer (180 ° C, 5 sec seal ing) And sealed. PCR amplification was performed using Verite 96-Well Thermal Cycler, and amplified PCR products were amplified using a QX200 drolet reaker. The results were analyzed using Quant aSoft software provided by Bk-RAD.
본 발명의 GenesWel l ddRAS/BRAF Mutat ion Test는 RAS/BRAF 변이를 검출할 수 있는 MMX1 내지 MMX8을 모두 포함하고 있으며， 각각의 구성들은 RAS/BRAF mutat ion site를 검출할 수 있음을 보여주고 있다 (도 3 내지 도 5) . 각 유전자에 대한 변이들은 F舰과 HEX로 구분할 수 있다. 예를 들어， MMX1에서 KRAS G12X mutat ion은 FAM으로， KRAS G13D mutat ion은 HEX로 구분하였으며， 샘플의 퀄리티 (qual i ty)를 측정하기 위한 야생형 유전자는麗 X4의 HEX를 이용하였다. .  The GenesWellddAS / BRAF mutation test of the present invention includes all of MMX1 through MMX8 capable of detecting RAS / BRAF mutation, and each construct can detect RAS / BRAF mutation sites ( 3 to 5). The mutations for each gene can be divided into F and HEX. For example, the KRAS G12X mutation in MMX1 was identified as FAM and the KRAS G13D mutation as HEX. The wild-type gene for measuring the quality of the sample was HEX of LYX4. .
또한 연구결과에 따르면 대장직장암 환자에서 k-Ras , n-Ras 돌연변이가 존재 하면 치료약물로 사용되는 EGFR 저해제 세특시맙， 파니투무맙에 대한 치료효과가 없지만， BRAF 변이에 대한 Raf 저해제 베무라페닙， 다브라페닙 약물에 대해서는 치 료효과가높음이 알려져 있다. · 실시예 4 ： 임상샘플에서의 정량적 검출을 위한 임상적 한계값 (cut-off ) 설 정  In addition, studies have shown that the presence of k-Ras and n-Ras mutations in colorectal cancer patients does not have the therapeutic effect of EGFR inhibitor cefixime, panitumumat, which is used as a therapeutic drug, but the Raf inhibitor, , And the treatment effect is high for dabrafenem drugs. Example 4: Clinical cut-off setting for quantitative detection in clinical samples
본 발명의 GenesWel l ddRAS/BRAF Mutat ion Test의 정량적 한계 설정을 위하 여 RAS/BRAF 돌연변이가 없는 RAS/BRAF 야생형 유전자를 가진 환자의 FFPE 샘플을 총 30회 반복시험을 수행하여 각 돌연변이에서의 공란한계 (Limit of blank, LoB) 및 위양성 (false posit ive) 수치를 분석하였다.  For the quantitative limit setting of the GenesWel® ddRAS / BRAF mutation test of the present invention, FFPE samples of patients with the RAS / BRAF wild-type gene without the RAS / BRAF mutation were subjected to a total of 30 repeated tests, (Limit of blank, LoB) and false positivities.
