CN114686517A

CN114686517A - Preparation method of HCV four-receptor transgenic combined STAT1 knockout mouse

Info

Publication number: CN114686517A
Application number: CN202011565016.9A
Authority: CN
Inventors: 杨威; 林田莉; 李端
Original assignee: Institute of Pathogen Biology of CAMS
Current assignee: Institute of Pathogen Biology of CAMS
Priority date: 2020-12-25
Filing date: 2020-12-25
Publication date: 2022-07-01

Abstract

The invention provides a STAT1 gene knockout mouse (4 hEF for short) constructed by a technology of combining CD81, CLDN1, OCLN and SRB1 four-receptor transgenes with CRISPR/Cas9^Tg STAT1^‑/‑Mouse), a four-receptor transgenic mouse is obtained according to a transgenic technology and a microinjection method, and a STAT1 knockout mouse is obtained by designing a target gene sgRNA based on a CRISPER/Cas9 system and performing the microinjection method; crossing the four-receptor transgenic mouse with STAT1 knockout mouse to obtain heterozygous F1 generationObtaining homozygous 4hEF through F1 generation selfing^Tg STAT1^‑/‑The mouse, i.e., the mouse of the present invention, can be used to establish a chronic HCV-infected mouse model.

Description

Preparation method of HCV (hepatitis C virus) four-receptor transgenic combined STAT1 knockout mouse

Technical Field

The invention relates to the technical field of transgenosis and gene editing, in particular to a STAT1 gene knockout mouse (4 hEF for short) constructed by the technology of combining CD81, CLDN1, OCLN and SRB1 four-receptor transgenosis with CRISPR/Cas9^Tg STAT1^-/-Mouse) and application thereof.

Background

Hepatitis C Virus (HCV) is a blood-borne virus and is chronically susceptible to infection in humans. The continuous existence of the virus can make hepatitis progress to liver fatty lesion, liver fibrosis, liver cirrhosis and even hepatocellular carcinoma, and seriously threaten human health. Worldwide, it is estimated that the prevalence of viral hepatitis c worldwide in 2015 is 1.0% (95% of indeterminate intervals 0.8-1.1), and 7100 million (62.5-79.4) is chronic viral infection. There is no HCV vaccine at present, but the development difficulty of the vaccine is that the difference of HCV genomes is large, the difference of virus sequences of different genotypes can reach 50% { Bukh,1995#111} { Simmonds,2005#112}, the virus sequences usually exist in a quasispecies form in an infected organism, and the development and application of the HCV vaccine are limited due to the lack of a suitable animal model at present.

The natural host of HCV is human and chimpanzee, which limits the use of primates due to their high cost and complex ethical issues. In recent years, scholars at home and abroad have made various attempts on small animal models, and have made partial progress, mainly including:

(1) the tree shrew model: tree shrew is susceptible to HCV, and some animals may progress to liver fibrosis and cirrhosis 3 years after initial infection { Amako,2010#155 }. However, the tree shrews belong to wild animals, the genetic strain is unstable, and the application is limited.

(2) HCV gene transgenic mouse model: can express and express a single protein component product of HCV genes or a combination product of a plurality of genes, but has large histopathology report difference due to different HCV expression products, difference of mouse backgrounds or different promoters used for HCV protein expression, and shows liver diseases with different degrees, so that more attention is needed for researching pathogenesis.

(3) Xenograft mouse model: human liver transplant mice are formed by transplanting human hepatocytes (e.g., hepatoma cell lines or primary hepatocytes) into mice. The mouse model has immunodeficiency, and can not be used for researching host anti-HCV specific adaptive immune response and reproducing the whole life cycle of the virus.

(4) Host factor humanized mouse model: there are four (CD81, SCARB1, CLDN1 and OCLN) essential host factors for HCV entry in humans, of which the critical amino acid residues of the second envelope loop of CD81 and the OCLN molecule are responsible for preventing HCV entry into rodent cells. A mouse model using adenovirus transiently expressing human CD81 as a single molecule or simultaneously expressing four molecules of human CD81, SCARB1, OCLN, and CLDN1 has not successfully established HCV infection { Masciopindo, 2002#191} { Hikosaka,2011#192 }. Human CD81 and OCLN molecules are stably expressed on inbred mice at the same time, HCV can be invaded successfully, but the immune system of the mice limits HCV infection { Dorner,2011#194}, STAT 1-/-is knocked out on the basis, and the mice can successfully establish HCV infection and activate adaptive immune response.

