CN113186353A - Primer for digital PCR detection aiming at C-type retrovirus and detection method - Google Patents
Primer for digital PCR detection aiming at C-type retrovirus and detection method Download PDFInfo
- Publication number
- CN113186353A CN113186353A CN202110588688.XA CN202110588688A CN113186353A CN 113186353 A CN113186353 A CN 113186353A CN 202110588688 A CN202110588688 A CN 202110588688A CN 113186353 A CN113186353 A CN 113186353A
- Authority
- CN
- China
- Prior art keywords
- type
- detection
- digital pcr
- primer
- retrovirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 77
- 241001430294 unidentified retrovirus Species 0.000 title claims abstract description 66
- 238000007847 digital PCR Methods 0.000 title claims abstract description 55
- 238000006243 chemical reaction Methods 0.000 claims abstract description 21
- 210000004978 chinese hamster ovary cell Anatomy 0.000 claims abstract description 19
- 238000000034 method Methods 0.000 claims abstract description 18
- 239000000523 sample Substances 0.000 claims description 48
- 230000003321 amplification Effects 0.000 claims description 31
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 31
- 238000012408 PCR amplification Methods 0.000 claims description 11
- 238000003757 reverse transcription PCR Methods 0.000 claims description 10
- 238000013461 design Methods 0.000 claims description 9
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 8
- 102000004190 Enzymes Human genes 0.000 claims description 7
- 108090000790 Enzymes Proteins 0.000 claims description 7
- 239000012634 fragment Substances 0.000 claims description 2
- 241000700605 Viruses Species 0.000 abstract description 18
- 238000005516 engineering process Methods 0.000 abstract description 18
- 238000011002 quantification Methods 0.000 abstract description 9
- 210000004027 cell Anatomy 0.000 abstract description 6
- 238000001415 gene therapy Methods 0.000 abstract description 2
- 238000003908 quality control method Methods 0.000 abstract description 2
- 238000012216 screening Methods 0.000 abstract description 2
- 239000000047 product Substances 0.000 description 21
- 239000013612 plasmid Substances 0.000 description 19
- 239000002245 particle Substances 0.000 description 7
- 230000001177 retroviral effect Effects 0.000 description 6
- 238000012795 verification Methods 0.000 description 6
- 238000002474 experimental method Methods 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 108020004707 nucleic acids Proteins 0.000 description 4
- 102000039446 nucleic acids Human genes 0.000 description 4
- 150000007523 nucleic acids Chemical class 0.000 description 4
- 108090000623 proteins and genes Proteins 0.000 description 4
- 108020004414 DNA Proteins 0.000 description 3
- 108010008281 Recombinant Fusion Proteins Proteins 0.000 description 3
- 102000007056 Recombinant Fusion Proteins Human genes 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000000746 purification Methods 0.000 description 3
- 238000003753 real-time PCR Methods 0.000 description 3
- 238000007480 sanger sequencing Methods 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 238000011144 upstream manufacturing Methods 0.000 description 3
- 230000003612 virological effect Effects 0.000 description 3
- 241000699802 Cricetulus griseus Species 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 230000000903 blocking effect Effects 0.000 description 2
- 238000004364 calculation method Methods 0.000 description 2
- 238000004113 cell culture Methods 0.000 description 2
- 239000002299 complementary DNA Substances 0.000 description 2
- 238000009826 distribution Methods 0.000 description 2
- 239000012535 impurity Substances 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 239000013641 positive control Substances 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 238000010791 quenching Methods 0.000 description 2
- 230000000171 quenching effect Effects 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 229960005486 vaccine Drugs 0.000 description 2
- 108060002716 Exonuclease Proteins 0.000 description 1
- 102100034343 Integrase Human genes 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 238000002123 RNA extraction Methods 0.000 description 1
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 1
- 238000011529 RT qPCR Methods 0.000 description 1
- 108010008038 Synthetic Vaccines Proteins 0.000 description 1
- 108020000999 Viral RNA Proteins 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 229940125644 antibody drug Drugs 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000012620 biological material Substances 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 238000012864 cross contamination Methods 0.000 description 1
- 239000012228 culture supernatant Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000001493 electron microscopy Methods 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 102000013165 exonuclease Human genes 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 210000002950 fibroblast Anatomy 0.000 description 1
- 239000001046 green dye Substances 0.000 description 1
- 239000001963 growth medium Substances 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000009776 industrial production Methods 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 238000012803 optimization experiment Methods 0.000 description 1
- 210000001672 ovary Anatomy 0.000 description 1
- 230000007017 scission Effects 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000004557 single molecule detection Methods 0.000 description 1
- 238000011895 specific detection Methods 0.000 description 1
- 238000004114 suspension culture Methods 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The application belongs to the technical field of virus detection, and particularly relates to a digital PCR (dPCR) detection technology patent application for C-type retroviruses. A primer group is designed aiming at the C-type retrovirus, and the method is suitable for digital PCR detection application. In the prior art, the QPCR technology is the most commonly used technology when detecting C-type retroviruses in CHO cells. However, in view of the problem of the accuracy of the QPCR detection result, in order to further improve the detection accuracy, in combination with the emerging digital PCR technology of absolute quantification, the inventors of the present application have significantly improved the accuracy of C-type retrovirus detection by screening a specific primer sequence and optimizing a reaction system, have improved the quality control standard using CHO cells as a host expression system, and have provided good reference for the application of other virus detection and cell gene therapy technologies.
