CN114807318A

CN114807318A - Composition, kit and method for detecting Vero cell genome DNA

Info

Publication number: CN114807318A
Application number: CN202210260994.5A
Authority: CN
Inventors: 张双宇; 刘玉方; 李晓晨; 孙克非
Original assignee: Tiangen Biotech Beijing Co Ltd
Current assignee: Tiangen Biotech Beijing Co Ltd
Priority date: 2022-03-16
Filing date: 2022-03-16
Publication date: 2022-07-29

Abstract

The invention provides a composition, a kit and a method for detecting Vero cell genome DNA, wherein the composition comprises a primer and a probe, and the primer comprises: the sequence of the upstream primer is as follows: 5'-CATCTCACAGAGTTACATCTTTCC-3' (SEQ ID NO:2), downstream primer sequence: 5'-CTTTTTCACCATAGCCCTCTA-3' (SEQ ID NO: 3); the probe comprises the following sequence: 5'-CCTTTCGCTAAGGCTGTTCTTGT-3' (SEQ ID NO: 4). The composition provided by the invention can eliminate the interference of genome DNA of CHO cells, Escherichia coli cells and human cells, can effectively detect residual Vero cell genome DNA in biological products, and has detection sensitivity as high as 0.03 fg/mu L.

Description

Composition, kit and method for detecting Vero cell genome DNA

Technical Field

The invention relates to the technical field of biology, in particular to a composition, a kit and a method for detecting Vero cell genome DNA, and more particularly relates to a composition, a kit and a method for detecting Vero cell genome DNA.

Background

Vero cells are cell lines isolated from renal epithelial cells of african green monkeys (cercophecus Aethiops), are heteroploid cells, are derived from macaque kidney cells by culture, and are cell lines frequently used in the production of biological products, like Hela cell lines, CHO cell lines and canine kidney cell lines (MDCK cells). The Vero cell line is often used in the following fields: preparation of virus vaccines, cell hosts for culturing viruses, cell hosts for culturing eukaryotic parasites, detection of escherichia coli toxins, and the like.

Recombinant biological products are mostly produced by large-scale genetically engineered host cells, and complex non-target products in the cells are main impurity sources in final products, and directly influence the safety of the biological products. Among them, residual DNA of biological genetic material is a very important contaminant, and thus, its detection is an important quality control step.

In recombinant bioprotein preparations, residual DNA is mostly derived from cultured host cells. These host cells are mostly exogenous mammalian cells as well as cells of tumor origin. In theory, the trace amounts of DNA impurities present in biological products may transmit genes associated with tumors or viruses and cause cancer or other pathological changes. When a certain amount of residual DNA enters a human body together with the product, the DNA fragment containing the oncogene may induce the generation of tumor; if the biological product contains some DNA capable of integrating virus, the DNA is infectious after expression, thereby causing a series of adverse effects.

The Vero cell belongs to a continuous cell line, is easy to culture, is suitable for large-scale industrial production, and is one of human vaccine cell matrixes recommended by the world health organization. Thus, the main risk of Vero cell-based vaccines is that the host genomic DNA remaining in the vaccine is potentially tumorigenic. Therefore, establishing an accurate quantitative method of the Vero cell residual genome DNA in the biological product is important for the safety and quality control of the vaccine.

At the present stage, the world health organization recommends the criterion that the final DNA content in each dose of preparation must be less than 10 ng; the FDA in the united states recommends the use of detection methods with detection sensitivity up to 10pg to detect DNA levels in preparations; the Chinese pharmacopoeia stipulates that the residual quantity of Vero cell genome DNA in each dose of vaccine must be less than 100 pg. With the development of science and technology and the trend of higher and higher requirements on health, the safety quantity standard of Vero cell genome DNA residue becomes higher and higher. Therefore, efficient and highly sensitive primers, probes and detection reagents are needed to detect residual Vero genomic DNA in biological products.

The conventional technology to date is generally to design primers and probes aiming at a long tandem repeat sequence in Vero cell genome, wherein the designed primers and probes can have certain detection sensitivity but are still not high, and the highest primer and probe can only reach 1 fg/. mu.L. In addition, because the Vero genome has high homology with the human cell genome, the primers designed in the prior art cannot well eliminate the interference from the human cell genome, and the sensitivity of the primers designed in the prior art cannot meet the standards of people for higher and higher detection sensitivity.

In view of the above, there is a need in the art for new primers, probes and detection methods that can detect residual Vero cell genomic DNA in biological products. The primer, the probe and the detection method have the advantages of high specificity, high sensitivity, simple and convenient operation, accurate quantification and the like, thereby providing favorable support for the quality control of biological products, particularly vaccines.

Disclosure of Invention

The present application is based on the discovery and recognition by the inventors of the following problems:

at present, the commonly used technology for detecting the Vero cell genome generally designs a primer and a probe aiming at a long tandem repeat sequence in the Vero cell genome, and the designed primer and probe have certain detection sensitivity but can only reach 1 fg/muL at the highest; in addition, the primers designed in the prior art can not well eliminate the interference from the human cell genome, so that the inventors develop a novel primer, probe and method for detecting the Vero cell genome.