Disclosure of Invention

The invention aims to solve the problem of the lack of the existing hepatitis C virus infected mouse model, and aims to provide a preparation method for constructing a mouse with transgenic combined STAT1 genes of CD81, CLDN1, OCLN and SRB 1.

Another object of the present invention is to provide a model base for HCV vaccine discovery studies using the animal model prepared by the method of the present invention.

The technical scheme adopted by the invention comprises the following specific steps:

(1) human CD81, CLDN1, OCLN and SRB1 four receptor genes are synthesized and inserted into the same pFUW-CSCO vector endonuclease NdeI restriction site to obtain a pFUW-CSCO-4hEF expression vector.

The constructed pFUW-CSCO-4hEF expression vector contains a human UBC promoter, and can be used for wide expression of transgenes in mice.

Digesting the pFUW-CSCO-4hEF expression vector DNA by NdeI endonuclease to obtain a linearized DNA fragment containing the gene; the DNA sequences encoding CD81, CLDN1, OCLN, SRB1 are SEQ ID 1, SEQ ID 2, SEQ ID 3 and SEQ ID 4, respectively;

injecting the DNA fragment into an ICR mouse fertilized egg by microinjection;

transplanting the fertilized eggs into the uterus of an ICR pseudopregnant female mouse;

after the mouse is born, 2 pairs of specific primers are designed and identified by a genome PCR method to obtain four receptors of CD81, CLDN1, OCLN and SRB1Somatic transgenic ICR progeny mice (4 hEF for short)^Tg)；

The PCR specific primer sequences were as follows:

Primer1：

F：5’CGGAACAGGCGAGGAAAAGT(SEQ ID:5)

R：5’ACAAAACACACTCGCCAACC(SEQ ID:6)

Primer2：

F：5’CCTGTCATCTGCCAAATCCG(SEQ ID:7)

R：5’TACTGATCCACGTAGAGTCCA(SEQ ID:8)

(2) aiming at a first exon and a second exon sequence of a STAT1 gene, 2 pairs of sgRNA sequences are designed, and sgRNA is obtained by constructing a STAT1 gene knockout vector and performing in vitro transcription

Inquiring mouse STAT1 gene information on NCBI, designing, evaluating and screening according to target point sequence, off-target site and mismatching possibility, wherein the nucleotide sequence and sgRNA sequence synthesized by company are shown as follows;

site 1: ACTCCAAGTTCCTGGAGC AGG (SEQ ID:9)

sgRNA sequence:

M-STAT1-gRNA-UP1 5’ATGGACTCCAAGTTCCTGGAGC(SEQ ID:10)

M-STAT1-GRNA-DOWN1 5’AAACGCTCCAGGAACTTGGAGT(SEQ ID:11)

site 2: CCT CCTCTCACAGCTGGACGA (SEQ ID:12)

sgRNA sequence:

M-STAT1-gRNA-UP2 5’ATGGTCGTCCAGCTGTGAGAGG(SEQ ID:13)

M-STAT1-GRNA-DOWN2 5’AAACCCTCTCACAGCTGGACGA(SEQ ID:14)

the synthesized sgRNA single chains are combined into small fragments through annealing renaturation, and then inserted into a BSA I linearized pUC57-sgRNA vector to be transcribed into the sgRNA which can be injected in vitro.

The pST1374-NLS-flag-linker-Cas9 vector was transcribed in vitro into injectable Cas 9-RNA.