Description
Technical Field
The application belongs to the technical field of virus detection, and particularly relates to a digital PCR (dPCR) detection technology patent application for C-type retroviruses.
Background
Chinese Hamster Ovary (CHO) cells are a common cell in the production of recombinant proteins and vaccines for pharmaceutical use and have the following excellent characteristics: (1) is suitable for suspension culture and can meet the requirement of large-scale industrial production of recombinant protein; (2) the produced antibody molecule is closer to the natural antibody molecule in structure and function; (3) the human viruses are contained rarely; (4) the exogenous gene can be stably integrated in CHO cells; (5) the CHO cell is a fibroblast and hardly secretes endogenous protein, so that the CHO cell is very beneficial to the separation and purification work of the target recombinant antibody.
Although CHO cells are free of human viruses and are widely used. However, it has been shown that CHO cells express endogenous retrovirus-like particles, and that 10 can be detected in cell supernatants3~109The presence of C-type retroviral particles in CHO cells was clearly observed by electron microscopy for the presence of/ml of retrovirus-like particles. Therefore, in order to ensure the safety of recombinant protein drugs such as antibody drugs and vaccines expressed and produced in CHO cells, accurate detection and quantification of the amount of relevant virus particles, especially C-type retrovirus in CHO cell line, are required in the production process and after purification.
In the prior art, the most commonly used molecular detection method is the fluorescent quantitative pcr (qpcr) method, which can specifically detect the content of C-type retroviral particles by using the Taqman probe method. Since each retroviral particle contains two viral genomic RNA molecules, the viral content per preparation can be deduced by measuring the viral genomic RNA copy number. However, since the fluorescence quantitative PCR is a relative quantification, a standard curve needs to be drawn by using a standard substance when the virus copy number is absolutely quantified, so that the virus copy number detection result mainly depends on the accuracy of the standard substance (standard curve). However, in the actual detection and quantification, the factors affecting the accuracy of the quantitative PCR detection result include: amplification efficiency, PCR interference factors, accuracy of standard, and the like. In addition, in the quantitative detection of the C-type retrovirus, the CHO cell culture supernatant is generally used for purifying virus nucleic acid, and a large amount of impurities such as cell debris, protein, impurity nucleic acid and the like in the supernatant can also interfere with PCR amplification, thereby causing inaccurate detection results. Based on these problems, a better and simpler method for accurately quantifying the virus copy number is urgently needed, so that a foundation is laid for accurately determining the content of related viruses.
The digital PCR technology is a third-generation PCR technology, is a single-molecule amplification technology, and is an absolute quantitative technology independent of a standard product. Compared with the traditional fluorescence quantification, the method can realize single molecule detection and has the advantages of high detection accuracy, high sensitivity and PCR amplification inhibition resistance. The same as QPCR, the digital PCR technology can utilize TaqMan probe or SYBR Green dye to detect fluorescent signal, and finally utilizes an end-point signal detection method and Poisson distribution statistical calculation to realize absolute quantification of the sample.
In view of the fact that QPCR still has a remarkable improvement space in the detection of C-type retrovirus in CHO cells, how to utilize the digital PCR technology to realize and improve the detection work of C-type retrovirus in CHO cells has very important technical significance for ensuring the stability of the quality of related products.
Disclosure of Invention
Aiming at the C-type retrovirus in the existing CHO cell, the application aims to provide a group of primers for digital PCR detection of the C-type retrovirus, thereby laying a certain technical foundation for accurate detection and quantification of related virus particles.
The technical solution adopted in the present application is detailed as follows.
A primer group for digital PCR detection of C-type retrovirus, which is designed for C-type retroviruses (GenBank access number: U09104) and is suitable for digital PCR (dPCR) detection application, and the specific primer design is as follows:
C-type-F：5’-ccggacccctgagtcacc -3’，
C-type-R：5’-taccagtcgcgagctggag -3’；
C-type-Probe: FAM-TGGGTACAGGGAGCTACAGGCGGAA-BHQ 1;
when the primer group is used for PCR amplification, the length of an amplified fragment is 99bp, and an amplification sequence is shown as SEQ ID No.1, and specifically comprises the following steps:
ccggacccctgagtcaccggactgcatgggtacagggagctacaggcggaaagcagtaccattggactacaaatcggcagctccagctcgcgactggta。
a kit for digital PCR amplification detection based on the primer set for digital PCR detection.
