CN108330213B - Method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection - Google Patents
Method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection Download PDFInfo
- Publication number
- CN108330213B CN108330213B CN201810352275.XA CN201810352275A CN108330213B CN 108330213 B CN108330213 B CN 108330213B CN 201810352275 A CN201810352275 A CN 201810352275A CN 108330213 B CN108330213 B CN 108330213B
- Authority
- CN
- China
- Prior art keywords
- pcr
- fmca
- cold
- probe
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Abstract
The invention provides a method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection, wherein primers are adopted as follows: 5 'GCCTCAGTCCGTTTCTC 3', R:5 'AAAGGGACTCAAGATGTTGT 3', and probes of the system A and the system B, a probe melting curve method is introduced to combine with COLD-PCR, and the probe melting curve method is used for quantitative detection of known and unknown mutant DNA of HBV RT regions 179-191 and 193-208 (the species difference of the RT regions is most significant). The method can realize sensitive detection of low-proportion mutant strains only by optimization of a reaction system and later-stage melting curve analysis without adding expensive equipment, and is particularly suitable for popularization and development in common clinical gene amplification laboratories.
Description
Technical Field
The invention belongs to the field of biotechnology, and particularly relates to a method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection.
Background
Hepatitis B Virus (HBV) belongs to the family of hepadnaviridae, and has a genome length of about 3.2kb, which is a partially double-stranded circular DNA. HBV exists in a patient in a quasi-species form, and the quasi-species change of Reverse Transcriptase (RT) regions of different genotypes has obvious heterogeneity, and the influence on the diagnosis, treatment and outcome of diseases is different. Currently, there are various defects in the methods available for detecting HBV RT region quasispecies (including HBV DNA concentration, different genotypes and mutation types and ratios). For example, the PCR product direct sequencing method (Sanger sequencing method) is considered to detect the gold standard of HBV genome because of one-time detection of known and possibly unknown variant sites, low false positive rate and mature technology, but can be found only when the variant strain is more than or equal to 20 percent, which results in that the tiny quasispecies difference can not be detected; the Restriction Fragment Length Polymorphism (RFLP) and real-time fluorescence PCR (real-time PCR) can only detect the variation of a known single site, and are difficult to capture the variation condition of HBV multiple sites in the treatment process. Some new technologies, such as Next Generation Sequencing (NGS), clone sequencing, mass spectrometry, digital PCR and the like, are gradually applied, but the technologies have the defects of complex operation, high price, need of special equipment and technical personnel, large workload of later data analysis, easy occurrence of base recognition errors and the like, are mainly applied to scientific research, and cannot be widely applied to clinic. The applicant has constructed high-sensitivity RT-AS-LNA-qPCR and RT-ARMS-qPCR technologies in the past, which are respectively used for quantitative detection of HBV YIDD (rtM 204I) and YVDD (rtM 204V) mutant strains, and discloses the prediction value of the curative effect of early detection of low-proportion mutant DNA on NAs, but the technology only aims at a single RT204 site. Under the selection of a host and drug pressure (particularly high-gene barrier antiviral drugs), drug-resistant strains with single-site mutation are difficult to develop into dominant populations, but are evolved in a low-abundance and multi-site combined mutation mode, the methods are characterized in that the qualitative detection with low sensitivity is adopted, the complexity and diversity of HBV RT region quasi-species cannot be considered, and the methods are complex to operate, expensive in equipment and not suitable for clinical routine detection. Therefore, only by establishing a high-sensitivity and convenient technology to dynamically monitor the quasi-species change of the HBV RT region in real time, the characteristics and the rules of the disease progress of the CHB patient and the generation and the development of the quasi-species of the HBV in the antiviral treatment process can be found out, and experimental basis can be provided for realizing accurate individualized diagnosis and treatment.