Injecting the fertilized eggs into ICR mice by microinjection;

mouse birthPostnatal genomic DNA, PCR detection primers are designed according to STAT1 gene sequence information, and knockout genotypes are detected by a PCR method to obtain positive F0 mice (STAT 1)^+/-)；

PCR detection primers:

M-STAT1-KO-S 5’GAGAGTAATTTAATGGTTGGGCTC(SEQ ID:15)

M-STAT1-KO-A 5’CATGTGAGTCCTGTATCCCTCTAATAGTAAC(SEQ ID:16)

homozygous STAT1 is obtained by selfing F0 mouse^-/-A mouse;

homozygous STAT1^-/-Mice and 4hEF^TgHybridizing the mice, detecting STAT1 gene knockout condition and four-receptor gene expression condition (PCR detection primer is the construction method) of the born mice by a PCR method to obtain F1 generation 4hEF containing CD81, CLDN1, OCLN and SRB1 four-receptor transgenic positive STAT1 heterozygous knockout^Tg STAT1^+/-A mouse;

f1 generation 4hEF^Tg STAT1^+/-Selfing the mouse, detecting the knockout condition of STAT1 gene and the expression condition of four-receptor gene (PCR detection primer is the construction method) by PCR amplification sequencing detection of the born mouse to obtain genotype, and obtaining the F2 generation 4hEF containing CD81, CLDN1, OCLN and SRB1 four-receptor transgenic positive combined STAT1 homozygous knockout^Tg STAT1^-/-The mouse is the mouse animal model.

According to the invention, a CD81, CLDN1, OCLN and SRB1 four-receptor transgenosis combined STAT1 gene knockout ICR mouse animal model is constructed for the first time through a transgenic technology and a CRISPR/Cas9 gene knockout technology, so that the defect that a mouse cannot be naturally infected with HCV is overcome; meanwhile, the gene introduction method is optimized, and the obtained mouse animal model can be stably inherited, so that a convenient, economic and reliable animal model is provided for researching and exploring an HCV infection mechanism and the progress of hepatitis C diseases and developing HCV vaccines.

Drawings

FIG. 1A. pFUW-CSCO-4hEF vector plasmid microinjection mode diagram

FIG. 1B, rat tail DNA identification of 4hEF mouse genotype

FIG. 2A. schematic representation of mouse STAT1 gene targeting

FIG. 2B shows construction of sgRNA vector for mouse STAT1 gene

FIG. 2C is an electrophoretogram for identifying mouse knockout STAT1 gene amplification products

FIG. 3A.4hEF^Tg STAT1^-/-Mouse construction model chart

FIG. 3B.4hEF^Tg STAT1^-/-Mouse STAT1 gene knockout product identification map

FIG. 3C.4hEF^Tg STAT1^-/-Mouse 4hEF genotype identification map

FIG. 4.4hEF^Tg STAT1^-/-Mouse establishment of HCV Chronic infection electropherogram

Detailed Description

Unless otherwise specified, the reagents and equipment used in the invention are common kit instruments in the technical field and can be obtained from commercial sources.

The pFUW-CSCO-4hEF vector plasmid was the gift of the Wang Tian wing researcher, as shown in FIG. 1

Example 1CD81, CLDN1, OCLN, SRB1 four-receptor transgenic ICR mice construction (Beijing Wintoda Biotechnology Co., Ltd.)

The pFUW-CSCO-4hEF vector plasmid is digested by NdeI endonuclease (NEB, # R0111V; Cutsmart buffer: NEB, # B7204S) to obtain a linear DNA fragment; injecting the linearized DNA fragment into an ICR mouse fertilized egg by microinjection and transferring the fertilized egg into a pseudopregnant mouse uterus; extracting genome after mouse birth, adopting cross-promoter region to design specific Primer1, detecting and screening positive F0 mouse (PCR product fragment is 872bp), then using Primer2 to detect and identify inserted target gene (PCR product fragment is 1643bp), obtaining CD81, CLDN1, OCLN, SRB1 four-receptor transgenic ICR filial generation mouse (4 hEF for short)^Tg)；

The PCR specific primer sequences were as follows:

Primer1：

F：5’CGGAACAGGCGAGGAAAAGT

R：5’ACAAAACACACTCGCCAACC

Primer2：

F：5’CCTGTCATCTGCCAAATCCG

R：5’TACTGATCCACGTAGAGTCCA

and (3) PCR reaction system:

PCR procedure:

example 2 construction of homozygous STAT1^-/-Mouse model (Beijing Huafukang scientific and biological shares GmbH)

Aiming at a first exon and a second exon sequence of a STAT1 gene, 2 pairs of sgRNA sequences are designed, and sgRNA is obtained by constructing a STAT1 gene knockout vector and performing in vitro transcription

The mouse STAT1 gene information is inquired on NCBI, design and evaluation screening is carried out according to target point sequence, off-target point and mismatching possibility, and the nucleotide sequence and sgRNA sequence synthesized by the company (Shanghai Yiwei Jie) are shown as follows;

site 1: ACTCCAAGTTCCTGGAGC AGG

SGRNA sequence:

M-STAT1-GRNA-UP1 5’ATGGACTCCAAGTTCCTGGAGC

M-STAT1-GRNA-DOWN1 5’AAACGCTCCAGGAACTTGGAGT

site 2: CCT CCTCTCACAGCTGGACGA

sgRNA sequence:

M-STAT1-gRNA-UP2 5’ATGGTCGTCCAGCTGTGAGAGG

M-STAT1-GRNA-DOWN2 5’AAACCCTCTCACAGCTGGACGA

the synthetic sgRNA single chains are annealed and renatured to combine into small fragments, inserted into a BSA I linearized pUC57-sgRNA vector and transcribed in vitro into the injectable sgRNA (in vitro transcription kit: Ambion Am 1354).

The pST1374-NLS-flag-linker-Cas9 vector was transcribed in vitro into injectable Cas9-RNA (in vitro transcription kit: Ambion Am 1345).

Injecting the fertilized eggs into ICR mice by microinjection;

7-10 days after the birth of the mouse, cutting toes and a tail tip, extracting genomic DNA (genomic DNA extraction kit EE101-12 of the all-round type golden Transgen company), designing a PCR detection primer (Shanghai Weijie Jie) according to STAT1 gene sequence information, detecting the knockout genotype by a PCR method, and obtaining a positive F0 generation mouse (STAT 1)^+/-)；

PCR detection primers:

M-STAT1-KO-S 5’GAGAGTAATTTAATGGTTGGGCTC

M-STAT1-KO-A5’CATGTGAGTCCTGTATCCCTCTAATAGTAAC

TM＝63℃

PCR reaction System and amplification procedure (TaKaRa RR042A)

Reaction system:

and (3) amplification procedure:

6 × loading buffer to terminate the reaction.

Electrophoresis was performed using a 1% agarose gel.

The results of the identification are shown in FIG. 2, two band types were identified, the target band with a detection molecular weight different from that of the wild-type band was selected for TA cloning, and then PCR was performed on the bacterial suspension using the detection primers to screen for sequencing of the inserted clones. The obtained mice were heterozygote STAT1 +/-mice (WT band size: 1081 bp);

f0 mouse is selfed, and the mouse is identified by genome PCR method to obtain homozygous STAT 1-/-mouse.

EXAMPLE 3 construction of CD81, CLDN1, OCLN, SRB1 four-receptor transgenic Combined STAT1 Gene knockout ICR mouse animal model

The homozygous STAT 1-/-mouse is hybridized with the 4hEFTG mouse, the birth mouse is used for detecting STAT1 gene knockout condition and four-receptor gene expression condition (PCR detection primers are shown as the construction method above) by a PCR method, and an F1 generation 4hEFTG STAT1 +/-mouse containing CD81, CLDN1, OCLN and SRB1 four-receptor transgenic positive STAT1 heterozygous knockout is obtained;

selfing an F1 generation 4hEFTG STAT1 +/-mouse, carrying out PCR amplification sequencing detection on a born mouse, identifying STAT1 gene knockout condition and four-receptor gene expression condition (a PCR detection primer refers to the construction method), obtaining a genotype, obtaining an F2 generation 4hEFTG STAT 1-/-mouse containing CD81, CLDN1, OCLN and SRB1 four-receptor transgenic positive combined STAT1 homozygous knockout, and obtaining the mouse animal model.