Accordingly, in a first aspect of the invention, a composition is provided. According to an embodiment of the invention, the composition comprises a primer and a probe, the primer comprising: the sequence of the upstream primer is as follows: 5'-CATCTCACAGAGTTACATCTTTCC-3' (SEQ ID NO:2), downstream primer sequence: 5'-CTTTTTCACCATAGCCCTCTA-3' (SEQ ID NO: 3); the probe comprises the following sequence: 5'-CCTTTCGCTAAGGCTGTTCTTGT-3' (SEQ ID NO: 4). According to the embodiment of the invention, the composition is obtained by screening and optimizing, wherein the upstream primer is combined with 3 rd to 29 th positions of a sequence shown as SEQ ID NO. 1 on the genomic DNA of Vero cells; the downstream primer is combined at the 90 th to 116 th positions of the sequence shown in SEQ ID NO. 1, and the length of the primer amplification product is 103-114 bp. The composition provided by the embodiment of the invention can eliminate the interference of the genomic DNA of CHO cells, Escherichia coli cells and human cells, can effectively detect residual Vero cell genomic DNA in biological products, and has the detection sensitivity of 0.03 fg/muL.

According to an embodiment of the present invention, the above composition may further comprise at least one of the following additional technical features:

according to an embodiment of the invention, the probe sequence has a locked nucleic acid modification.

According to the embodiment of the invention, the 3 rd base at the 5' end of the probe sequence has a locked nucleic acid modification.

According to an embodiment of the invention, the probe further carries a fluorophore.

According to an embodiment of the invention, the fluorescent group is selected from at least one of the following: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE.

According to an embodiment of the present invention, the probe is labeled with a fluorescent group at the 5 'end and a quenching group at the 3' end.

According to the embodiment of the invention, the 5 'end of the probe is marked with FAM fluorescent reporter group, and the 3' end of the probe is marked with BHQ1 quenching group.

According to an embodiment of the present invention, the molar ratio of the forward primer, the backward primer and the probe in the composition is (13-16): (13-16): (12-15).

According to the embodiment of the invention, the molar ratio of the upstream primer to the downstream primer to the probe is 15: 15: 14.

in a second aspect of the invention, a kit is provided. According to an embodiment of the invention, the kit comprises the composition as described above. As mentioned above, the composition is obtained by screening and optimizing the inventor, the composition can eliminate the interference of the genomic DNA of CHO cells, Escherichia coli cells and human cells, can effectively detect residual Vero cell genomic DNA in biological products, and has the detection sensitivity of 0.03 fg/muL; therefore, the kit containing the composition can also effectively detect residual Vero cell genome DNA in biological products, and the detection sensitivity reaches 0.03 fg/mu L.

According to an embodiment of the present invention, the kit may further comprise at least one of the following additional technical features:

according to an embodiment of the invention, further comprising at least one of the following: PCR buffer, salt ions, dNTPs, DNA polymerase, or target nucleic acid.

According to an embodiment of the present invention, a PCR enhancer is further included.

According to an embodiment of the invention, the DNA polymerase is Taq enzyme.

According to an embodiment of the invention, the salt ion is Mg ²⁺ 。

According to an embodiment of the invention, further comprising at least one of the following agents: DNA extraction reagents and nucleic acid purification reagents.

In a third aspect of the invention, the invention provides a method of detecting genomic DNA of Vero cells. According to an embodiment of the invention, the method comprises the following steps: and carrying out amplification reaction on a sample to be detected in a PCR amplification system, wherein the PCR amplification system comprises the composition or is configured by using the kit, and the sample to be detected comprises Vero cell genome DNA. According to the method provided by the embodiment of the invention, the interference of the genomic DNA of CHO cells, Escherichia coli cells and human cells in a biological sample can be eliminated, the residual Vero cell genomic DNA in a biological product can be effectively detected, and the detection sensitivity reaches 0.03 fg/mu L.

According to an embodiment of the present invention, the method for detecting genomic DNA of Vero cells may further comprise at least one of the following additional technical features:

according to an embodiment of the invention, the test sample is provided in the form of Vero cells.

According to the embodiment of the invention, the sample to be detected is subjected to Vero cell genome DNA extraction treatment in advance.

According to an embodiment of the present invention, an amplification reaction is performed in a PCR amplification system to obtain a CT value of a target nucleic acid; and determining the level of Vero cell genomic DNA in the sample to be tested based on the CT value of the target nucleic acid.

According to an embodiment of the invention, the target nucleic acid comprises the nucleotide sequence shown as SEQ ID NO. 1.

According to the embodiment of the invention, the PCR amplification system comprises the composition, wherein the molar ratio of the upstream primer to the downstream primer to the probe in the composition is (13-16): (13-16): (12-15).

according to the embodiment of the invention, the conditions of the PCR amplification reaction are as follows: 1 cycle at 90-97 deg.C for 0.8-1.5 min; 90-97 deg.C, 3-10s, 55-65 deg.C, 10-20s, 38-42 cycles.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 is a graph showing Amplification curves, wherein Amplification Plot indicates the number of cycles on the abscissa (Cycle) and relative fluorescence values on the ordinate (Δ Rn), according to the primer probe and the quantitative method designed in example 1;

FIG. 2 is a Standard Curve diagram obtained by the primer probe and the quantitative method designed in example 1, in which Standard Curve represents a Standard Curve, the abscissa (Quantity) represents the amount of template DNA in picograms, Slope represents Slope, Y represents-Inter denotes the Y-axis intercept, R ² Values represent the fitness of the standard curve, Eff% represents the PCR amplification efficiency, Error represents the standard Error;