The digital PCR detection method of the C-type retrovirus based on the primer group for digital PCR detection uses the RNA of the C-type retrovirus as a template to carry out digital PCR amplification; the 15. mu.l reaction system was designed as follows:
RNA template, 3. mu.l;
C-type-F，10μM、0.6μl；
C-type-R，10μM、1.2μl；
c-type-probe, 10. mu.M, 0.36. mu.l;
2X RT-PCR Buffer, 7.5. mu.l;
25 × RT-PCR Enzyme Mix, 0.6 μ l;
NF water (nuclease-free water), 1.74. mu.l;
the specific PCR reaction procedure is as follows: at 45 deg.C for 10 min; 95 deg.C for 10 min; 95 ℃ for 50 s; 57 ℃, 30s, 72 ℃, 1min30s, 40 cycles; 72 ℃ for 5 min; storing at 4 ℃.
In the prior art, the QPCR technology is the most commonly used technology when detecting C-type retroviruses in CHO cells. However, in view of the problem of the accuracy of the QPCR detection result, in order to further improve the detection accuracy, in combination with the emerging digital PCR technology of absolute quantification, the inventors of the present application have significantly improved the accuracy of C-type retrovirus detection by screening a specific primer sequence and optimizing a reaction system, have improved the quality control standard using CHO cells as a host expression system, and have provided good reference for the application of other virus detection and cell gene therapy technologies.
Drawings
FIG. 1 shows the detection result of the C-type1 primer set for NTC; as can be seen from the figure: no signal;
FIG. 2 shows the result of detecting the pUCM-T-Cvirus plasmid with the C-type1 primer set; as can be seen, there is a signal, but the positive signal and the background signal are not distinguished, which indicates that the C-type1 primer group is not suitable for the detection of the C-type retrovirus;
FIG. 3 shows the detection result of the C-type2 primer set against NTC; as can be seen, there is no signal;
FIG. 4 shows the result of detecting the pUCM-T-Cvirus plasmid with the C-type2 primer set; as can be seen, there is a signal, but the positive signal and the background signal are not distinguished, which indicates that the C-type2 primer group is not suitable for the detection of the C-type retrovirus;
FIG. 5 shows the detection result of the C-type primer set against NTC; as can be seen, there is no signal;
FIG. 6 shows the result of detection of the C-type primer set for the pUCM-T-Cvirus plasmid; as can be seen, there is a signal, but the background signal is too high, reducing the probe concentration detection;
FIG. 7 shows the result of detection of the C-type primer set for the pUCM-T-Cvirus plasmid; repeat1 and repeat2 are two duplicate wells of pUCM-T-Cvirus plasmid, respectively, and the results in the figure show that the C-type primer set is suitable for detecting C-type retrovirus;
FIG. 8 shows the results of detection of a C-type primer set for a C-type retrovirus sample; as can be seen, the positive signal and the background signal are well distinguished, the data is accurate, and the optimized system condition and the C-type primer group are suitable for detecting the C-type retrovirus;
FIG. 9 shows the result of electrophoresis of C-type amplification products; the result shows that the size of the C-type primer group digital PCR amplification product is consistent with that of the product designed theoretically;
FIG. 10 is a comparison of the sequencing results of the amplification products of the C-type primer set with the genome of a C-type retrovirus; the results showed complete sequence identity.
Detailed Description
The present application is further illustrated by the following examples. Before describing the specific embodiments, a brief description will be given of some experimental background cases in the following embodiments.
Related biological materials:
CHO cell lines (used for extraction of C-type retroviral genomic RNA), purchased from ATCC;
a pUCM-T vector (2773 bp, which is a gene sequence for synthesizing the C-type reverse transcriptase and is inserted into the pUCM-T vector) is provided by a biological organism;
a C virus plasmid standard (recombinant plasmid pUCM-T-Cvirus based on pUCM-T vector, length: 4289 bp; concentration: 100 ng/ul) provided by Shanghai Biotechnology corporation;
primers and probes for detecting related type C retroviruses were synthesized and supplied by Invitrogen corporation;
the main reagents are as follows:
QIAamp MinElute virus purification kit (for extracting C-type retrovirus genome RNA in CHO cell line culture medium), QIAGEN products;
AgPath-ID (Life, AM 1005) kit (for digital PCR amplification reaction), product of Life corporation;
digital PCR blocking oil (blocking each microwell, preventing cross contamination), JN Medsys products;
the main apparatus comprises:
the Clarity digital PCR System, JN Medsys, Singapore.