Example 4 evaluation of HCV infection Using 4 hIFtg STAT 1-/-mice

Hepatitis C virus JFH1 was injected via tail vein injection (1x10^7FFU) into 4 hEFFTg STAT 1-/-mice, and the liver tissues were harvested 3 months after infection. HCV RNA was detected in hepatocytes by qRT-PCR (QIAGEN 210210) and the product was identified in 1% DNA gel. The 4 hIFNG STAT 1-/-group of mice detected HCV RNA relative to the wild type ICR group of mice, indicating that the 4 hIFNG STAT 1-/-mice were successfully infected with HCV.

Sequence listing

<110> institute of pathogenic biology of Chinese academy of medical sciences

<120> preparation method of HCV four-receptor transgenic merged STAT1 knockout mouse

<130> TQZX2020-ZL0746

<141> 2020-12-25

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 711

<212> DNA

<213> Homo sapiens

<400> 1

atgggagtgg agggctgcac caagtgcatc aagtacctgc tcttcgtctt caatttcgtc 60

ttctggctgg ctggaggcgt gatcctgggt gtggccctgt ggctccgcca tgacccgcag 120

accaccaacc tcctgtatct ggagctggga gacaagcccg cgcccaacac cttctatgta 180

ggcatctaca tcctcatcgc tgtgggcgct gtcatgatgt tcgttggctt cctgggctgc 240

tacggggcca tccaggaatc ccagtgcctg ctggggacgt tcttcacctg cctggtcatc 300

ctgtttgcct gtgaggtggc cgccggcatc tggggctttg tcaacaagga ccagatcgcc 360

aaggatgtga agcagttcta tgaccaggcc ctacagcagg ccgtggtgga tgatgacgcc 420

aacaacgcca aggctgtggt gaagaccttc cacgagacgc ttgactgctg tggctccagc 480

acactgactg ctttgaccac ctcagtgctc aagaacaatt tgtgtccctc gggcagcaac 540

atcatcagca acctcttcaa ggaggactgc caccagaaga tcgatgacct cttctccggg 600

aagctgtacc tcatcggcat tgctgccatc gtggtcgctg tgatcatgat cttcgagatg 660

atcctgagca tggtgctgtg ctgtggcatc cggaacagct ccgtgtactg a 711

<210> 2

<211> 636

<212> DNA

<213> Homo sapiens

<400> 2

atggccaacg cggggctgca gctgttgggc ttcattctcg ccttcctggg atggatcggc 60

gccatcgtca gcactgccct gccccagtgg aggatttact cctatgccgg cgacaacatc 120

gtgaccgccc aggccatgta cgaggggctg tggatgtcct gcgtgtcgca gagcaccggg 180

cagatccagt gcaaagtctt tgactccttg ctgaatctga gcagcacatt gcaagcaacc 240

cgtgccttga tggtggttgg catcctcctg ggagtgatag caatctttgt ggccaccgtt 300

ggcatgaagt gtatgaagtg cttggaagac gatgaggtgc agaagatgag gatggctgtc 360

attgggggtg cgatatttct tcttgcaggt ctggctattt tagttgccac agcatggtat 420

ggcaatagaa tcgttcaaga attctatgac cctatgaccc cagtcaatgc caggtacgaa 480

tttggtcagg ctctcttcac tggctgggct gctgcttctc tctgccttct gggaggtgcc 540

ctactttgct gttcctgtcc ccgaaaaaca acctcttacc caacaccaag gccctatcca 600

aaacctgcac cttccagcgg gaaagactac gtgtga 636

<210> 3

<211> 1569

<212> DNA

<213> Homo sapiens

<400> 3

atgtcatcca ggcctcttga aagtccacct ccttacaggc ctgatgaatt caaaccgaat 60

cattatgcac caagcaatga catatatggt ggagagatgc atgttcgacc aatgctctct 120

cagccagcct actcttttta cccagaagat gaaattcttc acttctacaa atggacctct 180

cctccaggag tgattcggat cctgtctatg ctcattattg tgatgtgcat tgccatcttt 240

gcctgtgtgg cctccacgct tgcctgggac agaggctatg gaacttccct tttaggaggt 300

agtgtaggct acccttatgg aggaagtggc tttggtagct acggaagtgg ctatggctat 360

ggctatggtt atggctatgg ctacggaggc tatacagacc caagagcagc aaagggcttc 420

atgttggcca tggctgcctt ttgtttcatt gccgcgttgg tgatctttgt taccagtgtt 480