Low denaturation temperature Co-amplification PCR (COLD-PCR) is a PCR method which has been reported by Li et al to improve the sensitivity of Sanger sequencing, and is based on the principle that the melting temperature (Tm) of double-stranded DNA having mismatched bases is changed. Firstly, performing conventional PCR denaturation, annealing and extension for 10-15 cycles to simultaneously amplify the mutant strain and the wild strain to a certain degree to be used as templates of the next reaction; secondly, the critical denaturation temperature (Tc) of the system is determined experimentally, e.g.86.5 ℃ when only the mutant strain is melted and the wild strain is essentially not melted; after a plurality of PCR cycles, the detection sensitivity of the mutant strain can be greatly improved (COLD-PCR can enrich the mutant strain by 10-100 times compared with the conventional PCR). The probe-based fluorescence curve analysis (FMCA) is a mutation detection method for real-time analysis of the temperature melting characteristics of PCR products by using a fluorescence probe, wherein the amplification step of the method is completely consistent with that of real-time PCR, and the melting curve analysis is only added after the amplification is finished. In the melting curve analysis stage, the amplified target sequence is hybridized with a fluorescent probe, and the binding strength of mismatched bases is lower than that of a wild sequence in the melting process, so that the target sequence can be melted at a lower temperature (lower than that of the wild sequence by 5-20 ℃), and fluorescent signal peaks with different Tm values are formed. Compared with SYBR Green melting curve analysis, the hybridization sequence of the probe melting curve is only 20-30 bp, so that the detection of the mutation site is more sensitive and specific. In earlier work, a COLD-PCR/Sanger sequencing technology is preliminarily constructed for detecting common genotype drug-resistant mutation (rt 180-rt 215) of HBV, and a method which is high in sensitivity, simple, convenient and practical and can simultaneously detect a plurality of HBV drug-resistant mutation sites is established, but the method can only qualitatively detect genotype and HBV DNA but cannot simultaneously detect the genotype and the HBV DNA, and reports of the COLD-PCR combined FMCA technology in HBV multi-mutation site detection are not available at present. In the subject, firstly, two technologies of COLD-PCR and FMCA are combined, expensive equipment is not required to be added in the established COLD-PCR/FMCA technology, sensitive detection on low-proportion mutant strains can be realized only through optimization of a reaction system and later-stage melting curve analysis, and the method is particularly suitable for popularization and development in common clinical gene amplification laboratories.
Disclosure of Invention
The invention aims to provide a method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection, which does not need to add expensive equipment, can realize sensitive detection on low-proportion mutant strains only by optimizing a reaction system and analyzing a later-stage melting curve, and is particularly suitable for popularization and development in common clinical gene amplification laboratories.
In order to achieve the purpose, the invention adopts the following technical scheme:
the detection method comprises the following specific steps:
1) designing and synthesizing a pair of primers as shown in table 1;
TABLE 1 primer sequences for COLD-PCR/FMCA systems
2) Designing and synthesizing probes of system A and system B;
TABLE 2 Probe sequences for COLD-PCR/FMCA detection System
Note: the italic font is a base modified by locked nucleic acid; the type specific bases are underlined.
3) Constructing an asymmetric COLD-PCR/FMCA system for amplification, and configuring the system in a table 3;
TABLE 3 asymmetric PCR/Probe melting Curve System
4) Extracting hepatitis B virus DNA, carrying out amplification on a system A and a system B by using the primers and the probes in the step 1) and the step 2) as amplification primers, configuring system components according to the step 3), and determining a key system denaturation temperature Tc by changing the amplification denaturation temperature;
5) establishing COLD-PCR reaction system conditions through Tc and determining HBV DNA concentration, genotype, mutation type and proportion by combining probe melting curve analysis.
The COLD-PCR reaction system conditions are as follows: 95 ℃ 30 s → (95 ℃ 10 s, 56 ℃ 30 s) × 35 cycles (FAM and CY5 fluorescence signals were collected at the end of the 56 ℃ annealing extension for each cycle) → (Tc ℃ 10 s, 56 ℃ 30 s) × 30 cycles, respectively.
The melting curve analysis conditions are as follows: 1min at 40 ℃; melting is carried out at a heating rate of 0.2 ℃/s from 40 ℃ to 80 ℃, and a fluorescence signal is collected at each temperature rise of 0.2 ℃.
The Tc was 81.5 ℃.
The invention has the advantages that:
the invention introduces a probe melting curve method combined with COLD-PCR, is used for quantitative detection of known and unknown mutant DNA of HBV RT regions 179-191 and 193-208 (the quasi-species difference of the RT regions has the most significance), and on one hand, absolute quantification is carried out on the HBV DNA level through a fluorescence signal generated during amplification of B, C type specific probes; on the other hand, the relative quantification of the genotype and the ratio of different types (sites) of mutated DNA is carried out based on the position and height of melting point peak generated by the probe melting curve. The combination of the two can fully perform qualitative and quantitative analysis on the COLD-PCR enriched low-level mutant strain, thereby providing quantitative indexes for the change of the diversity and the complexity of HBV RT region quasi-species and laying a technical foundation for disclosing the dynamic change characteristics of the HBV RT region quasi-species in the treatment of CHB patients.