FIG. 3 is a graph of amplification curves corresponding to locked nucleic acid modified probes and unlocked nucleic acid modified probes according to example 2, wherein the abscissa (Cycle) represents the number of cycles and the ordinate (Δ Rn) represents the relative fluorescence;

FIG. 4 is a graph showing amplification curves corresponding to the primer probe according to example 3 and a primer probe recommended by national pharmacopoeia, in which the abscissa (Cycle) represents the Cycle number and the ordinate (Δ Rn) represents the relative fluorescence value;

FIG. 5-A is a comparison graph of Amplification curves (Amplification Plot) obtained with and without interference of CHO cell genomic DNA according to the primer probe and the detection method of example 4 of the present invention, in which the abscissa (Cycle) represents the Cycle number and the ordinate (Δ Rn) represents the relative fluorescence value;

FIG. 5-B is a comparative graph of a Standard Curve (Standard cut) obtained with or without interference of CHO cell genomic DNA according to the primer probe and the detection method of example 4 of the present invention, in which the abscissa (Quantity) represents the amount of template DNA (in picograms), Target represents the source of a Target sequence (TG) to be detected, Slope represents Slope, Y-Inter represents Y-axis intercept, R ² Values represent the fitness of the standard curve, and Eff% represents the PCR amplification efficiency;

FIG. 6-A is a comparison graph of Amplification curves (Amplification Plot) obtained with and without the interference of E.coli genomic DNA according to the primer probe and the detection method of example 4 of the present invention, in which the abscissa (Cycle) represents the Cycle number and the ordinate (Δ Rn) represents the relative fluorescence value;

FIG. 6-B is a comparison graph of a Standard Curve (Standard Curve) obtained with or without the interference of E.coli genomic DNA according to the primer probe and detection method of example 4 of the present invention, wherein the abscissa (Quantity) represents the amount of template DNA (in picograms), Target represents the source of the detected Target sequence, Slope represents Slope, Y-Inter represents Y-axis intercept, R represents ² Values represent the fitness of the standard curve, and Eff% represents the PCR amplification efficiency;

FIG. 7-A is a comparison graph of Amplification curves (Amplification Plot) obtained with and without Human293T cell genomic DNA interference according to the primer probe and detection method of example 4 of the present invention, in which the abscissa (Cycle) represents the Cycle number and the ordinate (. DELTA.Rn) represents the relative fluorescence value;

FIG. 7-B is a comparison of Standard curves (Standard Curve) obtained with and without Human293T cell genomic DNA interference according to the primer probe and detection method of example 4 of the present invention, wherein the abscissa (Quantity) represents the amount of template DNA (in picograms), Target represents the source of the detected Target sequence, Slope represents Slope, Y-Inter represents Y-axis intercept, R represents ² Values represent the fitness of the standard curve, and Eff% represents the PCR amplification efficiency;

FIG. 8-A is a graph showing the results of an Amplification curve (Amplification Plot) obtained on an ABI QuantStduio3 qPCR instrument according to the primer probe and detection method of example 6 of the present invention, wherein the abscissa (Cycle) represents the Cycle number and the ordinate (. DELTA.Rn) represents the relative fluorescence value;

FIG. 8-B is a graph of a Standard Curve (Standard Curve) obtained on an ABI QuantStduio3 qPCR instrument according to the primer probe and detection method of example 6 of the present invention, wherein the abscissa (Quantity) represents the amount of template DNA (in picograms), Slope represents Slope, Y-Inter represents Y-axis intercept, and R is ² Values represent the fitness of the standard curve, Eff% represents the PCR amplification efficiency, Error represents the standard Error;

FIG. 9-A is a graph showing the results of an Amplification curve (Amplification Plot) obtained on a Roche480qPCR instrument according to the primer probe and detection method of example 6 of the present invention, wherein the abscissa (Cycle) represents the number of cycles and the ordinate (Fluorescence) represents the Fluorescence value;

FIG. 9-B is a Standard Curve graph (Standard Curve) obtained on a Roche480qPCR instrument by the primer probe and detection method according to example 6 of the present invention, in which the abscissa (Log Concentration) represents the number of template DNAs (Log of picograms/microliter), and the ordinate (Cross Point) represents the intersection Point;

FIG. 10-A is a graph showing the results of Amplification curves (Amplification Plot) obtained on a BioRad CFX96 qPCR instrument according to the primer probe and detection method of example 6 of the present invention, wherein the abscissa (Cycle) represents the number of cycles and the ordinate (RFU) represents the fluorescence value;

FIG. 10-B is a Standard graph (Standard Curve) obtained on a BioRad CFX96 qPCR instrument using the primer probe and detection method according to example 6 of the present invention, wherein the abscissa (Log Starting Quantity) represents the amount of template DNA (Log of picograms/microliter, E represents amplification efficiency, R represents ² The values represent the fitness of the standard curve, Slope represents the Slope, and Y-Inter represents the Y-axis intercept;

FIG. 11-A is a graph showing the results of an Amplification curve (Amplification Plot) obtained on a Macro-Stone 96P qPCR instrument according to the primer probe and the detection method of example 6 of the present invention, wherein the abscissa (Cycle) represents the number of cycles and the ordinate (Rn) represents the relative fluorescence value;

FIG. 11-B is a Standard graph (Standard Curve) obtained on a Macro-Stone 96P qPCR instrument according to the primer probe and detection method of example 6 of the present invention, in which the abscissa (Quantity) represents the amount of template DNA in picograms.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.

Furthermore, the terms "first", "second" and "first" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or to implicitly indicate the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of the feature. In the description of the present invention, "a plurality" means at least two, e.g., two, three, etc., unless specifically limited otherwise.

For the sake of easy understanding, the inventors have made the following description of the present invention:

the method for obtaining the polynucleotide sequence of the primer and the probe for designing and detecting the genomic DNA of the Vero cell comprises the following steps:

(1) the sequence file GCF _015252025.1_ Vero _ WHO _ p1.0_ genomic.fna.gz and the repeat region annotation file GCF _015252025.1_ Vero _ WHO _ p1.0_ rm.out.gz of the african green monkey (chlorebus sabaeus) genome were downloaded from the NCBI database. The comment file in the repeat area is obtained by using a repeat Masker program (version: open-4.0.8), a RepBe database (20181026), and a Dfam _ Consenssus (20181026) database.

(2) According to the repeat annotation file information, the self characteristics of different repeated sequences and the distribution characteristics of the repeated sequences in the genome, extracting the AluSz and AluY repeated sequences of the SINE/Alu family on the corresponding genome, extracting the repeated sequences of the satellite sequence ALR/Alpha type, and filtering to remove the sequences with the length lower than 100 bp.

(3) And (3) respectively carrying out sequence similarity clustering on the different types of repeated sequences extracted in the step (2), clustering sequences with the sequence identity value of 80% or more into a Cluster, searching the Cluster with the largest number of clustered sequences, extracting sequences at the first 100 positions of the identity value in the Cluster, carrying out multi-sequence comparison, and determining the base with the largest possibility at each position in a multi-sequence comparison common region. The finally determined nucleotide sequence was used as a candidate sequence.

(4) And aligning each different type of candidate sequences obtained above to a genome sequence by using blast, -evalue is 1e-5, and filtering out the alignment result with the identity value less than 90 and the alignment length less than 90% of the length of the candidate sequences. Obtaining the number of aligned positions of different types of repeated sequences on the genome, and obtaining the maximum value as the finally selected sequence.

(5) And (3) carrying out qPCR amplification verification on the candidate sequence by a probe method. Through multiple rounds of primer and probe design and qPCR amplification verification of a probe method, the inventor unexpectedly finds that the primer and the probe designed according to the sequence shown in SEQ ID NO. 1 can detect Vero cell genome DNA with high sensitivity and can also distinguish interference DNA of CHO cells, Escherichia coli cells and human cells, thereby obtaining the primer, the probe and the detection method for detecting Vero cell genome DNA with sensitivity and specificity.

Composition comprising a metal oxide and a metal oxide

Thus, in some embodiments, the invention provides a composition comprising a primer and a probe.

(1) Primer and method for producing the same

The term "primer" as used herein has the meaning conventionally understood by those skilled in the art. The Vero cell genome DNA specific primer is not designed aiming at an exogenous gene or a virus vector, but is designed aiming at a sequence shown by SEQ ID NO. 1 of a Vero cell genome DNA sequence. In other words, the primer of the invention can specifically bind to the sequence shown in SEQ ID NO. 1 on the genomic DNA of Vero cells.

In view of the description of the present invention and the general knowledge in the art, it will be understood by those skilled in the art that a variety of primers can be designed with respect to the sequence shown in SEQ ID NO. 1. Therefore, the primer of the present invention is not limited to the primers specifically obtained in the examples.

In a specific embodiment, the upstream primer of the invention is combined with the 3 rd to 29 th positions of the sequence shown in SEQ ID NO. 1 on the genomic DNA of Vero cells; the downstream primer is combined at the 90 th to 116 th positions of the sequence shown in the SEQ ID NO. 1, and the length of the primer amplification product is 103-114 bp. In some specific embodiments, the length of the forward primer and the reverse primer is 21-27 bp; preferably, the lengths of the upstream primer and the downstream primer are 24 and 21bp, respectively.

In some preferred embodiments, the Tm temperatures of the forward and reverse primers are from 55 ℃ to 57 ℃ and the absolute value of the difference between the Tm of the forward primer and the Tm of the reverse primer is ≦ 2 ℃.

In a most preferred embodiment, the forward primer of the invention is shown in SEQ ID NO. 2 and the reverse primer is shown in SEQ ID NO. 3.

(2) Probe needle

The term "probe" as used herein has the meaning conventionally understood by those skilled in the art, i.e., a short piece of single-stranded DNA or single-stranded RNA fragment or single-stranded DNA/RNA hybrid fragment for detecting a nucleic acid sequence complementary thereto.

In the design process of the Vero cell genome DNA detection probe, the inventor surprisingly finds that the affinity of the detection probe and a template can be greatly improved by carrying out locked nucleic acid modification on the detection probe, and further the sensitivity of the detection reagent to Vero cell genome DNA detection is improved.

In the present application, "Locked Nucleic Acid (LNA)" refers to a nucleotide modified such that a methylene bridge is introduced at the 2 'oxygen atom and the 4' carbon atom of the carbocyclic ring to form a Locked structure, and the Locked Nucleic Acid obtained by the Locked Nucleic Acid modification is a nucleotide derivative.