Example 1
The method aims to provide a digital PCR detection technology aiming at the C-type retrovirus in CHO cells by taking the RNA detection of the C-type retrovirus as a target, thereby laying a certain technical foundation for the detection accuracy and the safety application of related products.
Since the design of specific primers and probes is required before the application of the digital PCR technology, the design principles of primers and probes are briefly introduced as follows.
In the present application, based on the RNA sequence of C-type retrovirus, in combination with the general primer design principle, the design of dPCR primer mainly takes into account the following factors:
the length of the amplification product is about 60-100 bp; the product cannot form a secondary structure; the length of the primer is designed to be 15-30 nt; the content of G and C is between 40 and 60 percent; the four bases are randomly distributed; the 5' end of the primer for detecting the C-type retrovirus does not need to be modified; primer 3' may not modify any group; the last 5 bases at the 3' end of the primer have at least one (at most 2-3) G or C.
In designing the dPCR probe (Taqman probe), the following principles are considered with reference to a general design method:
the optimal length is 20nt (no more than 30 nt), the length is more than 30nt, but the distance between the fluorescent group and the quenching group is 18-25 nt;
the dissolving temperature (Tm) value of the Taqman probe is required to be about 10 ℃ higher than that of a primer, and is usually between 65 ℃ and 70 ℃; continuous single base repeats, especially G, should be avoided as this may affect the secondary structure of the probe and reduce hybridization efficiency;
the 5' end of the probe should not contain too much G, because the G base quenches the fluorescent signal; the G/C content of the probe is about 50% (ideally 30% -80%), and if the amplified sequence is rich in AT sequence, nucleic acid analogues such as LNA (locked nucleic acid) or MGB can be doped;
the length of the MGB modified probe is about 15 nt; the 5 'end of the probe is as close as possible to the 3' end of the upstream primer, but it does not overlap to ensure rapid probe cleavage by the Taq enzyme.
It should be introduced that the TaqMan probe has a high specificity, and thus is suitable for use as a primer probe for digital PCR detection. In general, digital PCR primer design requires the same qPCR; however, the digital PCR probe is generally located at the middle of the amplification of the upstream and downstream amplification primers (closer to the upstream). The probe is a sequence with the length of 18-30nt, the 5 'end of the probe is marked with a fluorescent group, and the 3' end of the probe is marked with a quenching group. In the reaction process, the free probe does not emit light, but in the PCR amplification process, because Taq enzyme has 5 '-3' exonuclease activity, the encountered TaqMan probe is hydrolyzed so as to emit fluorescence, and finally, absolute quantification of the digital PCR on a sample is realized by utilizing end point signal detection and Poisson distribution statistical calculation.
Based on the above principle, the inventors preliminarily designed a series of primer pairs and corresponding probes for the C-type retrovirus genome, as follows.
C-type1 primer set:
C-type1-F：5’- atcggtcacccggaccc -3’，
C-type1-R：5’- ggagctgccgatttgtagtcc-3’；
c-type 1-Probe: FAM-caccggactgcatgggtacagg-BHQ 1;
using the above primers, the specific amplification sequence was as follows (93 bp):
atcggtcacccggacccctgagtcaccggactgcatgggtacagggagctacaggcggaaagcagtaccattggactacaaatcggcagctcc。
c-type2 primer set:
C-type2-F：5’- agagctcaaatacactttgagagg-3’，
C-type2-R：5’- tggacattgtcaagatggtaaggg-3’；
c-type 2-Probe: FAM-cagaagtcaaagtcacagggccagaggg-BHQ 1;
using the primers, the specific amplification sequence was as follows (82 bp):
Agagctcaaatacactttgagaggtcagaagtcaaagtcacagggccagagggaattccccttaccatcttgacaatgtcca。
c-type primer set:
C-type-F：5’-ccggacccctgagtcacc -3’，
C-type-R：5’-taccagtcgcgagctggag -3’；
C-type-Probe: FAM-TGGGTACAGGGAGCTACAGGCGGAA-BHQ 1;
using the above primers, the specific amplification sequence was as follows (99 bp):
ccggacccctgagtcaccggactgcatgggtacagggagctacaggcggaaagcagtaccattggactacaaatcggcagctccagctcgcgactggta。
specifically, the cDNA sequence (1522 bp) of the C-type retrovirus referred to in the present application is as follows:
atgattgtgagcagattttgcaggttcttttaacctcggaagagaaacagcgtgttctactagaggcacgaaagaatgtcccaggagccaacgggcagcccacccagctgcccaatgaaatcgatgcggcttgccctcttgaaagacctgaatgggattttactactgaagcaggtaggacccatctgcgtctctatcgccagttgctggtgcgggtctccggggggcaggacgccgacctaccaatttggcccaggtaaagcaggtaatacagggggcggaggaatcgcccgccacttttctagagagactaaaaggagcatatagaatgtatactccctatgatccagaagatccagggcaggccaccacgcttgctatctcttatttggcagtcagccccggacataagaaacaagctccaaaggctagaaaatttacaaggatatactctccaagacttgttaaaggaagcagaacgtatttctaataagagagagacacagacagaaagagaagaacgttggagaaaggaagccaggagagagaggaaagactgagaaagagcagaggagaaagaggctgcaagagaccgtaagcggaatagagagatgagcaggctattggccacagtagtgacaggtcagagacagaataggcagagggatggcagaagggggccccacctggacagggatcaatgcgcttactgcaaagaaaaaggacattgggcaaaagaatgccctaagaacccccgggccaagcctccacggccaagaacctctgaccttctaaacctagaagattagagaagtcagggccaggagcccccccctgagcccaggataacactgcaagtcggggggcatccggtcaccttcctagtagatacaggggcacaacattccgttctgaatcggtcacccggacccctgagtcaccggactgcatgggtacagggagctacaggcggaaagcagtaccattggactacaaatcggcagctccagctcgcgactggtaaggttatgcattctttcctccatgtgccagattgcccctaccccttacctaggacgggacctattgaccaaattaagagctcaaatacactttgagaggtcagaagtcaaagtcacagggccagagggaattccccttaccatcttgacaatgtccatagaagatgaatacagactccatgaaaagaggactaattcgaacaatcaggaaacccttgatcactggcttgcggaatttccccaagcctgggctgaaacaggaggaatggccttgccatcaaccaggccccaattatagtaaccttaaaagctgccatccttcctgcatccgtcagacagtatccaatgcctaaagaagcccgagaaggaattcggccacatattaaaagttacttgaacaagggattctggtgccctgtaaatctccttggaatacacctttgttgcccgtcaggaagccaggaaccaatgactataggccagtacaggatctgagggag。
the primer is designed primarily aiming at the sequence, and obviously, from the practical detection point of view, further detection verification is required to prove the effectiveness and the accuracy of the primer. For this reason, the inventors have carried out relevant practical verification, and the specific experimental procedures are summarized as follows.
(I) design and preparation of different control samples
Positive Control (PC) -like template for PCR amplification: a pUCM-T plasmid is used as a vector to recombine and integrate a cDNA sequence of the C-type retrovirus (the recombined plasmid is provided by a biological organism), and the recombined plasmid pUCM-T-Cvirus is used as a template for PCR amplification.
Blank NTC negative control: nuclease-free water (NF water) was used as a template for PCR amplification.
C-type retrovirus RNA extraction: free C-type retroviral RNA was extracted from cell culture using the QIAamp MinElute viral RNA kit, with reference to the instructions.
(II) PCR amplification
And (3) carrying out PCR amplification by combining different primer groups with different templates for PCR amplification in the step (I) by adopting a Clarity digital PCR instrument. The 15. mu.l amplification system was designed as follows:
template, 3. mu.l;
C-type-F，10μM、0.6μl；
C-type-R，10μM、1.2μl；
c-type-probe, 10. mu.M, 0.6. mu.l;
2X RT-PCR Buffer, 7.5. mu.l;
25 × RT-PCR Enzyme Mix, 0.6 μ l;
NF water，1.38μl。
the reaction procedure is as follows: at 45 deg.C for 10 min; 95 deg.C, 10min, 95 deg.C, 50s, 57 deg.C, 30s, 72 deg.C, 1min30s, 40 cycles; 72 ℃ for 5 min; storing at 4 ℃.
PCR reactions were repeated 3 times for each primer set, and for each template sample. The experimental results of different primer groups are plotted after statistics as shown in FIGS. 1 to 6. The specific description is as follows.
The results of the experiments on the C-type1 primer set are shown in FIGS. 1 and 2. It can be seen that C-type1 detects that the NTC has no signal. The detection of the C-type1 shows that pUCM-T-Cvirus has a positive signal, but the positive signal and the background signal are not distinguished, which indicates that the C-type1 primer probe is not suitable for the detection of the C-type retrovirus. (i.e., when C-type1 is used for dPCR verification, positive and background signals are indistinguishable, and C-type1 is ineffective in detecting C-type retroviruses)
The results of the experiments on the C-type2 primer set are shown in FIGS. 3 and 4. As can be seen, the C-type2 has no signal when detecting NTC, and has a positive signal when detecting pUCM-T-Cvirus, but the positive signal and the background signal are not separated, which indicates that the C-type2 primer probe is not suitable for digital PCR detection. (i.e., when C-tpye2 is used for dPCR detection, the positive signal and the background signal are not distinguished, and C-type2 does not detect C-type retrovirus)
The results of the experiments on the C-type primer set are shown in FIGS. 5 and 6. The C-type primer amplifies NTC and C virus plasmid DNA, and the result shows that NTC has no signal, and C virus plasmid has positive signal, but the background signal is too high, which is supposed to be the reason of too high probe concentration, therefore, the reaction system needs to be further optimally designed.