Drawings
FIG. 1 shows the verification result of PCR amplification design primer. Wherein the channel 1, B genotype wild strain; channel 2, a YIDD mutant of genotype B (rtM 204I); channel 3, C genotype wild strain; channel 4, a YVDD mutant of genotype C (rtL 180M + rtM 204V); m, DNA Marker.
FIG. 2 is a sequence chart of amplified plasmids of wild strain and mutant strain of HBV. Note: wild strains of A and B genotypes; b, a YIDD mutant strain of genotype B (rtM 204I); c, C genotype wild strain; d, C genotype YVDD mutant (rtL 180M + rtM 204V). The arrow marks the position of the mutated base.
FIG. 3 recognition ability of probes for mutant strains before and after modification of locked nucleic acid base. Note: a, a common probe; and B, LNA modified probe.
FIG. 4 shows mutants corresponding to different Tm temperatures. Note: a, FAM probe of system A; b, the A system CY5 probe; FAM probe of C, B system; d, B System CY5 Probe.
FIG. 5 analysis of product melting curves (A) and amplification curves at different denaturation temperatures (B)
FIG. 6 comparison of detection of HBV gene mutation by conventional PCR/FMCA, COLD-PCR/FMCA and Sanger sequencing (System A)
Note: carrying out serial dilution on the mutant strain and the wild strain plasmid according to the proportion of l:5, l:10, l:20, l:50, l:100 and l:200, wherein the concentration of HBV DNA is 1.0E +04 IU/ml; the peak indicated by the black arrow in the figure is the position of the mutant base.
FIG. 7 comparison of detection of HBV gene mutations by conventional PCR/FMCA, COLD-PCR/FMCA and Sanger sequencing (System B). Note: carrying out serial dilution on the mutant strain and the wild strain plasmid according to the proportion of l:5, l:10, l:20, l:50, l:100 and l:200, wherein the concentration of HBV DNA is 1.0E +04 IU/ml; the peak indicated by the black arrow in the figure is the position of the mutant base.
FIG. 8 lowest limit of quantitative detection of HBV DNA by COLD-PCR/FMCA system. Note: a, an amplification curve chart and B, a product melting curve analysis chart.
FIG. 9 is a graph of COLD-PCR/FMCA detection of different concentrations of HBV DNA plasmid.
FIG. 10 is a graph of COLD-PCR/FMCA detection of different mutant/wild-type standards.
FIG. 11 comparison of the consistency of COLD-PCR/FMCA assay with commercial reagents for HBV DNA detection. Note: a, correlation regression analysis curves of the two methods; b, mean bias plots of the two detection methods.
FIG. 12-1 is the initial picture of the results of COLD-PCR/FMCA and second-generation sequencing assays in patient number 15. Wherein A is a detection result of a COLD-PCR/FMCA system, and B is a second-generation sequencing detection result.
FIG. 12-2 is a raw picture of the results of COLD-PCR/FMCA and second-generation sequencing assays in patient number 18. Wherein A is a detection result of a COLD-PCR/FMCA system, and B is a second-generation sequencing detection result.
Detailed Description
The detection method comprises the following steps:
1) designing and synthesizing a pair of primers as shown in table 1;
TABLE 1 primer sequences for COLD-PCR/FMCA systems
2) Designing and synthesizing probes of system A and system B;
TABLE 2 Probe sequences for COLD-PCR/FMCA detection System
Note: the italic font is a base modified by locked nucleic acid; the type specific bases are underlined.
3) Constructing an asymmetric PCR/FMCA system for amplification, the configuration of which is shown in Table 3;
TABLE 3 asymmetric PCR/Probe melting Curve System
4) Extracting hepatitis B virus DNA, carrying out amplification on a system A and a system B by using the primers and the probes in the step 1) and the step 2) as amplification primers, configuring system components according to the step 3), and determining a key system denaturation temperature Tc by changing the amplification denaturation temperature;
5) establishing COLD-PCR reaction system conditions through Tc and determining HBV DNA concentration, genotype, mutation type and proportion by combining probe melting curve analysis.
The COLD-PCR reaction system conditions are as follows: 95 ℃ 30 s → (95 ℃ 10 s, 56 ℃ 30 s) × 35 cycles (FAM and CY5 fluorescence signals were collected at the end of the 56 ℃ annealing extension for each cycle) → (Tc ℃ 10 s, 56 ℃ 30 s) × 30 cycles, respectively.
The melting curve analysis conditions are as follows: 1min at 40 ℃; melting is carried out at a heating rate of 0.2 ℃/s from 40 ℃ to 80 ℃, and a fluorescence signal is collected at each temperature rise of 0.2 ℃.