ataagatctg aaatgtccag aacaagaaga tactacttaa gtgtgataat agtgagtgct 540

atcctgggca tcatggtgtt tattgccaca attgtctata taatgggagt gaacccaact 600

gctcagtctt ctggatctct atatggttca caaatatatg ccctctgcaa ccaattttat 660

acacctgcag ctactggact ctacgtggat cagtatttgt atcactactg tgttgtggat 720

ccccaggagg ccattgccat tgtactgggg ttcatgatta ttgtggcttt tgctttaata 780

attttctttg ctgtgaaaac tcgaagaaag atggacaggt atgacaagtc caatattttg 840

tgggacaagg aacacattta tgatgagcag ccccccaatg tcgaggagtg ggttaaaaat 900

gtgtctgcag gcacacagga cgtgccttca cccccatctg actatgtgga aagagttgac 960

agtcccatgg catactcttc caatggcaaa gtgaatgaca agcggtttta tccagagtct 1020

tcctataaat ccacgccggt tcctgaagtg gttcaggagc ttccattaac ttcgcctgtg 1080

gatgacttca ggcagcctcg ttacagcagc ggtggtaact ttgagacacc ttcaaaaaga 1140

gcacctgcaa agggaagagc aggaaggtca aagagaacag agcaagatca ctatgagaca 1200

gactacacaa ctggcggcga gtcctgtgat gagctggagg aggactggat cagggaatat 1260

ccacctatca cttcagatca acaaagacaa ctgtacaaga ggaattttga cactggccta 1320

caggaataca agagcttaca atcagaactt gatgagatca ataaagaact ctcccgtttg 1380

gataaagaat tggatgacta tagagaagaa agtgaagagt acatggctgc tgctgatgaa 1440

tacaatagac tgaagcaagt gaagggatct gcagattaca aaagtaagaa gaatcattgc 1500

aagcagttaa agagcaaatt gtcacacatc aagaagatgg ttggagacta tgatagacag 1560

aaaacatag 1569

<210> 4

<211> 1530

<212> DNA

<213> Homo sapiens

<400> 4

atgggctgct ccgccaaagc gcgctgggct gccggggcgc tgggcgtcgc ggggctactg 60

tgcgctgtgc tgggcgctgt catgatcgtg atggtgccgt cgctcatcaa gcagcaggtc 120

cttaagaacg tgcgcatcga ccccagtagc ctgtccttca acatgtggaa ggagatccct 180

atccccttct atctctccgt ctacttcttt gacgtcatga accccagcga gatcctgaag 240

ggcgagaagc cgcaggtgcg ggagcgcggg ccctacgtgt acagggagtt caggcacaaa 300

agcaacatca ccttcaacaa caacgacacc gtgtccttcc tcgagtaccg caccttccag 360

ttccagccct ccaagtccca cggctcggag agcgactaca tcgtcatgcc caacatcctg 420

gtcttgggtg cggcggtgat gatggagaat aagcccatga ccctgaagct catcatgacc 480

ttggcattca ccaccctcgg cgaacgtgcc ttcatgaacc gcactgtggg tgagatcatg 540

tggggctaca aggaccccct tgtgaatctc atcaacaagt actttccagg catgttcccc 600

ttcaaggaca agttcggatt atttgctgag ctcaacaact ccgactctgg gctcttcacg 660

gtgttcacgg gggtccagaa catcagcagg atccacctcg tggacaagtg gaacgggctg 720

agcaaggttg acttctggca ttccgatcag tgcaacatga tcaatggaac ttctgggcaa 780

atgtggccgc ccttcatgac tcctgagtcc tcgctggagt tctacagccc ggaggcctgc 840

cgatccatga agctaatgta caaggagtca ggggtgtttg aaggcatccc cacctatcgc 900

ttcgtggctc ccaaaaccct gtttgccaac gggtccatct acccacccaa cgaaggcttc 960

tgcccgtgcc tggagtctgg aattcagaac gtcagcacct gcaggttcag tgcccccttg 1020

tttctctccc atcctcactt cctcaacgct gacccggttc tggcagaagc ggtgactggc 1080

ctgcacccta accaggaggc acactccttg ttcctggaca tccacccggt cacgggaatc 1140

cccatgaact gctctgtgaa actgcagctg agcctctaca tgaaatctgt cgcaggcatt 1200

ggacaaactg ggaagattga gcctgtggtc ctgccgctgc tctggtttgc agagagcggg 1260

gccatggagg gggagactct tcacacattc tacactcagc tggtgttgat gcccaaggtg 1320

atgcactatg cccagtacgt cctcctggcg ctgggctgcg tcctgctgct ggtccctgtc 1380

atctgccaaa tccggagcca agagaaatgc tatttatttt ggagtagtag taaaaagggc 1440

tcaaaggata aggaggccat tcaggcctat tctgaatccc tgatgacatc agctcccaag 1500

ggctctgtgc tgcaggaagc aaaactgtag 1530

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

cggaacaggc gaggaaaagt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 6

acaaaacaca ctcgccaacc 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 7

cctgtcatct gccaaatccg 20

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 8

tactgatcca cgtagagtcc a 21

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 9

actccaagtt cctggagcag g 21

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 10

atggactcca agttcctgga gc 22

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 11

aaacgctcca ggaacttgga gt 22

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 12

cctcctctca cagctggacg a 21

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 13

atggtcgtcc agctgtgaga gg 22

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 14

aaaccctctc acagctggac ga 22

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 15

gagagtaatt taatggttgg gctc 24

<210> 16

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 16

catgtgagtc ctgtatccct ctaatagtaa c 31

Claims

1. A construction method for constructing STAT1 gene knockout mice by using CD81, CLDN1, OCLN and SRB1 four-receptor transgenic combination CRISPR/Cas9 technology is characterized by comprising the following steps:

(1) constructing four-receptor transgenic mice of CD81, CLDN1, OCLN and SRB 1;

carrying out enzyme digestion on the expression plasmid pFUW-CSCO-4 hEF;

the obtained linear DNA fragments are injected into ICR mouse fertilized eggs in a micro-injection mode and are implanted into the uterus of a pseudopregnant mouse;

the genotype of the postnatal rat is identified by a genome PCR method to obtain positive 4hEF^TgA mouse;

(2) construction of STAT1 knockout mice;

aiming at a first exon and a second exon sequence of a STAT1 gene, 2 pairs of sgRNA sequences are designed, and sgRNAs are obtained by constructing a STAT1 gene knockout vector and performing in vitro transcription;

the synthesized sgRNA single chains are combined into small fragments through annealing renaturation, a BSA I linearized pUC57-sgRNA vector is inserted, and the sgRNA becomes injectable sgRNA through in vitro transcription;

Injecting the fertilized eggs into ICR mice by microinjection;

detecting the mouse by a genome PCR method after birth to obtain a positive F0 generation mouse;

homozygous STAT1 is obtained by selfing F0 mouse^-/-A mouse;

(3)4hEF^Tg STAT1^-/-constructing a mouse;

homozygous STAT1^-/-Mice and 4hEF^TgHybridizing the mice, and detecting the born mice by PCR to obtain the F1 generation 4hEF containing CD81, CLDN1, OCLN and SRB1 four-receptor transgenic positive STAT1 heterozygous knockout^TgSTAT1^+/-A mouse;

f1 generation 4hEF^Tg STAT1^+/-Selfing the mouse, detecting the born mouse by PCR amplification and sequencing, identifying the genotype, and obtaining the F2 generation 4hEF containing the transgenic positive combination of four receptors of CD81, CLDN1, OCLN and SRB1 and STAT1 homozygous knockout^Tg STAT1^-/-The mouse is the mouse animal model.