Example 2
Based on the preliminary verification of the embodiment 1, the inventors performed further optimization experiments for the C-type primer set in order to further optimize the related detection effect, and the related optimization process and the result are briefly described as follows.
(I) solving the problem of overhigh background signal of the C virus plasmid during the detection of the C-type primer group from the perspective of a reaction system
To solve the problem of excessive background signal of C-type primer set for detection of C-type retrovirus plasmid, based on the existing experience and the prior art, the inventors preliminarily considered to appropriately reduce the probe concentration, thereby reducing the probe background fluorescence signal (i.e., background signal of digital PCR). Therefore, the inventors reduced the concentration of the C-type probe by about half, redesigned the reaction system, and performed PCR verification. Specifically, the method comprises the following steps:
the 15. mu.l reaction system was designed as follows:
template, 3. mu.l;
C-type-F，10μM、0.6μl；
C-type-R，10μM、1.2μl；
c-type-probe, 10. mu.M, 0.36. mu.l;
2X RT-PCR Buffer, 7.5. mu.l;
25 × RT-PCR Enzyme Mix, 0.6 μ l;
NF water，1.74μl。
the reaction procedure is as follows: at 45 deg.C for 10 min; 95 deg.C, 10min, 95 deg.C, 50s, 57 deg.C, 30s, 72 deg.C, 1min30s, 40 cycles; 72 ℃ for 5 min; storing at 4 ℃.
The results of the different primer sets are shown in FIG. 7 and Table 1 below.
Specific test data results referred to in Table 1, FIG. 7
The specific description is as follows.
Results of detection of C-type retrovirus by C-type primer (shown in FIG. 7, Table 1): NTC of 0.00copies/ul, repeat1 and repeat2 were the results of two duplicate wells against the pUCM-T-Cvirus plasmid, which were 2.06X 1010copies/ul、 2.12×1010copies/ul, whereas the theoretical value for the C-type retroviral plasmid is 2.16X 1010(theoretical copy number of plasmid can be calculated according to plasmid concentration: 100 ng/ul; plasmid size: 4289 bp), the difference value between the digital PCR detection result (average value of multiple wells) and the theoretical result is 3.24%, and the confidence interval cv of 95% is<And 10%, indicating that the detection result is accurate. In addition, C-type detects the value of the difference between 2 duplicate wells of C-type retroviruses<10 percent, which shows that the repeatability of the multiple holes is better. The C-type primer pair is shown to be suitable for detecting the C-type retrovirus under an optimized system.
Specific detection application of optimized system
And (3) specifically detecting the C-type retrovirus sample by using the optimized reaction system to evaluate the application effect of the C-type in the quantitative detection of the C-type retrovirus. The specific experimental conditions are briefly described below.
The specific 15. mu.l reaction system was designed as follows:
type C retrovirus RNA template, 3 μ l;
C-type-F，10μM、0.6μl；
C-type-R，10μM、1.2μl；
c-type-probe, 10. mu.M, 0.36. mu.l;
2X RT-PCR Buffer, 7.5. mu.l;
25 × RT-PCR Enzyme Mix, 0.6 μ l;
NF water，1.74μl。
the reaction procedure is as follows: at 45 deg.C for 10 min; 95 deg.C for 10 min; 95 ℃ for 50 s; 57 ℃, 30s, 72 ℃, 1min30s, 40 cycles; 72 ℃ for 5 min; storing at 4 ℃.
The specific results are shown in fig. 8 and table 2 below.
Specific test data results referred to in Table 2, FIG. 8
Specifically, the method comprises the following steps: NTC is 0.00 copies/ul; the C-type retrovirus sample is 3041.3copies/ul, and the difference of the three experimental results in a 95% confidence interval is less than 10%, which indicates that the detection result is accurate.
In conclusion, it is considered that the C-type primer set can accurately detect the C-type retrovirus sample without copy number in the NTC by optimizing the reaction system and the reaction procedure.
(III) verification of specificity of amplification product of C-type primer
As shown in the previous detection results, the C-type primer group can accurately detect the C-type retrovirus sample, and the NTC has no copy number. To determine the specificity of the amplification products of the C-type primer set, the inventors further examined and verified by agarose gel electrophoresis and Sanger sequencing, and the detailed experimental conditions are summarized below.
Agarose gel electrophoresis
The amplification product of the C-type retrovirus after Clarity digital PCR amplification was recovered and electrophoresed in 2% agarose gel, the result of which is shown in FIG. 9.
For specific results: the band of the amplification product of the C-type retrovirus appears about 100bp of DNA marker, and when the primers are designed, the size of the amplification product of the C-type primer group is 99bp, which can indicate that the amplification product of the C-type retrovirus is a specific C-type retrovirus.