The Tc was 81.5 ℃.
Example 1
1. System amplification primer and target gene fragment verification
BLAST and multiple test results in a Pubmed database show that the designed primers are conservative and specific, can amplify various wild (including B, C genotypes) and mutant HBV DNA, and amplified fragments fall between 100-200 bp and accord with expected sizes (figure 1).
The PCR amplification product is taken, and is processed by using a commercial hepatitis B virus genotyping and drug resistance detection reagent according to the steps of the reagent specification strictly, and then subjected to Sanger sequence determination on an ABI 3130 type gene analyzer. The results showed that Blast alignment with the gene bank (Genbank) confirmed that our amplified fragments were completely identical to the expected target gene sequence (fig. 2).
2. Systematic probe screening and optimization
Considering that target fragments are short and mutation types recognized by each probe are more, if all the probes are intensively designed in the same PCR reaction tube, the mutual interference of Tm value judgment in later melting curve analysis is serious, so that two reaction tubes are designed to adopt the same pair of primers (shown in table 1) to carry out amplification simultaneously, all the mutation types can be judged by one-time reaction, the correct recognition of mutation results can be ensured, and the configuration of an asymmetric PCR/probe melting curve system A/B is shown in table 3.
Meanwhile, in order to better distinguish the difference of Tm values of different mutant species, Locked Nucleic Acid (LNA) bases are introduced on the basis of earlier experimental investigation, and LNA is modified RNA and can be hybridized with DNA or RNA in a highly specific manner, so that the Tm value after base matching is obviously improved. As shown in FIG. 3, the probe modified by LNA can improve the Tm value of melting curve analysis, and can further enlarge the Tm temperature difference of different types of mutations such as rtM204I and rtM204V, and the Tm temperature difference is increased from 9.4 ℃ to 14.3 ℃, so that different types of mutation peaks can be distinguished more conveniently, and the sensitivity and specificity of a detection system are further improved.
On the basis of the above, we designed a double probe system B which can identify 13 sites of HBV rt179-rt185 and rt193-rt200, and 13 sites of HBV rt185-rt191 and rt202-rt207, each system respectively adopts FAM and CY5 for fluorescence labeling, and different melting peak positions are analyzed according to the melting curve after PCR amplification to realize the discrimination of different mutation types (FIG. 4). Meanwhile, the system A also introduces type specific bases, the designed probes (shown in table 2) can identify wild and mutant strains according to the melting point temperature, and can judge common B/C genotypes (shown in table 4), and if the detected Tm value of a melting peak does not fall in the range of table 4, the Tm value is the unknown mutation site of the corresponding probe detection region.
3. Confirmation of crucial denaturation temperature (Tc) of COLD-PCR/FMCA System
Using the primers designed as described above, melting curve analysis was performed on the amplification products of the B, C wild type strain, and Tm =82.58 ℃ (fig. 5A). The system denaturation temperature Tx is slightly higher than the Tm value, and when Tx is set to be 83.0 ℃, an amplification curve shows a PCR product; when Tx is further reduced to 82.0 ℃ and 81.5 ℃, an amplification curve still exists; however, when Tx was decreased to 81.0 ℃, the amplification curve showed no PCR product (FIG. 5B). Thus, 81.5 ℃ was defined as the critical denaturation temperature for the COLD-PCR/FMCA system (in which wild double-stranded DNA barely melts, while mutant DNA melts smoothly, and the temperature continues to increase or decrease both at the same time or at the same time).
TABLE 4T of different HBV genotypes and mutant species experimentally foundmValue of
The COLD-PCR system reaction conditions were determined as follows: 95 ℃ 30 s → (95 ℃ 10 s, 56 ℃ 30 s) × 35 cycles (FAM and CY5 fluorescence signals were collected at the end of the 56 ℃ annealing extension for each cycle) → (81.5 ℃ 10 s, 56 ℃ 30 s) × 30 cycles, respectively.
The melting curve analysis conditions are as follows: 1min at 40 ℃; melting is carried out at a heating rate of 0.2 ℃/s from 40 ℃ to 80 ℃, and a fluorescence signal is collected at each temperature rise of 0.2 ℃.
The amplification products are confirmed to be the expected target gene sequence after Sanger sequencing.