In view of the description of the present invention and the general knowledge in the art, those skilled in the art will understand that, knowing the primer pair, those skilled in the art can design a probe autonomously according to the template sequence between the upstream primer and the downstream primer binding site, and test the technical effect of the probe and the primer pair. In specific embodiments, one of ordinary skill in the art can design probes based on the specific primer sequences required, either in the liquid phase or immobilized on a solid phase; the binding may be performed before amplification or after amplification. Therefore, the probe of the present invention is not limited to the probe specifically disclosed in the examples. The primer set of the present invention is not limited to the use of the probe set specifically disclosed in the examples.

In a specific embodiment, the probe of the invention is shown in SEQ ID NO 4.

Reagent kit

In some embodiments, the invention provides a kit comprising the primers of the invention, a detection probe and other components required for performing the probe method qPCR, such as Taq enzyme, dNTP, Mg ²⁺ And the like.

In a specific embodiment, the detection reagent of the present invention comprises an upstream primer shown in SEQ ID NO. 2, a downstream primer shown in SEQ ID NO. 3, and a probe shown in SEQ ID NO. 4.

In a specific embodiment, the detection sensitivity of the kit of the invention reaches 0.03 fg/. mu.L.

On the basis of the primer, the detection probe or the kit, the invention further provides a method for detecting Vero cell genome DNA, which comprises the following steps: the primer, the detection probe or the kit provided by the invention is used for carrying out probe qPCR on a sample to be detected and detecting a qPCR amplification product.

Detection method

On the basis of the primer and the detection probe, the invention also provides a probe method qPCR method for amplifying a target product by using the primer and the probe.

After screening and optimization, the following primer sequences, reaction systems and reaction conditions can effectively detect Vero cell genome DNA.

(1) DNA detection related sequence reagent and sequence:

reagent: 2 XProbe qPCR MasterMix (containing Hot Start Taq enzyme, dNTP, Mg) ²⁺ And ROX Reference Dye, the detection primer and the probe of the present invention).

The sequence is as follows: the related sequences related to the present invention are shown in Table 1, and the primer probes used were synthesized from Shanghai.

Table 1:

the Vero cell genome DNA standard used in the invention is purchased from China institute of assay. The negative standard substance is RNase-Free ddH ₂ O, Vero cell genome DNA standard dilution is provided by Tiangen Biochemical technology (Beijing) Ltd.

The detection instrument used in the invention comprises: ABI 7500, ABI quantstduo 3, BioRad CFX96, Roche480, macrocalite 96P.

(2) Preparation of DNA Standard

Vero cell genomic DNA purchased from China assay institute was subjected to gradient dilution with a nucleic acid standard diluent (Tiangen Biochemical product, catalog number RT504) at a concentration shown in Table 2, wherein the non-template control (NTC) was ultrapure water.

Table 2:

gradient numbering	1	2	3	4	5	6	7	8
									Concentration of	300pg/μL	30pg/μL	3pg/μL	300fg/μL	30fg/μL	3fg/μL	0.3fg/μL	0.03fg/μL

(3) qPCR reaction system by probe method

The reaction system is shown in table 3:

table 3:

components	Volume required for a Single reaction (. mu.L)
		Template DNA (Standard DNA or ultrapure water)	10
2 xqPCR reaction reagent	15
		Upstream primer (10. mu.M)	0.75
Downstream primer (10. mu.M)	0.75
		Detection probe (10. mu.M)	0.6
Ultrapure water	2.9
		Total volume	30

(4) Probe method qPCR reaction program

The reaction procedure is shown in table 4:

table 4:

the beneficial effects of the invention include:

(1) the primer, the detection probe or the detection reagent designed in the invention has higher detection sensitivity when detecting Vero cell genome DNA;

(2) the primers, the detection probes or the detection reagents designed in the invention can eliminate the interference of the genome DNA of CHO cells, Escherichia coli cells and human cells;

(3) the detection probe is modified by locked nucleic acid, so that the detection sensitivity of the detection reagent can be further improved;

(4) the detection method has the characteristics of simple and convenient operation, accurate quantification, strong specificity and high sensitivity.

The invention will now be described with reference to specific examples, which are intended to be illustrative only and not to be limiting in any way.

Example 1 primer, Probe design and sensitivity test

1.1 obtaining of polynucleotide sequence used for designing primer and probe for detecting Vero cell genome DNA:

(1) the sequence file GCF _015252025.1_ Vero _ WHO _ p1.0_ genomic.fna.gz and the repeat region annotation file GCF _015252025.1_ Vero _ WHO _ p1.0_ rm.out.gz of the african green monkey (chlorebus sabaeus) genome were downloaded from the NCBI database. The comment file in the repeat region is obtained by using the replay Masker program (version: open-4.0.8), Rebse database (20181026) and Dfam _ Consensus (20181026) databases.

(3) And (3) respectively carrying out sequence similarity clustering on the different types of repeated sequences extracted in the step (2), clustering the sequences with the sequence identity value of 80% or more into one Cluster, searching the Cluster with the largest number of clustered sequences, extracting the sequences at the first 100 bits of the identity value in the Cluster, carrying out multi-sequence comparison, and determining the base with the maximum possibility at each position in the common region of the multi-sequence comparison. The finally determined nucleotide sequence was used as a candidate sequence.