Sanger sequencing
To further confirm the amplification specificity of the C-type primer set, the product recovered by Clarity digital PCR was subjected to clone Sanger sequencing (the sequencing result is: gagctagcatcatgctacggtcaaccggacccctgagtcaccggactgcatgggtacagggagctacaggcggaaagcagtaccattggactacaaatcggcagctccagctcgcgactggtacaggatcgtagcacta), and the sequencing result and the C-type retrovirus sequence were aligned by Snapgene (the results are shown in FIG. 10), and the results showed that the amplification product sequence was completely identical to the C-type retrovirus sequence, indicating that the amplification product of the C-type primer set was specific.
From the above results, the C-type primer set can be used for Clarity digital PCR to accurately quantify the C-type retrovirus.
Sequence listing
<110> Hangzhou Jingbai Biotechnology Ltd
<120> primers for digital PCR detection of C-type retrovirus and detection method
<130> none
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 99
<212> DNA
<213> C-type retrovirus
<400> 1
ccggacccct gagtcaccgg actgcatggg tacagggagc tacaggcgga aagcagtacc 60
attggactac aaatcggcag ctccagctcg cgactggta 99
Claims (6)
1. The primer group for digital PCR detection of the C-type retrovirus is characterized in that the primer group is designed for the C-type retrovirus and is suitable for digital PCR detection application, and the specific primer design is as follows:
C-type-F：5’-ccggacccctgagtcacc -3’，
C-type-R：5’-taccagtcgcgagctggag -3’；
C-type-Probe: FAM-TGGGTACAGGGAGCTACAGGCGGAA-BHQ 1;
when the primer group is used for PCR amplification, the length of an amplified fragment is 99bp, and an amplification sequence is shown as SEQ ID No.1, and specifically comprises the following steps:
ccggacccctgagtcaccggactgcatgggtacagggagctacaggcggaaagcagtaccattggactacaaatcggcagctccagctcgcgactggta。
2. a kit for digital PCR amplification detection based on the primer set for digital PCR detection of C-type retrovirus.
3. The primer group for digital PCR detection of the C-type retrovirus is applied to detection of the C-type retrovirus, and is characterized by being used for detecting the C-type retrovirus in CHO cells.
4. The method for digital PCR detection of a C-type retrovirus, which is based on the primer set for digital PCR detection of a C-type retrovirus, is characterized in that the RNA of the C-type retrovirus is used as a template to carry out digital PCR amplification.
5. The digital PCR detection method according to claim 4, wherein the 15. mu.l reaction system is designed as follows during digital PCR amplification:
RNA template, 3. mu.l;
C-type-F，10μM、0.6μl；
C-type-R，10μM、1.2μl；
c-type-probe, 10. mu.M, 0.36. mu.l;
2X RT-PCR Buffer, 7.5. mu.l;
25 × RT-PCR Enzyme Mix, 0.6 μ l;
NF water，1.74μl。
6. the digital PCR detection method of claim 5, wherein during the digital PCR amplification, the specific PCR reaction procedure is as follows: at 45 deg.C for 10 min; 95 deg.C for 10 min; 95 ℃ for 50 s; 57 ℃, 30s, 72 ℃, 1min30s, 40 cycles; 72 ℃ for 5 min; storing at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110588688.XA CN113186353A (en) | 2021-05-28 | 2021-05-28 | Primer for digital PCR detection aiming at C-type retrovirus and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110588688.XA CN113186353A (en) | 2021-05-28 | 2021-05-28 | Primer for digital PCR detection aiming at C-type retrovirus and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113186353A true CN113186353A (en) | 2021-07-30 |
Family
ID=76985636
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110588688.XA Pending CN113186353A (en) | 2021-05-28 | 2021-05-28 | Primer for digital PCR detection aiming at C-type retrovirus and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113186353A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321569A (en) * | 2018-10-29 | 2019-02-12 | 凯杰（苏州）转化医学研究有限公司 | A kind of primer combination of probe object and its application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1169161A (en) * | 1994-10-07 | 1997-12-31 | 东卡罗来纳大学 | Attenuated viruses and method of making same |
| WO1999058701A1 (en) * | 1998-05-13 | 1999-11-18 | Genetix Pharmaceuticals, Inc. | Novel lentiviral packaging cells |
| EP1061129A1 (en) * | 1999-05-18 | 2000-12-20 | Etablissement de Transfusion Sanguine de Lyon | Infectious retroviruses from a leukemic dog cell line with extensive homologies to murine leukemia viruses |
| CN104388582A (en) * | 2014-10-29 | 2015-03-04 | 雷永良 | Digital PCR detection kit and detection method for A-type universal flu virus |
| CN109468412A (en) * | 2018-12-14 | 2019-03-15 | 河南普诺易生物制品研究院有限公司 | Primer, kit and the method for 2117 virus pollution of Vesivirus in a kind of detection Chinese hamster ovary celI |
-
2021
- 2021-05-28 CN CN202110588688.XA patent/CN113186353A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1169161A (en) * | 1994-10-07 | 1997-12-31 | 东卡罗来纳大学 | Attenuated viruses and method of making same |
| WO1999058701A1 (en) * | 1998-05-13 | 1999-11-18 | Genetix Pharmaceuticals, Inc. | Novel lentiviral packaging cells |
| EP1061129A1 (en) * | 1999-05-18 | 2000-12-20 | Etablissement de Transfusion Sanguine de Lyon | Infectious retroviruses from a leukemic dog cell line with extensive homologies to murine leukemia viruses |
| CN104388582A (en) * | 2014-10-29 | 2015-03-04 | 雷永良 | Digital PCR detection kit and detection method for A-type universal flu virus |
| CN109468412A (en) * | 2018-12-14 | 2019-03-15 | 河南普诺易生物制品研究院有限公司 | Primer, kit and the method for 2117 virus pollution of Vesivirus in a kind of detection Chinese hamster ovary celI |
Non-Patent Citations (3)
| Title |
|---|
| CHRISTINA DE WIT等: "Real-time Quantitative PCR for Retrovirus-like Particle Quantification in CHO Cell Culture", 《BIOLOGICALS》 * |
| YOLANDA S. LIE等: "Chinese Hamster Ovary Cells Contain Transcriptionally Active Full-Length Type C Proviruses", 《JOURNAL OF VIROLOGY》 * |
| 何士勤等: "C型逆转录病毒与人类白血病关系的探讨", 《中国人兽共患病杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321569A (en) * | 2018-10-29 | 2019-02-12 | 凯杰（苏州）转化医学研究有限公司 | A kind of primer combination of probe object and its application |
| CN109321569B (en) * | 2018-10-29 | 2022-04-12 | 迈杰转化医学研究(苏州)有限公司 | Primer probe composition and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3792364A1 (en) | Method for detecting nucleic acid based on prokaryotic argonaute protein and application thereof | |
| CN105861678B (en) | Design method of primer and probe for amplifying low-concentration mutation target sequence | |
| CN101838683B (en) | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene | |
| CN113278733A (en) | Combination of primer and probe for detecting mutant strain of new coronavirus | |
| CN108624716B (en) | seven-PCR primer group for simultaneously detecting seven waterfowl susceptibility viruses and detection method thereof | |
| CN115058543A (en) | Primer group and kit for identifying Delta variant strain and Omicron variant strain | |
| CN113186353A (en) | Primer for digital PCR detection aiming at C-type retrovirus and detection method | |
| CN108060213B (en) | Probe and kit for detecting SNP (single nucleotide polymorphism) sites by recombinase-mediated isothermal amplification method based on probe guidance | |
| CN107338287B (en) | Kit and method for detecting sheep BMPR-IB gene A746G mutation by Taqman-MGB probe | |
| TW201321520A (en) | Method and system for virus detection | |
| CN106555011B (en) | Compositions and methods for genetic testing or genotyping | |
| CN113789368B (en) | Nucleic acid detection kit, reaction system and method | |
| CN115418394A (en) | Composition, kit and method for detecting CHO cell genome DNA | |
| WO2014027663A1 (en) | Primer set for detecting bovine leukemia virus and use thereof | |
| CN116254371A (en) | Primer molecular beacon combination for wild type and mutant molecular typing of monkey pox virus and application thereof | |
| CN113502353A (en) | Application of integrated high-frequency gene locus of high-intermediate-risk HPV (human papilloma virus) related to cervical cancer occurrence | |
| CN112553349A (en) | Identification primer, probe, kit and method for homozygote and heterozygote of Hulunbel short-tailed sheep | |
| CN113005223A (en) | Primer for digital PCR detection aiming at RCR/RCL and detection method | |
| CN112961939A (en) | Novel coronavirus SARS-CoV-2 loop-mediated isothermal amplification kit and application thereof | |
| CN114703288B (en) | Blocker probe and primer group for amplifying EGFR-T790M gene variation and application thereof | |
| CN105603055B (en) | Multiplex polymerase chain reaction method and application thereof | |
| CN112662817B (en) | Primer probes, target combinations, kits and methods for detecting Latinovirus, Mobala virus and Mopeya virus | |
| CN114606229B (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer set and detection method for yam latent viruses | |
| CN114250273B (en) | Compositions for nucleic acid detection | |
| CN117431345A (en) | qPCR primer probe group, kit and method for detecting AAV genome titer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210730 |
|
| RJ01 | Rejection of invention patent application after publication |