4. COLD-PCR/FMCA system methodological evaluation
4.1 evaluation of precision of System
Serum samples (Table 5) with different HBV DNA concentrations (1.0E +03, 1.0E +05 IU/ml, 1.0E +07 IU/ml) and mixed plasmids (Table 6) with different mutation ratios (20%, 10%, 5%) were tested 5 times a day using COLD-PCR/FMCA system for 5 consecutive days. The results show that the inaccuracy fluctuation of the system for HBV DNA detection is 2.58-4.42%, and the repeatability of the system for detecting mutant DNA with different proportions is 3.35-6.49%, which indicates that the inaccuracy of the establishment method is small.
TABLE 5 HBV DNA imprecision evaluation
Note: the low, medium and high are serum mixed samples of patients.
TABLE 6 imprecise evaluation of HBV DNA mutation ratio detection
4.2 evaluation of mutation detection sensitivity
Respectively adjusting the DNA concentration of the constructed mutant strains to be consistent with that of wild strain plasmids (both are 1.0E +04 IU/ml) by ultraviolet spectrophotometry and HBV DNA commercial reagent detection, mixing the prepared mutant strains into wild strains with consistent genotypes according to a certain proportion (such as 1: 5-1: 200) by adopting a gradient dilution method, and respectively performing simultaneous detection by adopting conventional PCR/FMCA, COLD-PCR/FMCA and conventional PCR/Sanger sequencing, wherein the result shows that for different single-point mutation types, the proportion of the lowest mutation DNA detected by the conventional PCR/FMCA is about l:10 (10%), the proportion of the lowest mutation DNA detected by the COLD-PCR/FMCA is about l:100 (1%), and the proportion of the lowest mutation DNA detected by the conventional PCR product Sanger sequencing is l:5 (20, 20%), the COLD-PCR/FMCA created by us is suggested to remarkably improve the detection sensitivity of the mutant DNA, and is improved by 20 times compared with the conventional PCR/Sanger sequencing (FIGS. 6 and 7).
4.3 evaluation of minimum quantitative detection Limit of HBV DNA
Diluting HBV DNA wild plasmid, and accurately quantifying on a traceability commercial reagent detection system, wherein the concentration of the diluted HBV DNA wild plasmid is 5.0E +02 IU/ml and 1.0E +02 IU/ml, and the COLD-PCR/FMCA system established by the invention is adopted to continuously detect the HBV DNA specimen for 25 times. As shown in FIG. 8, when the HBV DNA concentration was 5.0E +02 IU/ml (coefficient of variation: 5.5%), 25 times (100%) were all positive (with distinct peaks of amplification curve and melting curve); when the concentration is reduced to 1.0E +02 IU/ml, no obvious amplification curve and melting peak are found in the system; when the concentration is between the two, the result is negative and positive, and the requirement that the detection result is positive for 25 times or at least 22 times of detection in the industry standard cannot be met. Therefore, the constructed COLD-PCR/FMCA system has the lowest quantitative detection limit of 5.0E +02 IU/ml for HBV DNA, and is comparable to most of commercial conventional HBV DNA detection reagents at present (the lowest quantitative detection limit is 5.0E +02 IU/ml-1.0E +03 IU/ml).
4.4 System Linear Range evaluation
After wild strain plasmids are diluted by adopting gradient (the initial concentration is 5.0E +09 IU/ml, the original concentration is quantified by using traceable commercial reagents, the gradient is diluted by times such as 1:10, 1:100, 1:1000, 1:10000, 1:100000, 1:1000000, 1:10000000 and the like), a COLD-PCR/FMCA system is established to detect the diluted products, and each sample is detected for 3 times. The result shows that when the HBV DNA concentration is in the range of 5.0E +02 IU/ml to 5.0E +09 IU/ml, the Ct value of the serial diluted plasmids has a good linear relation with the initial concentration (the slope: -3.20, the correlation coefficient: 0.997, the amplification efficiency reaches 105.31%), the amplification curves are in a typical S shape (FIG. 9), so the linear range of the self-constructed COLD-PCR/FMCA method for quantitative detection of the HBV DNA is considered to be 5.0E +02 IU/ml to 5.0E +09 IU/ml, and the current clinical common HBV DNA concentration detection range is covered. Therefore, when each batch of detection is carried out, the system simultaneously incorporates four plasmids (stored at-20 ℃ after subpackaging) with the concentrations of 5.0E +03 IU/ml, 5.0E +04IU/ml, 5.0E +05 IU/ml and 5.0E +06 IU/ml after dilution, and the plasmids are used as standard substances for amplification together during each amplification of the system, so that the accurate quantification of the HBV DNA can be realized.