(4) And aligning each different type of candidate sequences obtained above to a genome sequence by using blast, -evalue is 1e-5, and filtering out the alignment result with the identity value less than 90 and the alignment length less than 90% of the length of the candidate sequences. And obtaining the number of the aligned positions of the different types of repeated sequences on the genome, wherein the largest value is the finally selected sequence.

1.2 design of primer and Probe sequences

Based on the sequence shown in SEQ ID NO. 1 obtained in 1.1 and the Oligo7 software, the inventors designed the following primer pairs and probes:

an upstream primer: CATCTCACAGAGTTACATCTTTCC (SEQ ID NO: 2);

a downstream primer: CTTTTTCACCATAGCCCTCTA (SEQ ID NO: 3);

detecting a probe: CC (challenge collapsar)TTTCGCTAAGGCTGTTCTTGT (SEQ ID NO:4), wherein the underlined bases are modified with a locked nucleic acid.

Wherein, the DNA template for designing the primer probe is as follows:

ATTCATCTCACAGAGTTACATCTTTCCCTTCAGAAGCCTTTCGCTAAGGCTGTTCTTGTGGAATTTGCAAAGGGATATTTGAAAGCCCTTAGAGGGCTATGGTGAAAAAGGAAATATCTTCCGTTCAAAACTGGAAAGAAGATTTCTGAGAATCTGCTCTGTGTACTGTTAATTCATCT(SEQ ID NO:1)；

amplification products: CATCTCACAGAGTTACATCTTTCCCTTCAAGAAGCCTTTCGCTAAGGCTGTTCTTGTGGAATTGGCAAAGTGATATTTGGAAGCCCATAGAGGGCTATGGTGAAAAAG (SEQ ID NO: 5).

The inventors have tested the performance of the above primer pairs and probes by a probe method qPCR experiment, wherein the qPCR system is shown in table 5:

table 5:

The concentration settings of the standard DNA used for the qPCR standard curve are shown in table 6:

table 6:

gradient of gradient	1	2	3	4	5	6	7	8
									Concentration of	300pg/μL	30pg/μL	3pg/μL	300fg/μL	30fg/μL	3fg/μL	0.3fg/μL	0.03fg/μL

The qPCR reaction program is shown in table 7:

table 7:

the qPCR instrument used was ABI QuantStudio 3.

The specific experimental results are shown in fig. 1 and fig. 2, wherein fig. 1 is an amplification curve of the standard, and the amplification curve shows a significant exponential growth period. FIG. 2 is a calibration curve for the standard. As is clear from FIG. 2, when the concentrations of the standards were 300 pg/. mu.L, 30 pg/. mu.L, 3 pg/. mu.L, 300 fg/. mu.L, 30 fg/. mu.L, 3 fg/. mu.L, 0.3 fg/. mu.L, and 0.03 fg/. mu.L, the slope of the calibration curve obtained by plotting it was-3.22, and the correlation coefficient (R) was obtained ² ) The amplification efficiency was 104.4% at 0.999. The standard curve has good linearity, and the detection sensitivity can reach 0.03 fg/mu L.

Example 2 Effect of Probe Lock nucleic acid modification on assay results

The primer probes used in this example are shown below:

an upstream primer: CATCTCACAGAGTTACATCTTTCC (SEQ ID NO: 2);

a downstream primer: CTTTTTCACCATAGCCCTCTA (SEQ ID NO: 3);

detecting a probe: CC (challenge collapsar)TTTCGCTAAGGCTGTTCTTGT (SEQ ID NO:4), the underlined bases are subjected to locked nucleic acid modification;

detection probes (no locked nucleic acid modification): CCTTTCGCTAAGGCTGTTCTTGT, respectively;

qPCR system as in example table 2:

the DNA concentration settings for the standards used for the qPCR standard curve are shown in table 8:

table 8:

gradient of gradient	1	2	3	4	5	6	7
								Concentration of	300pg/μL	30pg/μL	3pg/μL	300fg/μL	30fg/μL	3fg/μL	0.3fg/μL

The qPCR reaction procedure is as shown in table 7 in example 1.

The qPCR instrument used was ABI 7500.

The amplification curves comparing the detection effects of the two probes are shown in FIG. 3. The PCR reaction corresponding to the probe modified by the locked nucleic acid has a lower CT value, a higher fluorescence signal and longer exponential amplification time. The specific parameters of the two probes corresponding to the PCR reaction are shown in Table 9, and the experimental results shown in FIG. 3 and Table 9 show that the probes modified by the locked nucleic acid have better amplification effect.

Table 9:

example 3 comparison of the detection Effect of the primer Probe of the invention and the national pharmacopoeia recommended primer Probe

The primer probes used in this example are shown below:

an upstream primer: CATCTCACAGAGTTACATCTTTCC (SEQ ID NO: 2);

a downstream primer: CTTTTTCACCATAGCCCTCTA (SEQ ID NO: 3);

amplification products: CATCTCACAGAGTTACATCTTTCCCTTCAAGAAGCCTTTCGCTAAGGCTGTTCTTGTGGAATTGGCAAAGTGATATTTGGAAGCCCATAGAGGGCTATGGTGAAAAAG (SEQ ID NO: 5);

the upstream primer recommended by the national pharmacopoeia: GCTTTCTGAGAAACTGCTCTGTGT (SEQ ID NO: 6);

downstream primers in national pharmacopoeia: GGAAGATATTTCCTTTTTCACCATAGC (SEQ ID NO: 7);

national detection probes: CCTTCAAGAAGCCTTTCGCTAAG (SEQ ID NO: 8);

the qPCR system is as shown in table 5 of example 1;

the concentration settings of the standard DNA used for the qPCR standard curve are shown in table 10:

table 10:

The qPCR reaction procedure is the same as in table 7 of example 1.

The qPCR instrument used was ABI 7500.

The amplification curves of the two groups of primer probes for comparison of detection effects are shown in fig. 4, wherein the curve with high fluorescence signal corresponds to the primer probe of the invention, and the curve with low fluorescence signal corresponds to the recommended primer probe in the national pharmacopoeia. As can be seen from the results in the figure, the PCR reaction corresponding to the primer probe designed by the application has a lower CT value, a higher fluorescence signal and a longer exponential amplification time; the specific parameters of the PCR reaction corresponding to the two sets of detection primer probes are shown in Table 11. As can be seen from the experimental results shown in FIG. 4 and Table 11, the primer probe of the present invention has a better detection effect than the primer probe recommended by the national pharmacopoeia.

Table 11:

example 4 primer Probe specificity evaluation

This example detects the specificity of the primer probe designed by the present invention, and the primer probes used are as follows:

an upstream primer: CATCTCACAGAGTTACATCTTTCC (SEQ ID NO: 2);

a downstream primer: CTTTTTCACCATAGCCCTCTA (SEQ ID NO: 3);

The interfering DNA was prepared as follows: diluting three interference DNAs of escherichia coli, CHO and Human293T cells into 5 ng/mu L; wherein, the Escherichia coli DNA is derived from DH5 alpha strain preserved in Tiangen biochemistry, CHO cells and Human293T cells are purchased from Dingguo biology, and genomic DNA is extracted by a gene extraction kit of Tiangen biochemistry.

The qPCR system is shown in table 12:

table 12:

components	Volume required for a Single reaction (. mu.L)
		Template DNA (Standard DNA or ultrapure water)	10
Interfering with genomic DNA	2
		2 xqPCR reaction reagent	15
Upstream primer (10. mu.M)	0.75
		Downstream primer (10. mu.M)	0.75
Detection probe (10. mu.M)	0.6
		Ultrapure water	0.9
Total volume	30

The concentration settings of the standard DNA used for the qPCR standard curve are shown in table 13:

table 13:

gradient of gradient	1	2	3	4	5	6
							Concentration of	300pg/μL	30pg/μL	3pg/μL	300fg/μL	30fg/μL	3fg/μL

The qPCR reaction procedure is as shown in table 7 of example 1.

The qPCR instrument used was ABI 7500.

The amplification curve and standard curve for CHO genomic DNA interference are shown in FIGS. 5-A and 5-B, from which it can be seen that the addition of CHO cell genomic DNA has no effect on DNA amplification in Vero cells. The amplification curve and standard curve of E.coli genomic DNA interference are shown in FIGS. 6-A and 6-B, from which it can be seen that the addition of E.coli genomic DNA has no effect on DNA amplification of Vero cells. The amplification curve and standard curve of the genomic DNA interference of the Human293T cell are shown in FIGS. 7-A and 7-B, and it can be seen that the addition of the genomic DNA of the Human293T cell has no influence on the DNA amplification of Vero cells. In addition, the standard curve parameters of the three groups of interference experiments corresponding to the PCR reaction are shown in table 14, and the pictures and the experimental results in table 14 show that the primer probe can effectively resist the interference of CHO, Escherichia coli and human cell genome DNA, and has good species specificity.

Table 14:

grouping	R ²	Efficiency of amplification
			Non-interfering genomic DNA	1	100.15％
DNA interference by adding CHO cell	1	101.00％
			Interference by adding Escherichia coli cell DNA	1	99.05％
DNA interference by adding Human293T cell	1	99.21％

Example 5 quantitative stability and accuracy evaluation of primer probes and detection methods

The primer probes used in this example are shown below:

an upstream primer: CATCTCACAGAGTTACATCTTTCC (SEQ ID NO: 2);

a downstream primer: CTTTTTCACCATAGCCCTCTA (SEQ ID NO: 3);

detecting a probe: CCTTTCGCTAAGGCTGTTCTTGT, the underlined bases are subjected to locked nucleic acid modification (SEQ ID NO: 4);

amplification products: CATCTCACAGAGTTACATCTTTCCCTTCAAGAAGCCTT

TCGCTAAGGCTGTTCTTGTGGAATTGGCAAAGTGATATTTGGAAGCCCATAGAGGGCTATGGTGAAAAAG(SEQ ID NO:5)。

The detection reagent used in this example contains the primer of the present invention and other components necessary for the probe method qPCR, such as a detection probe, e.g., Taq enzyme, dNTP, Mg ²⁺ And the like.

The quantitative accuracy was determined by the following procedure: the 5 concentrations of the mock samples shown in Table 15 were selected and tested 10 times repeatedly using the primer probe, reaction system and test method described in example 1 of the present invention.

Table 15:

gradient of gradient	1	2	3	4	5
						Concentration of	3pg/μL	1fg/μL	0.5pg/μL	0.3fg/μL	0.1fg/μL

The qPCR system used in the present application is shown in table 16:

table 16:

The qPCR standard curve is shown in table 17:

table 17:

The qPCR reaction program is shown in table 18:

table 18:

the qPCR instrument used was ABI 7500.

The quantitative data of the experiment is shown in table 19, wherein the quantitative CV values of the primer probe and the quantitative method for detecting the primer probe are less than 20% for 5 concentrations of the simulated samples, which indicates that the quantitative accuracy and the repeatability of the invention are good.

Table 19:

example 6 Universal detection of primer probes and detection methods for qPCR instruments

The primer probes used in this example are shown below:

an upstream primer: CATCTCACAGAGTTACATCTTTCC (SEQ ID NO: 2);

a downstream primer: CTTTTTCACCATAGCCCTCTA (SEQ ID NO: 3);

detecting a probe: CC (component C)TTTCGCTAAGGCTGTTCTTGT (SEQ ID NO:4), the underlined bases are subjected to locked nucleic acid modification;

The invention provides a detection reagent for detecting Vero cell genome DNA, which comprises the primer of the invention, detection probe and other components required for implementing the probe method qPCR, such as Taq enzyme, dNTP, Mg ²⁺ And the like.

qPCR system is shown in table 20:

table 20:

The concentration settings of the standard DNA used for the qPCR standard curve are shown in table 21:

table 21:

The qPCR reaction procedure is as shown in table 7 in example 1.

The qPCR instrument used was ABI quantstduo 3, Roche480, BioRad CFX96, macrocalite 96P.

Table 22:

the specific experimental results are shown in FIG. and Table 22, wherein FIGS. 8-A and 8-B show the amplification curve and standard curve of the method of the present invention on ABI QuantStduio3 instrument, FIGS. 9-A and 9-B show the amplification curve and standard curve of the method of the present invention on Roche480 instrument, FIGS. 10-A and 10-B show the amplification curve and standard curve of the method of the present invention on BioRad CFX96 instrument, FIGS. 11-A and 11-B show the amplification curve and standard curve of the method of the present invention on Macro 96P instrument; table 22 shows the CT values and the amplification efficiencies of the standard curves and R corresponding to the method of the present invention under various qPCR instrument platforms ² The data show that the detection primer probe and the detection method have good instrument universality, and the detection effect on the mainstream qPCR instrument is stable and good.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

Claims

1. A composition comprising a primer and a probe,

the primer comprises:

the sequence of the upstream primer is as follows: 5'-CATCTCACAGAGTTACATCTTTCC-3' (SEQ ID NO:2),

the sequence of the downstream primer is as follows: 5'-CTTTTTCACCATAGCCCTCTA-3' (SEQ ID NO: 3);

the probe comprises the following sequence: 5'-CCTTTCGCTAAGGCTGTTCTTGT-3' (SEQ ID NO: 4).

2. The composition of claim 1, wherein the probe sequence has a locked nucleic acid modification;

optionally, the 3 rd base at the 5' end of the probe sequence has a locked nucleic acid modification.

3. The composition of any one of claims 1-2, wherein the probe further carries a fluorophore;

optionally, the fluorophore is selected from at least one of: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE.

4. The composition of claim 3, wherein the probe is labeled at the 5 'end with a fluorescent group and at the 3' end with a quenching group,

preferably, the 5 'end of the probe is marked with FAM fluorescent reporter group, and the 3' end is marked with BHQ1 quenching group.

5. A kit comprising the composition of any one of claims 1-4.

6. The kit of claim 5, further comprising at least one of: PCR buffer, salt ions, dNTPs, DNA polymerase or target nucleic acid;

optionally, further comprising a PCR enhancer;

optionally, the DNA polymerase is Taq enzyme;

optionally, the salt ion is Mg ²⁺ 。

7. The kit of claim 5 or claim, further comprising at least one of the following reagents: DNA extraction reagents and nucleic acid purification reagents.

8. A method for detecting Vero cell genome DNA is characterized by comprising the following steps:

subjecting a sample to be tested to an amplification reaction in a PCR amplification system comprising the composition of any one of claims 1 to 4 or configured using the kit of any one of claims 5 to 7,

wherein the sample to be detected comprises Vero cell genome DNA;

optionally, the sample to be tested is provided in the form of Vero cells;

optionally, the sample to be detected is subjected to Vero cell genome DNA extraction treatment in advance;

optionally, performing an amplification reaction in a PCR amplification system to obtain a CT value of the target nucleic acid; and determining the level of Vero cell genomic DNA in a sample to be tested based on the CT value of the target nucleic acid;

optionally, the target nucleic acid comprises the nucleotide sequence shown in SEQ ID NO. 1.

9. The method of claim 8, wherein the PCR amplification system comprises the composition of any one of claims 1 to 4, wherein the molar ratio of the forward primer, the backward primer and the probe in the composition is (13-16): (13-16): (12-15);

preferably, the molar ratio of the upstream primer, the downstream primer and the probe is 15: 15: 14.

10. the method of claim 8, wherein the PCR amplification reaction is performed under the following conditions: 1 cycle at 90-97 deg.C for 0.8-1.5 min; 90-97 deg.C, 3-10s, 55-65 deg.C, 10-20s, 38-42 cycles.