그 결과 도 6에서 나타난 바와 같이， RAS/BRAF 돌연변이가 존재하지 않는 FFPE 샘플임에도 불구하고 KRAS G12X, G13D와 Q61X 에 대한 Mutant index는 0.8， 0.2와 0.3을 보였으며， NRAS G12X와 Q61X에 대한 Mutant index는 0.6, 0.1 그리고 BRAF V600E에 대한 Mutant index는 0.1로 나타났다. 이를 위양성으로 한정하였다. 이러한 위양성 결과를 바탕으로 GenesWel l ddRAS/BRAF Mutat ion Test의 각 변이별 정량적 검출 한계는 하기 표 3에 나타내었으며， 각 변이별 Mutant index 에 대한 역치값 이상의 수치가 도출된 경우에, 돌연변이가 존재한다고 판단하였다. 상기 Mutant index (MI)는 각 돌연변이에 상응하는 야생형유전자 대비 존재하는 돌연변 이비율을 뜻한다. As a result, mutant indices for KRAS G12X, G13D and Q61X were 0.8, 0.2 and 0.3, respectively, despite the presence of the RAS / BRAF mutation-free FFPE sample, and the mutant index for NRAS G12X and Q61X , And the mutant index for BRAF V600E was 0.1. We limited this to false positives. Based on these false-positive results, the quantitative detection limits of each of the mutations in the GenesWel® ddRAS / BRAF Mutation Test are shown in Table 3 below. Mutation is present when a value above the threshold value for each mutant index is derived Respectively. remind The mutant index (MI) is the ratio of the mutation to the wild type gene corresponding to each mutation.
<표 3> <Table 3>
Figure imgf000022_0001
실시예 5 ： 환자의 FFPE 시료로부터 추출된 DNA sample의 quality control 환자로부터 추출한 암조직올 장기보관하기 위해 일반적으로 환자의 조직을 파라핀 포매하는 방법 (paraffin embedded methods)을 많이 사용한다. 그러나 조직 을 FFPE 화하는 과정에서 화학반웅 및 외부요인에 의해 환자의 시료 내 DNA는 탈아 미노 반응 (deamination) 또는 손상 (damage)이 일어나고， 보관기간에 따라 DNA quality 저하가 일어나고 이로 인해 정확한 진단에 어려움을 가져온다. 따라서 정 확한 진단을 위해서는 시료내의 DNA 퀄리티 확인법은 매우 증요하다.
Figure imgf000022_0001
Example 5 Quality Control of DNA Sample Extracted from a Patient's FFPE Samples In order to preserve the long-term survival of cancer tissues extracted from patients, the patient's paraffin embedded methods are commonly used. However, in the process of converting the tissue into FFPE, deamination or damage of the DNA in the patient's sample occurs due to chemical reaction and external factors, DNA quality deteriorates according to the storage period, Lt; / RTI &gt; Therefore, DNA quality verification in samples is very important for accurate diagnosis.
GenesWell ddRAS/BRAF Mutation Test는 퀄리티 컨트롤 (Quality control)을 도입하고, 실험을 진행하기 전， DNA 손상정도를 확인할 수 있는 DNA 완전성 슷자 (DNA integrity number (DIN), 수치가 10 에 가까울수록 DNA 퀄리티가 높음)를 측정 함으로써 진단의 정확성을 높였다. 도 7a와 같이， FFPE 조직화 1년 이내 검체가 DIN 수치가 높았으며， 퀄리티 컨트롤도 500copy 이상 안정적임을 확인하였다 (도 7b). 실시예 6 ： 환자의 FFPE샘플에서의 돌연변이 검출 방법에 따른 검출능 비교 차세대 PCR 방법을 적용한 GenesWell' ddRAS/BRAF Mutation Test의 분자진단 적합성을 판단하였다. 이를 위하여， 환자의 FFPE 샘플 40개를 사용하여 분자진단법 의 표준 시험 (gold standard)인 생거 시뭔성 (Sanger sequencing) 방법 또는 real¬ time PCR방법에 대하여 돌연변이 검출능 비교시험을 진행하였다. The GenesWell ddRAS / BRAF Mutation Test introduces quality control and allows the DNA integrity number (DIN), which is the DNA integrity number (DIN) High) to improve the accuracy of diagnosis. As shown in FIG. 7A, it was confirmed that the DIN value of the specimen within one year of FFPE organization was high and the quality control was stable over 500 copies (FIG. 7B). Example 6 Comparison of Detection Ability According to Mutation Detection Method in FFPE Samples of Patients The molecular diagnostic suitability of GenesWell 's ddRAS / BRAF Mutation Test using the next generation PCR method was evaluated. To this end, using the FFPE samples of 40 patients was performed for mutation detection performance comparison test with respect to the methods or real time PCR ¬ mwonseong method (Sanger sequencing) during the Sanger standard test of the molecular diagnosis (gold standard).
ᅳ 그 결과 하기 표 4에 나타난 바와 같이, 3가지 방법 중 GenesWell ddRAS/BRAF Mutation Test가 돌연변이 검출율이 가장 높았으며, 생거 시뭔싱 방법 이 가장 낮은 검출율을 보였다. 또한 GenesWell ddRAS/BRAF Mutation Test와 생거 시퀀싱과의 불일치 검체는 real-time PCR과 일치하는 결과가 나타났다. 더 나아가 GenesWell ddRAS/BRAF Mutation Test는 real-time PCR 방법으로는 검출하지 못한 돌연변이를 추가 검출하였다. 따라서 본 발명의 GenesWell ddRAS/BRAF Mutation Test는 현존하는 다른 분자진단 방법대비 민감도가높음을 확인하였다. As shown in Table 4, the GenesWell ddRAS / BRAF mutation test showed the highest mutation detection rate among the three methods, and the searing method showed the lowest detection rate. The GenesWell ddRAS / BRAF Mutation Test and Sanger Inconsistent samples with sequencing showed results consistent with real-time PCR. Furthermore, the GenesWell ddRAS / BRAF Mutation Test detects additional mutations that were not detected by real-time PCR. Therefore, the GenesWell ddRAS / BRAF Mutation Test of the present invention has a higher sensitivity than other existing molecular diagnostic methods.
Figure imgf000023_0001
【산업상 이용가능성】
Figure imgf000023_0001
[Industrial applicability]
이상 살펴본 바와 같이 본 발명의 조성물 및 키트는 암 환자 예후의 치료제 에 대한 반웅성 예측을 통하여 암 환자의 항암치료제 투여 필요성 판단을 비롯하여 향후 치료의 방향에 대한 단서를 제시하는 목적 및 암의 전이 또는 재발에 대한 모니터링 하는 데에 유용하게 이용될 수 있다.  As described above, the compositions and kits of the present invention can be used for the purpose of presenting a clue to the direction of treatment in addition to judging the necessity of administration of an anticancer drug to cancer patients through anti-maleicity prediction of a cancer patient's prognosis, As shown in FIG.

Claims

【청구의 범위】 Claims:
【청구항 1】  [Claim 1]
i ) 서열번호 1의 정방향 프라이머, 서열번호 2의 역방향 프라이머 및 서열 번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트;  i) a polynucleotide set of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24;
ii ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역방향 프라이머 서열번 호 3의 정방향 프라이머, 서열번호 4의 역방향 프라이머 및 서열번호 25 내지 서열 번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 및  ii) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the forward primer of reverse primer SEQ ID NO: 3 of SEQ ID NO: 2, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27; And
iii ) 서열번호 5의 정방향 프라이머， 서열번호 6의 역방향 프라이머 및 서열 번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 로 이루어진 군에서 선택된 세트를 유효성분으로 포함하는 RAS/BRAF 돌연변 이 검출용 프라이머 및 프로브 세트 조성물.  iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; Wherein the set comprises a set selected from the group consisting of: &lt; RTI ID = 0.0 &gt; RAS / BRAF &lt; / RTI &gt;
【청구항 2】 [Claim 2]
제 1항에 있어서， 상기 조성물은  The composition of claim 1, wherein the composition comprises
i ) 서열번호 7의 정방향 프라이머， 서열번호 8의 역방향 프라이머 및 서열 번호 34 내지 서열번호 36으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 및  i) a polynucleotide set of the forward primer of SEQ ID NO: 7, the reverse primer of SEQ ID NO: 8 and the probe selected from the group consisting of SEQ ID NO: 34 to SEQ ID NO: 36; And
ii ) 서열번호 9의 정방향 프라이머， 서열번호 10의 역방향 프라이 서열번 호 11의 정방향 프라이머， 서열번호 12의 역방향 프라이머 및 서열번호 37 내지 서 열번호 42으로 이루어진 군에서 선택된 프로브와 폴리뉴클로에티드 세트;로 이루어 진 군에서 선택된 세트를 유효성분으로 추가 포함하는 RAS/BRAF 돌연변이 검출용 프라이머 및 프로브 세트 조성물.  ii) a forward primer of SEQ ID NO: 9, a forward primer of reverse primer number 11 of SEQ ID NO: 10, an inverted primer of SEQ ID NO: 12, and a probe selected from the group consisting of SEQ ID NO: 37 to SEQ ID NO: 42 and a polynucleotide set ; &Lt; / RTI &gt; wherein the selected set of RAS / BRAF mutants is selected from the group consisting of: &lt; RTI ID = 0.0 &gt;
【청구항 3】 [Claim 3]
제 1항에 있어서, 상기 조성물은 서열번호 13의 정방향 프라이머, 서열번호 14의 역방향 프라이머， 서열번호 15의 정방향 프라이머， 서열번호 16의 역방향 프 라이머 및 서열번호 43 내지 서열번호 46으로 이루어진 군에서 선택된 프로브의 폴 리뉴클레오티드 세트를 유효성분으로 추가 포함하는 RAS/BRAF 돌연변이 검출용 프 라이머 및 프로브 세트 조성물. The composition of claim 1, wherein the composition is selected from the group consisting of a forward primer of SEQ ID NO: 13, a reverse primer of SEQ ID NO: 14, a forward primer of SEQ ID NO: 15, an inverted primer of SEQ ID NO: 16 and SEQ ID NO: A primer and probe set composition for detecting RAS / BRAF mutation additionally comprising a polynucleotide set of a probe as an active ingredient.
【청구항 4】 Claim 4
제 1항에 있어서， 상기 RAS/BRAF 돌연변이 검출은 EGFR 저해제에 대한 치료 반응성 (responsiveness) 예측을 위한 것임을 특징으로 하는 프라이머 및 프로브 세트 조성물.  3. The primer and probe set composition of claim 1, wherein said RAS / BRAF mutation detection is for predicting the responsiveness to EGFR inhibitors.
【청구항 5] [Claim 5]
거 항에 있어서， 상기 EGFR 저해제는 세툭시맙 (cetuximab) , 파니투무맙 (panitumumab) , 베무라페닙 (Vemurafenib) 또는 다브라페닙 (Dabrafenib) 인 것을 특 징으로 하는 프라이머 및 프로브 세트 조성물.  Wherein the EGFR inhibitor is cetuximab, panitumumab, Vemurafenib or Dabrafenib. &Lt; Desc / Clms Page number 15 &gt;
【청구항 6】 [Claim 6]
제 1항에 있어서， 상기 프로브는 형광물질과 결합되어 있는 것을 특징으로 하 는 프라이머 및 프로브 세트 조성물.  2. The primer and probe set composition according to claim 1, wherein the probe is bound to a fluorescent material.
【청구항 7] [7]
계 6항에 있어서, 상기 형광물질은 VIC, HEX, FAM, EverGreen dye로 이루어진 군에서 선택된 하나이상인 것임을 특징으로 하는 프라이머 및 프로브 세트 조성물.  Wherein the fluorescent material is at least one selected from the group consisting of VIC, HEX, FAM, and EverGreen dyes.
【청구항 8] [8]
거 U항 내지 제 3항 중 어느 한 항에 따른 프라이머 및 프로브 세트 조성물을 유효성분으로 포함하는 RAS/BRAF돌연변이 검출용 키트.  A kit for detecting RAS / BRAF mutation comprising the primer and the probe set composition according to any one of claims 1 to 3 as an active ingredient.
【청구항 9】 [Claim 9]
제 8항에 있어서 , 상기 키트는 RUO (research use only) 또는 IVD ( in vi tro diagnost ic) 키트인 것을 특징으로 하는 키트.  The kit according to claim 8, wherein the kit is a research use only (RUO) or an IVD (in vitro diagnostic) kit.
【청구항 10】 Claim 10
i ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역방향 프라이머 및 서열 번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트;  i) a polynucleotide set of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24;
ii ) 서열번호 1의 정방향 프라이머， 서열번호 2의 역방향 프라이머， 서열반 호 3의 정방향 프라이머， 서열번호 4의 역방향 프라이머 및 서열번호 25 내지 서열 번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 및 iii ) 서열번호 5의 정방향 프라이머, 서열번호 6의 역방향 프라이머 및 서열 번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 로 이루어진 군에서 선택된 세트를 유효성분으로 포함하는 RAS/BRAF 돌연변 이 검출용 키트. ii) the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the SEQ ID NO: A polynucleotide set of a probe selected from the group consisting of SEQ ID NO: 27; And iii) a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO: 33; Wherein the kit comprises a set selected from the group consisting of: &lt; RTI ID = 0.0 &gt; RAS / BRAF &lt; / RTI &gt;
【청구항 11】 Claim 11
제 10항에 있어서， 상기 키트는  11. The apparatus of claim 10, wherein the kit
i ) 서열번호 7의' 정방향 프라이머, 서열번호 8의 역방향 프라이머 및 서열 번호 34 내지 서열번호 36으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 및 i) SEQ ID NO: 7 of the 'forward primer, reverse primer SEQ ID NO: 8 and SEQ ID NO: 34 to SEQ ID NO: A polynucleotide probe sets of selected from the group consisting of 36; And
ii ) 서열번호 9의 정방향 프라이머, 서열번호 10의 역방향 프라이머, 서열번 호 11의 정방향 프라이머, 서열번호 12의 역방향 프라이머 및 서열번호 37 내지 서 열번호 42으로 이루어진 군에서 선택된 프로브의 폴리뉴클로에티드 세트;로 이루어 진 군에서 선택된 세트를 유효성분으로 추가 포함하는 RAS/BRAF 돌연변이 검출용 키트.  ii) a forward primer of SEQ ID NO: 9, a reverse primer of SEQ ID NO: 10, a forward primer of SEQ ID NO: 11, an inverted primer of SEQ ID NO: 12 and a polynucleotide of the probe selected from the group consisting of SEQ ID NO: 37 to SEQ ID NO: Kit for detecting RAS / BRAF mutation, comprising a set selected from the group consisting of RAS / BRAF mutation.
【청구항 12】 Claim 12
제 10항에 있어서, 상기 키트는 서열번호 13의 정방향 프라이머， 서열번호 14 의 역방향 프라이머， 서열번호 15의 정방향 프라이머， 서열번호 16의 역방향 프라 이머 및 서열번호 43 내지 서열번호 46으로 이루어진 군에서 선택된 프로브의 폴리 뉴#레오티드 세트를 유효성분으로 추가포함하는 RAS/BRAF돌연변이 검출용 키트.  The kit according to claim 10, wherein the kit comprises a forward primer of SEQ ID NO: 13, an inverse primer of SEQ ID NO: 14, a forward primer of SEQ ID NO: 15, an inverse primer of SEQ ID NO: 16 and a group of SEQ ID NO: A kit for RAS / BRAF mutation detection further comprising a polynucleotide of the probe as an active ingredient.
【청구항 13] [13]
제 8항 내지 제 12항 중 어느 한 항에 있어서， 상기 키트는 qPCR 13. The method according to any one of claims 8 to 12,
(quant itat ive PCR) 또는 digi tal PCR 방법에 사용되는 것임을 특징으로 하는 키 트 (quantitate ive PCR) or a digital PCR method.
【청구항 14】 14.
제 8항 내지 제 12항 중 어느 한 항에 있어서, 상기 키트는 혈액에서 분리된 cfDNA(cel l-free DNA)를 주형으로 하는 것을 특징으로 하는 키트. 13. The kit according to any one of claims 8 to 12, wherein the kit is a cfDNA (cel-free DNA) separated from blood as a template.
【청구항 15】 15.
제 8항 내지 제 12항 중 어느 한 항에 있어서, 상기 키트는 FFPE (formal in f ixed paraf in embedded) 조직에서 분리된 DNA 또는 상기 조직 유래의 R A로부터 역전사 반웅에 의해 합성된 cDNA (complementary DNA)를 주형으로 하는 것을 특징 으로 하는키트.  13. The kit according to any one of claims 8 to 12, wherein the kit comprises DNA isolated from FFPE (tissue integrated fingered) or cDNA (complementary DNA) synthesized by reverse transcription from RA derived from the tissue, As a template.
【청구항 16] 16. The method of claim 16,
제 8항 내지 제 12항 중 어느 한 항에 있어서， 상기 키트는 혈액에서 분리된 CTC (circulat ing tumor cel l )에서 분리된 DNA 또는 상기 CTC 유래의 RNA로부터 역 전사 반응에 의해 합성된 cDNA (co即 lementary DNA)를 주형으로 하는 것을 특징으 로 하는 키트.  13. The kit according to any one of claims 8 to 12, wherein the kit comprises DNA isolated from CTC (circulating tumor cell) isolated from blood or cDNA (co A lementary DNA) as a template.
【청구항 17】 17.
RAS/BRAF 돌연변이 검출용 제제를 제조하기 위한 하기 i ) 내지 i i i )으로 이 루어진 군에서 선택된 폴리뉴클레오티드 세트의 용도:  Use of a set of polynucleotides selected from the group consisting of the following i) to iii) for producing a preparation for RAS / BRAF mutation detection:
i ) 서열번호 1의 정방향 프라이머, 서열번호 2의 역방향 프라이머 및 서열 번호 17 내지 서열번호 24로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트;  i) a polynucleotide set of a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a probe selected from the group consisting of SEQ ID NO: 17 to SEQ ID NO: 24;
ii ) 서열번호 1의 정방향 프라이머, 서열번호 2의 역방향 프라이머， 서열번 호 3의 정방향 프라이머, 서열번호 4의 역방향 프라이머 및 서열번호 25 내지 서열 번호 27로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트; 및  ii) a set of polynucleotides of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4 and the probe selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27; And
iii ) 서열번호 5의 정방향 프라이머， 서열번호 6의 역방향 프라이머 및 서열 번호 28 내지 서열번호 33으로 이루어진 군에서 선택된 프로브의 폴리뉴클레오티드 세트.  iii) the polynucleotide set of the forward primer of SEQ ID NO: 5, the reverse primer of SEQ ID NO: 6, and the probe selected from the group consisting of SEQ ID NO: 28 to SEQ ID NO:
【청구항 18】 Claim 18
(a) 시료에서 DNA를 분리하는 단계 ;  (a) separating DNA from a sample;
(b) 상기 분리된 DNA를 주형으로 하고 제 1항의 프라이머 및 프로브 세트를 이용하여 중합효소연쇄반웅 (PCR)을 실시하는 단계; 및  (b) carrying out PCR using the separated DNA as a template and using the primer and the probe set of claim 1; And
(c) 상기 중합효소연쇄반웅으로 증폭된 산물을 통해， RAS/BRAF 돌연변이 유 전자를 검출하는 단계를 포함하는 RAS/BRAF 유전자 돌연변이 검출 방법 .  (c) detecting the RAS / BRAF mutation gene through the product amplified by the polymerase chain reaction.
PCT/KR2018/011645 2017-09-29 2018-10-01 Composition for detecting ras/braf mutations, and kit comprising same WO2019066621A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170128335 2017-09-29
KR10-2017-0128335 2017-09-29

Publications (1)

Publication Number Publication Date
WO2019066621A1 true WO2019066621A1 (en) 2019-04-04

Family

ID=65903650

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/011645 WO2019066621A1 (en) 2017-09-29 2018-10-01 Composition for detecting ras/braf mutations, and kit comprising same

Country Status (2)

Country Link
KR (1) KR20190038464A (en)
WO (1) WO2019066621A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113718033A (en) * 2021-09-02 2021-11-30 深圳市海普洛斯生物科技有限公司 Application of biomarker in preparation of reagent for predicting prognosis of colorectal cancer patient

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130217020A1 (en) * 2012-02-22 2013-08-22 National Health Research Institutes Methods for improving sensitivity and specificity of screening assays of kras codons 12 and 13 mutations
US20140248614A1 (en) * 2009-08-11 2014-09-04 Response Genetics Methods, primers, probes and kits useful for the detection of braf mutations
KR20160014202A (en) * 2014-07-28 2016-02-11 사회복지법인 삼성생명공익재단 An Apparatus for Diagnosing Cancer and an Method for The Same
KR20170009605A (en) * 2015-07-17 2017-01-25 서울대학교산학협력단 Composition for detecting mutations of NRAS gene and kit comprising the same
KR20170009604A (en) * 2015-07-17 2017-01-25 서울대학교산학협력단 Composition for detecting mutations of KRAS gene and kit comprising the same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140248614A1 (en) * 2009-08-11 2014-09-04 Response Genetics Methods, primers, probes and kits useful for the detection of braf mutations
US20130217020A1 (en) * 2012-02-22 2013-08-22 National Health Research Institutes Methods for improving sensitivity and specificity of screening assays of kras codons 12 and 13 mutations
KR20160014202A (en) * 2014-07-28 2016-02-11 사회복지법인 삼성생명공익재단 An Apparatus for Diagnosing Cancer and an Method for The Same
KR20170009605A (en) * 2015-07-17 2017-01-25 서울대학교산학협력단 Composition for detecting mutations of NRAS gene and kit comprising the same
KR20170009604A (en) * 2015-07-17 2017-01-25 서울대학교산학협력단 Composition for detecting mutations of KRAS gene and kit comprising the same

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113718033A (en) * 2021-09-02 2021-11-30 深圳市海普洛斯生物科技有限公司 Application of biomarker in preparation of reagent for predicting prognosis of colorectal cancer patient

Also Published As

Publication number Publication date
KR20190038464A (en) 2019-04-08

Similar Documents

Publication Publication Date Title
US11180812B2 (en) Use of DNA in circulating exosomes as a diagnostic marker for metastatic disease
EP3285193A1 (en) Method for predicting organ transplant rejection using next-generation sequencing
US9109259B2 (en) Detection method for novel ROS1 fusions
JP6534930B2 (en) Detection method of NTRK3 fusion
JP2017538404A (en) Use of circulating cell-free RNA for diagnosing and / or observing cancer
CN107849606A (en) The method for improving sequencing sensitivity of future generation
JP5769952B2 (en) Highly sensitive detection method for EML4-ALK fusion gene
WO2014201092A1 (en) Non-invasive blood based monitoring of genomic alterations in cancer
JP6636247B2 (en) Method for quantifying WT1 mRNA expression level
JP2018514202A (en) Multiplex PCR to detect gene fusions
JP2019519540A (en) Novel Mutations in Anaplastic Lymphoma Kinase to Predict Response to ALK Inhibitor Therapy in Lung Cancer Patients
EP4089184A1 (en) Disposable reagent kit for detecting multiple genetic mutations of lung cancer
CN110691852A (en) Multiplex PCR detection of ALK, RET and ROS fusions
US11261482B2 (en) Composition for detecting epidermal cell growth factor receptor gene mutation, and kit comprising same
US20180187267A1 (en) Method for conducting early detection of colon cancer and/or of colon cancer precursor cells and for monitoring colon cancer recurrence
KR102600344B1 (en) Composition for detecting mutations of KRAS gene and kit comprising the same
WO2019066621A1 (en) Composition for detecting ras/braf mutations, and kit comprising same
JP2013523178A (en) KRAS primers and probes
KR101800366B1 (en) Composition for detecting mutations of epidermal growth factor receptor gene and kit comprising the same using cfDNA in plasma
CN107354197B (en) Kit for detecting human NRAS gene mutation
KR102600347B1 (en) Composition for detecting mutations of NRAS gene and kit comprising the same
MX2015003386A (en) Method for detection of braf and pi 3k mutations.
EP3212791A1 (en) Methods of detecting braf in cancer
KR20070116567A (en) Detection of lymph node metastasis from gastric carcinoma
RU2688189C1 (en) Oligonucleotide sequence oligonucleotide sequence for the nras gene q61r mutation in the tumor formations of the thyroid gland

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18862751

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18862751

Country of ref document: EP

Kind code of ref document: A1