Meanwhile, mutant strains with the same genotype and the same concentration (1.0E +04 IU/ml) and wild strains are diluted according to a certain proportion (0, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% and 100%) to investigate the quantitative capability of COLD-PCR/FMCA on mutant DNA. As shown in FIG. 10A, the mutation peak gradually increased and the wild peak gradually decreased with the increase of the mutation ratio. Calculating the actually detected mutation ratio (occupied values) by using the measured mutation peak height/(mutation peak height + wild peak height), and drawing a correlation curve by using the theoretically configured mutation ratio (expected values) as an abscissa and the occupied values as an ordinate, as shown in fig. 10B, wherein the total correlation coefficient (R) of the two is2= 0.4132) is not high, but there is a significant inflection point of 10%. Therefore, we further refine the correlation analysis when the mutation ratio>At 10%, the mutation peak height/wild peak height has a clear linear relationship with the mutation ratio (R)2= 0.9853) (fig. 10C); when the mutation ratio is between 1% and 10%, the linear correlation coefficient of the two can reach 0.9716 (FIG. 10D). Therefore, it is also expected that the amplification of each batch of the system will increase 1%, 5%, 10% and 20% of the mutant/wild type DNA simultaneously as the standard of the system for the quantification of the ratio of the detected mutant DNA.
4.5 evaluation of System specificity
In the experiment, 10 cases of other virus infected patients (such as HCV-RNA positive, HIV antigen/antibody positive, HAV-IgM antibody and HEV-IgM antibody positive) and sera of healthy examinees are respectively adopted, DNA samples are extracted and then subjected to COLD-PCR/FMCA detection, and no non-specific result is found in an amplification curve and a melting curve. Meanwhile, a newly-built COLD-PCR/FMCA system is adopted to respectively detect wild strains and mutant strains plasmids with different concentrations (HBV DNA: 1.0E + 04-1.0E +06 IU/ml) for 3 times, corresponding wild peaks or mutant peaks are detected, abnormal miscellaneous peaks are not found, and the system specificity is good.
5. Comparison of methodology
650 HBsAg-positive serum samples were tested by the self-constructed COLD-PCR/FMCA method, 250 of which had HBV DNA below the limit of detection (< 5.0E +02 IU/ml); and simultaneously, a commercial HBV DNA nucleic acid quantitative detection kit and a hepatitis B virus genotyping and drug resistance detection kit are used for detecting the 650 samples, and patients with low-proportion mutation (mutation proportion is less than 20%) are subjected to Illumina Miseq high-throughput sequencing verification by selecting different types of mutation samples and wild samples so as to evaluate the detection accuracy of the self-construction method on the HBV DNA quantification, genotyping and mutation types and proportions.
5.1 HBV DNA quantitation results vs. commercial kits
The self-constructed COLD-PCR/FMCA method and commercial reagents (adopting qRT-PCR principle) are used for simultaneously detecting 650 HBV DNA, and linear correlation regression is carried out on the detection results, so that 250 HBV DNA samples with the concentration of 5.0E +02 IU/ml are not detected (the concentration is lower than the lower detection limit), and the coincidence rate of the two methods to the negative result is 100%. The results of the 400 positive specimens were analyzed by linear regression and bias analysis (FIG. 11) according to EP15-A3, the correlation coefficient between them was 0.9577, and the average deviation was 0.24%, indicating that the two methods also have good consistency in the detection of positive results of HBV DNA.
5.2 genotyping results compared to commercial sequencing kits
326 samples with HBV DNA more than or equal to 1.0E +04IU/ml are respectively detected by a COLD-PCR/FMCA method and a Sanger sequencing method, wherein 185 samples (56.7) of B genotypes, 128 samples (39.6) of C genotypes and 13 samples (4.0) of mixed genotypes are detected by a self-construction method, the proportion of the B or C genotypes in the mixed genotypes is below 20%, and the coincidence rate is 96.0% compared with the detection result of a commercial gene sequencing kit (192 samples of the B genotypes, 134 samples of the C genotypes and undetected mixed genotypes),kappa=0.921，P< 0.001), suggesting that the two methods are in good agreement (table 7).
TABLE 7 comparison of typing results of COLD-PCR/FMCA method and Sanger sequencing kit
5.3 comparison of Gene mutation results with commercial sequencing kits
The results of sequencing by COLD-PCR/FMCA and Sanger in 326 cases are shown in Table 8, and wild strain 259 (79.5%), pure mutant strain 2 (0.6%), mixed mutant strain 65 (20.0%) were detected by the self-constructed method, and the ratio thereof was low (mutant strain ratio)<20%) of the mixed mutant strains, and the coincidence rate was 82.5% when compared with the results of the commercial sequencing kit (316 wild strains, 2 mutant strains, and 8 mixed mutant strains) (269/326,kappa=0.223，P< 0.001). The results of the two HBV gene mutation detection methods are proved to have better consistency except for the low-proportion mixed mutant strains.
TABLE 8 comparison of the results of the COLD-PCR/FMCA method with the Sanger sequencing kit for gene mutation
5.4 comparison of COLD-PCR/FMCA assay results with Secondary sequencing results
As the requirement of the second generation sequencing on the HBV DNA concentration is more than or equal to 1.0E +04IU/ml, 20 mutant samples of different types and 10 samples without mutation detected in a system are selected from low-proportion mutant patients detected by COLD-PCR/FMCA to carry out Illumina Miseq high-throughput sequencing verification. As shown in Table 9, the results are shown in Table 9, wherein the numbers 1 to 6 are low-ratio mixed genotype samples detected, the numbers 7 to 15 are low-ratio single-site mutation samples detected, the numbers 16 to 18 are joint mutation samples detected, the numbers 19 to 20 are base groups with unknown mutation detected, and the numbers 21 to 30 are systems in which only wild plants are detected and no mutant genes are detected. A primary graph of the results of partial COLD-PCR/FMCA and second-generation sequencing assays is shown in FIG. 12. The results suggest that the qualitative and quantitative detection results of the two methods for genotype and mutation are basically consistent.
TABLE 9 comparison of COLD-PCR/FMCA with the results of second generation sequencing for HBV genotype detection and mutation
Note: underlined font represents the proportion of mutated genes detected. "-", no mutation was detected, "+", and a combination mutation was detected.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> Fujian medical university affiliated first hospital
<120> method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection
<130> 6
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 17
<212> DNA
<213> Artificial sequence
<400> 1
gcctcagtcc gtttctc 17
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
aaagggactc aagatgttgt 20
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<400> 3
ccagacagtg ggggaaagcc c 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence
<400> 4
actagtaaac tgagccagga g 21
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<400> 5
agtgccattt gttcagtggt t 21
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence
<400> 6
cagttatgtg gatgatgtgg t 21
Claims (2)
1. The application of the primer and the probe in preparing the reagent for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection is characterized by comprising the following specific steps:
1) designing and synthesizing the primer;
the primer is F: 5 'GCCTCAGTCCGTTTCTC 3', R:5 'AAAGGGACTCAAGATGTTGT 3';
2) design and Synthesis of probes for systems A and B:
system a: FAM-A: FAM-CCAGACAGTGGGGGAAAGCCC-BHQ1；
CY5-A：CY5-ACTAGTAAACTGAGCCAGGAG-BHQ2；
And (3) a system B: FAM-B: FAM-AGTGCCATTTGTTCAGTGGTT-BHQ 1;
CY 5-B: CY5-CAGTTATGTGGATGATGTGGT-BHQ 2; wherein the bold is a locked nucleic acid modified base; type specific bases are underlined;
3) constructing an asymmetric PCR/FMCA system for amplification, wherein the system is as follows;
system a: 2 XPremix Ex Taq 12.5. mu.l, 10 umol/L upstream primer 1.00. mu.l, 10 umol/L downstream primer 0.1. mu.l, 10 umol/L FAM probe 0.60. mu.l, 10 umol/L CY5 probe 0.60. mu.l, DNA template 5.00. mu.l, ROX correction fluid 0.25. mu.l, ddH2O4.95. mu.l, total volume 25.0. mu.l;
and (3) a system B: 2 × Premix Ex Taq 12.5. mu.l, 10. mu.l upstream primer 0.1. mu.l, 10. mu.l downstream primer 1.00. mu.l, 100.30. mu.l of umol/L FAM probe, 0.60. mu.l of 10 umol/L CY5 probe, 5.00. mu.l of DNA template, 0.25. mu.l of ROX calibration solution, ddH2O5.25 μ l, total volume 25.0 μ l;
4) extracting hepatitis B virus DNA, carrying out amplification on a system A and a system B by using the primers and the probes in the step 1) and the step 2) as amplification primers, configuring system components according to the step 3), and determining the denaturation temperature Tc of a key system to be 81.5 ℃ by changing the amplification denaturation temperature;
5) establishing COLD-PCR/FMCA reaction system conditions through Tc and determining HBV DNA concentration, genotype, mutation type and mutation ratio by combining probe melting curve analysis.
2. Use according to claim 1, characterized in that: the reaction conditions of COLD-PCR/FMCA were: the COLD-PCR/FMCA system reaction conditions are as follows: 30 s at 95 ℃; respectively collecting FAM and CY5 fluorescence signals when annealing extension at the temperature of 56 ℃ is finished in each cycle of 95 ℃ for 10 s, 56 ℃ for 30 s and 35 cycles; 81.5 ℃ for 10 s, 56 ℃ for 30 s, 30 cycles; the melting curve analysis conditions are as follows: 1min at 40 ℃; melting is carried out at a heating rate of 0.2 ℃/s from 40 ℃ to 80 ℃, and a fluorescence signal is collected at each temperature rise of 0.2 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810352275.XA CN108330213B (en) | 2018-04-19 | 2018-04-19 | Method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810352275.XA CN108330213B (en) | 2018-04-19 | 2018-04-19 | Method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108330213A CN108330213A (en) | 2018-07-27 |
| CN108330213B true CN108330213B (en) | 2021-07-13 |
Family
ID=62933458
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810352275.XA Active CN108330213B (en) | 2018-04-19 | 2018-04-19 | Method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108330213B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110982940A (en) * | 2019-12-30 | 2020-04-10 | 广州市疾病预防控制中心 | Composition and kit for detecting nucleic acid of measles virus, rubella virus and mumps virus based on melting curve |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103320531A (en) * | 2013-06-22 | 2013-09-25 | 福建医科大学附属第一医院 | New method capable of simultaneously detecting multiple HBV (hepatitis B virus) drug-resistant mutation sites |
| CN106367528A (en) * | 2016-08-26 | 2017-02-01 | 厦门大学 | Detection method of hepatitis B virus drug-resistant mutation |
-
2018
- 2018-04-19 CN CN201810352275.XA patent/CN108330213B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103320531A (en) * | 2013-06-22 | 2013-09-25 | 福建医科大学附属第一医院 | New method capable of simultaneously detecting multiple HBV (hepatitis B virus) drug-resistant mutation sites |
| CN106367528A (en) * | 2016-08-26 | 2017-02-01 | 厦门大学 | Detection method of hepatitis B virus drug-resistant mutation |
Non-Patent Citations (1)
| Title |
|---|
| 低变性温度共扩增PCR及其衍生技术的研究进展;王清等;《临床检验杂志》;20160228;第34卷(第2期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108330213A (en) | 2018-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111662958B (en) | Construction method of library based on nanopore sequencing platform, method for identifying microorganisms and application | |
| CN107488711B (en) | Method for detecting genotype of point mutation and kit thereof | |
| CN110577987B (en) | Detection method of FMR1 gene CGG repetitive sequence and application thereof | |
| CN111235272B (en) | Composition for once detecting multiple gene mutation of lung cancer and application thereof | |
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| CN102586456A (en) | Method for detecting copy number variations through multiple competitive polymerase chain reaction (PCR) | |
| CN113025701A (en) | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN110846409A (en) | Primer combination for detecting TNNI3K gene mutation and application thereof | |
| CN106566874B (en) | Specific primer group and detection kit for detecting mycoplasma pneumoniae drug-resistant mutant gene | |
| CN108330213B (en) | Method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection | |
| CN109321651A (en) | A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism | |
| CN112111609A (en) | Universal nucleic acid detection kit for enteroviruses | |
| CN111748628A (en) | Primer and kit for detecting thyroid cancer prognosis related gene variation | |
| CN113025702B (en) | Early screening method and kit for ankylosing spondylitis susceptibility genes | |
| CN115418394A (en) | Composition, kit and method for detecting CHO cell genome DNA | |
| CN116219040A (en) | Molecular marker, primer probe group and detection method for detecting lactobacillus plantarum S58 | |
| CN111172248B (en) | General kit for verifying copy number variation based on fragment analysis technology | |
| CN114085926A (en) | Primer, probe, kit and detection method for SNP site polymorphism of ABCB1 gene C3435T | |
| CN110951857A (en) | Digital PCR-based noninvasive prenatal detection method and kit for trisomy 21, 18 and 13 syndromes of fetus | |
| CN116814777B (en) | Kit for guiding related gene polymorphic sites by using hypertension and application method of kit | |
| CN109609661A (en) | A kind of combination of kidney-yang deficiency exogenous disease mouse model lung tissue qPCR reference gene and its screening technique | |
| CN116397027B (en) | Composite amplification system and kit for combined detection of KRAS/NRAS/BRAF genotyping | |
| CN109609694B (en) | Kit and method for detecting hepatitis B typing and multiple drug-resistant sites based on Illumina sequencing technology | |
| CN116949146A (en) | Method for detecting genome mutation proportion |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |