CN110157704B

CN110157704B - Mouse for resisting mouse hepatitis virus and preparation method thereof

Info

Publication number: CN110157704B
Application number: CN201910273305.2A
Authority: CN
Inventors: 蔡卫斌; 李慧; 高赛飞; 杨镇宇
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2019-04-04
Filing date: 2019-04-04
Publication date: 2021-08-06
Anticipated expiration: 2039-04-04
Also published as: CN110157704A

Abstract

The invention discloses a mouse for resisting mouse hepatitis virus and a preparation method thereof, which applies CRISPR/Cas9 technology and utilizes sgRNA sites with nucleotide sequences shown as SEQ ID NO:1 to quickly and efficiently construct Ceacam1^‑/‑The successful preparation of the mouse has important significance for the research of laboratory MHV infection, can realize that the mouse for experiments is not infected by MHV any more, and has important significance for improving the quality of the mouse for domestic scientific research. In addition, Ceacam1^‑/‑The mouse has the ability of resisting MHV infection, and thus important guarantee is provided for improving the quality of mice for scientific research and guaranteeing the authenticity and reliability of scientific research experiment data.

Description

Mouse for resisting mouse hepatitis virus and preparation method thereof

Technical Field

The invention relates to the technical field of mouse hepatitis viruses, and in particular relates to a mouse for resisting the mouse hepatitis viruses and a preparation method thereof.

Background

The CRISPR/Cas9 technical system is a new gene editing tool which is started in recent years, is optimized from a system for resisting virus invasion and clearing virus genomes of prokaryotes, becomes a third-generation gene editing tool following ZFN technology and TALENS technology, and rapidly surpasses and replaces the first two technologies in most application fields due to high efficiency and low operation difficulty, and becomes a mainstream gene editing tool at present.

Mouse Hepatitis Virus (MHV) belongs to the genus coronavirus of the family Coronaviridae, and is a single-stranded RNA virus. MHV can be divided into two broad categories: respiratory and intestinal strains. Wherein, the respiratory strains comprise MHV-1, MHV-2, MHV-3, MHV-JHM, MHV-A59 and the like; the intestinal strain comprises MHV-Y, MHV-S, MHV-U, MHV-LIVIM and the like. Among them, the MHV-JHM and MHV-A59 strains have been studied in many cases. The MHV has a diameter of about 80-169 nm and contains 4-6 structural proteins. The nucleoprotein shell is surrounded by the viral envelope, which is generally composed of 3 proteins, the M, S and E proteins. The S protein is a main protein of virus and environment interaction, can recognize MHV receptors on the cell surface, and participates in the process of MHV infected cells. MHV receptor glycoproteins CEACAMs [ CEA-related cell adhesives ], belong to the immunoglobulin superfamily. Recognition of CEACAM by S protein is the first determinant of MHV infectious species specificity and tissue tropism. The mouse genome comprises two Ceacam family genes, Ceacam1 and Ceacam 2. The Ceacam1 includes two alleles, Ceacam1a and Ceacam1 b. CEACAM1a is mainly found in liver, intestinal tract, kidney and hematopoietic cells, CEACAM2 is mainly found in liver and pancreas. Mouse CEACAM1a is a pathogen and a receptor for MHV infection. As a receptor for MHV infection, CEACAM1a was expressed not only in inbred mice but also in inbred mice.

Mice evolved from mice. It is widely distributed around the world, and has been bred into more than 1000 inbred lines and independent distant cross groups through long-term artificial breeding and selective breeding. The experiment of human mice in the early 17 th century has become the most thoroughly studied experimental mammal with the largest use amount. However, because of the limited breeding environment in the laboratory, the mouse hepatitis virus is one of the most serious virus diseases of the experimental mice, and the virus seriously affects the quality and the experimental results of the experimental mice.

Therefore, there is a need for a method for rapidly and efficiently producing a mouse against a mouse hepatitis virus.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a mouse for resisting mouse hepatitis virus and a preparation method thereof.

The first purpose of the invention is to provide a preparation method of mice for resisting mouse hepatitis virus.

The second purpose of the invention is to provide the mouse prepared by the preparation method.

In order to achieve the purpose, the invention is realized by the following technical scheme:

the mouse with 10bp deletion at the second exon of the Ceacam1 gene is successfully prepared by using a C57BL/6J inbred line mouse and applying a CRISPR/Cas9 technical system and knocking out an MHV receptor protein CEACAM1 a. Screening Ceacam1 by propagation^-/-After mice, they were infected with a classical strain of MHV, MHV-A59, and the results showed that Ceacam1^-/-Mice are not infected with mouse hepatitis virus.

Therefore, the invention claims an sgRNA locus for constructing a mouse for resisting mouse hepatitis virus, and the nucleotide sequence of the sgRNA locus is shown as SEQ ID NO. 1;

a pair of primers for constructing a mouse resistant to mouse hepatitis virus has nucleotide sequences shown in SEQ ID NO. 2-3.

The application of the sgRNA locus and/or the primer in preparing mice resistant to mouse hepatitis viruses also belongs to the protection scope of the invention.

Further, the invention claims a preparation method of a mouse for resisting mouse hepatitis virus, which utilizes CRISPR/Cas9 technology and the sgRNA locus to carry out gene knockout.

Preferably, the method comprises the steps of:

s1, annealing and phosphorylating the primer, and then connecting the primer to a linearized CRISPR/Cas9 vector to obtain a recombinant vector;

s2, adding a T7 promoter sequence in front of an sgRNA sequence of the recombinant vector, and carrying out in-vitro transcription of the sgRNA;

s3, selecting female mice of 3-4 weeks, carrying out superovulation treatment, and mating the female mice with male mice of 7-8 weeks to obtain embryos for microinjection;

s4, taking an embryo from an oviduct of a female mouse, and microinjecting the embryo cytoplasm through a mixed solution of sgRNA and Cas9 mRNA;

s5, transplanting the embryo subjected to microinjection into a pseudopregnant mouse to a two-cell stage;

s6, the mouse is born to obtain an F0 generation mouse, and the F0 generation gene modified mouse is identified;

s7, mating the obtained F0 generation gene modified mouse with a wild type mouse to obtain an F1 generation mouse, and identifying the F1 generation gene modified mouse;

s8, selfing the obtained F1 generation gene modified mice to obtain F2 generation mice, and identifying homozygous F2 generation gene modified mice.

More preferably, in step S3, the mouse is C57 BL/6J.

More preferably, in step S5, the pseudopregnant mouse is a pseudopregnant CD1 mouse.

More preferably, in step S5, the pseudopregnant mouse is obtained by excising vas deferens from a male mouse for 8 weeks or more and mating with a female mouse for 6 weeks or more to obtain a pseudopregnant female mouse.

More preferably, the CRISPR/Cas9 vector is pX330-U6-Chimeric _ BB-CBh-hSpCas9(Addge plasma # 42230).

More preferably, pX330-U6-Chimeric _ BB-CBh-hSpCas9 is linearized with BbsI.

Preferably, in step S4, the embryo is 10-12 h.

More preferably, in step S4, the embryo is a 12h embryo.

More preferably, in step S6, the sgRNA is used at a concentration of 25 to 100g/μ L;

more preferably, in step S6, the Cas9 mRNA is used at a concentration of 30-100 g/. mu.L

Further preferably, in step S6, the sgRNA is used at a concentration of 50 ng/. mu.l.

Further preferably, in step S6, Cas9 mRNA is used at a concentration of 100 ng/. mu.l.

Preferably, in step S6, the culture conditions are 36-38 ℃ and 4.5-5.5% CO₂Culturing for 22-26 h.

More preferably, in step S6, the culture conditions are 37 ℃ and 5% CO₂And culturing for 24 h.

More preferably, primers with nucleotide sequences shown in SEQ ID NO 12-13 are used for PCR reaction to identify the modified mouse.

Further preferably, the PCR reaction system for identifying the modified mice is: 5 Xone Taq Buffer 4. mu.l; dNTP (2.5mM) 1.6. mu.l; 1. mu.l of each primer; one Taq enzyme (NEB) 0.4. mu.l; 1. mu.l of DNA; h₂O 11μl；Total 20μl。

Further preferably, the PCR reaction procedure for identifying modified mice is: 3min at 95 ℃; 95 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 1min, 35 cycles; 10min at 72 ℃.

The mouse with the anti-mouse hepatitis virus prepared by any preparation method also belongs to the protection scope of the invention.

Preferably, 10bp of the second exon of the Ceacam1 gene is deleted.

Compared with the prior art, the invention has the following beneficial effects:

the invention applies CRISPR/Cas9 technology and utilizes sgRNA sites with the nucleotide sequence shown as SEQ ID NO:1 to quickly and efficiently construct Ceacam1^-/-The successful preparation of the mouse has important significance for the research of laboratory MHV infection, can realize that the mouse for experiments is not infected by MHV any more, and has important significance for improving the quality of the mouse for domestic scientific research. In addition, Ceacam1^-/-The mouse has the ability of resisting MHV infection, and thus important guarantee is provided for improving the quality of mice for scientific research and guaranteeing the authenticity and reliability of scientific research experiment data.

Drawings

Fig. 1 is a target site for sgRNA at the second exon of the Ceacam1 gene; the triangle indicates the position of the sgRNA cleavage site.

Fig. 2 shows that the sgRNA cleavage activity is identified in vitro, a pX330-Cas9-sgRNA plasmid is transfected into 3T3 cells, and genomic DNA is extracted 48h later to verify that a gene editing activity sequencing result shows a set of peaks, which indicates that the sgRNA1 has cleavage activity.

FIG. 3 is a sequencing map of the Founder mice born after microinjection, showing gene editing in 2 out of 5 Founder mice born (sequencing map showing nested peaks), which is the sequencing result of 1 out of them.

FIG. 4 shows different gene editing modes of F1 generation mice, wherein F1 generation mice are obtained after Breeding of F0 generation mice and WT mice, and after PCR amplification and monoclonal sequencing, the F1 generation mice have the following 4 different editing modes: d2: 2bp is deleted; d10: deletion of 10 bp; m7: a mutation of 7 bases; +2: insert 2 bp.

FIG. 5 shows sequencing patterns of homozygous deletion mice obtained by crossing 10 bp-deleted F1 generation mice (heterozygous) and PCR-amplified, wherein the patterns show a single peak, and the black line indicates the position of the deletion of a base (the deletion base is TACTCAGGCG).

FIG. 6 shows that the homozygous deletion 10bp mouse is further verified by PCR amplification, and a forward primer is designed near the deletion 10bp site (wherein the underlined part is 10bp deleted from the homozygous mouse): 5' -actatcgtcgtactcaggcg-3'; the reverse primer is: 5'-gattctcatggtttcctcaggcag-3' are provided. A band of 361bp appears after PCR amplification of a wild type mouse. And the homozygous mouse cannot expand due to the fact that the deleted 10bp is located at the 3' end of the forward primer, so that a band cannot be amplified, wherein WT1, WT2 are wild-type mice, and 43, 50 and 52 are the numbers of the homozygous mouse.

FIG. 7 is a depiction of the sequence of Ceacam1 after infection with MHV-A59^-/-Mouse and wild type mouse IgG levels varied, and from the list, Ceacam1^-/-The level of IgG in the mice did not change significantly after 3, 7, 14, 21, 28 days after MHV-A59 infection, and no positive detection was observed; while wild-type mice began to be positive for IgG antibodies on day 7 of MHV-A59 infection, both day 14 and day 21 had increased OD values, and slightly decreased on day 28, indicating that Ceacam1^-/-Mice have the ability to fight MHV-A59 infection.

FIG. 8 is a photograph of pathological sections of liver after infection with MHV-A59, and the results of the liver HE staining at day 7 after infection with MHV-A59 were selected in the present invention, and it can be seen from the results that liver of wild type mouse was seriously damaged, and Ceacam1^-/-The liver of the mice was normal and no damage occurred.

Detailed Description

The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

The oligos used in the following examples are shown in Table 1.

Table 1:

example 1 CEACAM1a knockout vector pX330-Cas9-sgRNA plasmid construction and Activity identification

First, determination of sgRNA target site

1. Experimental methods

Firstly, the genome sequence of Ceacam1 (Gene ID 26365) is obtained, the initiation codon and the exon region of the Gene are found, and the basic principle of sgRNA design is followed byhttp://crispr.mit.edu/Potential highly efficient sgRNA sites were sought.

2. Results of the experiment

The following sgrnas were obtained:

sgRNA1：5’-TGAAAACTATCGTCGTACTCAGG-3’(SEQ ID NO:1)；

sgRNA2：5’-CATTGAGGCTGTGCCGCCCCAGG-3’(SEQ ID NO:4)；

sgRNA3：5’-GCAAAGGCTCCAAGCGCCAGGGG-3’(SEQ ID NO:7)。

all 3 sgRNA sites are located in the second exon of Ceacam1, with specific targets for sgRNA1 shown in fig. 1.

Secondly, constructing a plasmid capable of simultaneously expressing Cas9 and sgRNA

1. Experimental methods

And cloning and connecting the sgRNAs obtained in the last step to a pX330 plasmid capable of expressing the Cas9 protein to obtain a pX330-Cas9-sgRNA plasmid.

pX330 plasmid: the pX330-U6-Chimeric _ BB-CBh-hSpCas9 vector plasmid (Addgeneplanmid #42230, given by Zhang Feng laboratories) was digested with BbsI, and recovered after electrophoresis using QIAquick gel recovery kit.

The sgRNA1 designed by the invention is as follows: 5'-TGAAAACTATCGTCGTACTCAGG-3' (SEQ ID NO: 1);

to construct the pX330-Cas9-sgRNA plasmid, the following two primers were synthesized:

Forward1：5’-CACCGTGAAAACTATCGTCGTACTC-3’(SEQ ID NO:2)，

Reverse1：5’-AAACGAGTACGACGATAGTTTTCAC-3’(SEQ ID NO:3)。

sgRNA2 was: 5'-CATTGAGGCTGTGCCGCCCCAGG-3' (SEQ ID NO: 4);

Forward2：5’-CACCGCATTGAGGCTGTGCCGCCCC-3’(SEQ ID NO:5)，

Reverse2：5’-AAACGGGGCGGCACAGCCTCAATGC-3’(SEQ ID NO:6)。

sgRNA3 was: 5'-GCAAAGGCTCCAAGCGCCAGGGG-3' (SEQ ID NO: 7);

Forward3：5’-CACCGCAAAGGCTCCAAGCGCCAG-3’(SEQ ID NO:8)，

Reverse3：5’-AAACCTGGCGCTTGGAGCCTTTGC-3’(SEQ ID NO:9)。

the primers were annealed, phosphorylated separately and ligated to the linearized px330 vector. After ligation, the cells were transformed into DH5a E.coli and plated on LB medium containing ampicillin. The next day, 5 clones were picked for sequencing, with the sequencing primer sequence: forward primer: GAGGGCCTATTTCCCATGATT are provided. After the cloning amplification culture for successful ligation, plasmid extraction was performed using a plasmid extraction kit (QIAGEN, USA) without endotoxin.

2. Results of the experiment

Respectively obtaining pX330-Cas9-sgRNA1, pX330-Cas9-sgRNA2 and pX330-Cas9-sgRNA 3.

III, identifying the in vitro activity of pX330-Cas9-sgRNA plasmid

1. Experimental methods

In order to verify the activity of each sgRNA, the plasmid obtained in the previous step is transfected into 3T3 cells, and after 48 hours, the genomic DNA of the cells is extracted, and the activity is detected by sequencing after PCR amplification.

3T3 cells were used for in vitro activity identification of the pX330-Cas9-sgRNA plasmid constructed above.

The specific experimental method comprises the following steps:

when the cells grew to a density of 70% -80%, 800ng of pX330-Cas9-sgRNA was transfected, and genomic DNA was extracted 48h later using a cell genome extraction kit (Donghai organism). The genomic sequence located near the sgRNA site was then amplified for sequencing analysis.

The PCR amplification system used was: 400-800 ng genomic DNA, 4. mu.l of 5 Xone Taq standard buffer, 1.6. mu.l of 2.5mM dNTP, 1. mu.l of 10. mu.M forward primer, 1. mu.l of 10. mu.M reverse primer, 0.4. mu.l of OneTaq enzyme (NEB), and supplementing ultrapure water to a total volume of 20. mu.l.

The PCR reaction conditions are as follows: 3 minutes at 95 ℃; 30 seconds at 94 ℃, 30 seconds at 55 ℃, 1 minute at 72 ℃ and 35 cycles; 10 minutes at 72 ℃.

And (4) sequencing the obtained PCR product, and identifying the gene editing mode.

2. Results of the experiment

The result shows that in the experimental group transfected with the pX330-Cas9-sgRNA1 plasmid, the sequencing map (figure 2) shows that the sgRNA1 generates a set of peaks near the sgRNA site and in the subsequent sequence, and the sgRNA1 is proved to have the cutting activity. In the experimental group transfected with plasmids of pX330-Cas9-sgRNA2 and pX330-Cas9-sgRNA3, no obvious peak is detected in the sequencing map (in order to save layout, the sequencing map is not provided for the moment in the patent), which indicates that the cleavage activity of sgRNA2 and sgRNA3 is lower than that of sgRNA 1. sgRNA1 was used for subsequent experiments.

Thirdly, obtaining the sgRNA

1. Experimental methods

A DNA template of the sgRNA is amplified by taking a pX330-Cas9-sgRNA1 plasmid as a template and adding a T7 promoter sequence (required for subsequent transcription) in front of the sgRNA sequence as a primer to obtain T7-Ceacam1-sgRNA, and the T7-Ceacam1-sgRNA is purified by using a PCR purification kit (QIAGEN, USA).

The primers used were as follows: a forward primer:

5’-TAATACGACTCACTATAGGGTGAAAACTATCGTCGTACTCAGG-3’(SEQ ID NO:10)；

reverse primer:

5’-AAAAGCACCGACTCGGTGCC-3’(SEQ ID NO:11)。

in vitro transcription was performed using the purified T7-Ceacam1-sgRNA1 PCR product as template (MEGASHORTscript T7 kit, ThermoFisher Scientific, USA). The transcripts were then purified using a MEGAclear kit (ThermoFisher Scientific, USA), purified and then dissolved in RNase-free water and run on a gel electrophoresis to identify the correct bands.

Second, experimental results

After transcription by a T7 transcription kit, detecting sgRNA bands by gel electrophoresis to obtain sgRNAs required by experiments.

Example 2 construction of CEACAM1a knockout mice

First, culture of experimental animals

C57BL/6J female mice of 3-4 weeks are selected for superovulation treatment (in order to obtain enough egg cells), and the superovulation treatment is mated with C57BL/6J male mice of 7-8 weeks to obtain embryos for microinjection. Vasectomized male mice with CD1 over 8 weeks were then mated with female mice with CD1 over 6 weeks to give pseudopregnant females. All experimental mice were propagated in the experimental animal center of Zhongshan university.

Second, microinjection and embryo transfer

The sgRNA1 and Cas9 mRNA obtained in the above steps are co-microinjected into a single-cell-stage embryo, because the sgRNA guides the Cas9 protein to be cut at a specific DNA site complementary to the sequence of the protein, and causes DNA Double Strand Breaks (DSBs), and further excites a non-homologous end connection repair mechanism of the cell, thereby generating deletion or insertion of DNA bases (indels).

The method comprises the following specific operations: day 0.5 embryos were removed from the oviduct of C57BL/6J female mice and injected microscopically with blastocysts at a concentration of sgRNA 150 ng/. mu.l and Cas9 mRNA (Biomics Biotechnologies, China)100 ng/. mu.l.

Microinjected embryos were incubated at 37 ℃ with 5% CO₂After 24h of culture, the cells were transferred to the two-cell stage, and then transplanted into pseudopregnant CD1 female mice and normally raised.

Genotype identification of mice of three, F0 generations

1. Experimental methods

21 days after the birth of the mice, the surrogate mother mice born 5 mice, and rat tail genomic DNA was extracted and PCR-amplified and sequenced to identify the presence of gene editing in F0 generation mice.

The primers used were as follows:

Ceacam1-Exon2-F：5’-CTGGTACAAGGGAAACACTACG-3’(SEQ ID NO:12)；

Ceacam1-Exon2-R：5’-CACCATGAAGGATATGGGAGTCTAC-3’(SEQ ID NO:13)。

the reaction system is as follows:

Component	Amount(Per reaction)	Final
			5×One Taq Buffer	4μl	1×
dNTP(2.5mM)	1.6μl	0.2mM
			Ceacaml-Exon2-F(10μM)	1μl	0.5mM
Ceacaml-Exon2-R(10μM)	1μl	0.5mM
			one Taq enzyme (NEB)	0.4μl
DNA	1μl
			H₂O	11μl
Total	20μl

The reaction procedure is as follows: 3min at 95 ℃; 95 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 1min, 35 cycles; 10min at 72 ℃.

2. Results of the experiment

The results show (fig. 3) that two mice showed overlapping peaks near the sgRNA site and in the subsequent sequences, indicating the presence of gene editing, mice No. 2 and 3, respectively. The presence of the genetic modification was determined for the mouse,

genotype identification of mice of three, F1 generations

1. Experimental methods

The two genetically modified mice obtained in the last step are respectively mated with wild type C57BL/6J to obtain F1 generations, PCR amplification TA clone analysis and identification are carried out, and the specific detection method is the same as the F0 generation mouse genotype identification.

2. Results of the experiment

The results show (FIGS. 4-5) that the Ceacam1 gene has 4 different gene modification patterns. 3 mice (1 male and 2 female) lack 10bp, 7 mice generate 7bp base mutation, 1 mouse lacks 2bp, and the other 4 mice are inserted with 2 bp. These 4 editing modes are all sense mutations. By comprehensively comparing the editing modes, the 10bp deletion genotype is the best selection, and finally, the 10bp deletion mouse is selected for screening of F2 generation.

Genotype identification of four-generation and F2-generation mice

1. Experimental methods

Mating F1 generation mice with the same genotype to obtain 13F 2 generation mice, and carrying out further identification, wherein the specific detection method is the same as that of the F0 generation mouse genotype identification.

2. Results of the experiment

The results showed 13F 2 mice, 3 homozygous (23%), 6 heterozygous (46%), 4 wild type (31%). Basically complying with the mendelian law of inheritance.

Fifth, deletion verification

1. Experimental methods

To verify that these 3 mice did lack 10bp, further verification was performed: design forward primer near deletion 10bp site (wherein the underlined part is 10bp deleted from homozygous mouse): 5'-actatcgtcgtactcaggcg-3' (SEQ ID NO: 14); the reverse primer is: 5'-gattctcatggtttcctcaggcag-3' (SEQ ID NO: 15).

2. Results of the experiment

The results show (FIG. 6) that a band of 361bp appeared in the wild type mouse PCR amplification. However, the 10bp of the deletion of the homozygous mouse is positioned at the 3' end of the forward primer, so that the amplification process cannot be extended, and a band cannot be amplified. Gel electrophoresis strip analysis validated this result robustly. To this end, Ceacam 1-/-mice were successfully obtained. Then, the amplification breeding is continued for the subsequent experiment.

Example 3 MHV-A59 infection of CEACAM1a knockout mice

First, experiment method

To further validate the Ceacam1^-/-Whether mice can resist MHV infection, the invention uses MHV-A59 strain to respectively infect Ceacam1^-/-Mice and wild-type mice.

After the standard strain MHV-A59 was proliferated in a large amount by L929 cells, its TCID50 ═ 10 was determined^5.7After dilution at a ratio of 1:500, 0.5ml of the solution is injected into the abdominal cavity of each mouse.

And (3) detecting IgG: blood was collected on

days

3, 7, 14, 21, and 28, respectively, and livers were collected (Ceacam 1 for each sample)^-/-5 mice and wild type mice each, and 1 wild type mouse died due to infection at day 28), and IgG in serum was detected by ELISA method according to national Standard of the people's republic of China (GB/T14926.50-2001). And measuring the OD value by a microplate reader under the condition of a wavelength of 405 nm.

Pathological diagram: rinsing the liver of the mouse in PBS until no bloodstain exists, and fixing the liver in 4% paraformaldehyde overnight; PBS wash 3 times, 10 minutes each time; gradient dehydration of 25% ethanol, 50% ethanol, 75% ethanol, 90% ethanol, anhydrous ethanol (I) and anhydrous ethanol (II), each for 30 minutes; xylene (I) and xylene (II) each for 15 minutes; paraffin wax (I) and paraffin wax (II) are respectively used for 60 minutes; after dehydration, the heart was laid flat in paraffin for embedding; the laika paraffin slicer slices the slices with the thickness of 10 mu m.

Second, experimental results

As shown in FIG. 7, the wild-type mice became positive for IgG antibodies on day 7 after infection with MHV-A59, and the OD values were increased on day 14 and day 21, and slightly decreased on day 28. And Ceacam1^-/-Mice were consistently undetectable for IgG positivity within 28 days of continued detection following infection. Demonstrates the Ceaca prepared according to the inventionm1^-/-Mice were resistant to MHV-A59 and could not be infected with the virus. For harvested mouse livers, HE staining was performed.

Pathological results show (fig. 8), the liver of the wild-type mouse has obvious damage from day 7, a large number of blood focuses can be seen, cells are arranged disorderly and are swollen, the liver is changed like a balloon, a large amount of neutrophilic granulocyte is infiltrated, and the damage degree of the liver is more and more serious along with the increase of time; and Ceacam1^-/-The liver of the mice was always normal. The present invention presents wild-type mice and Ceacam1 at day 7 post-infection^-/-Pathology plots of mice.

Sequence listing

<110> Zhongshan university

<120> mouse for resisting mouse hepatitis virus and preparation method thereof

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Mouse hepatitis virus

<400> 1

tgaaaactat cgtcgtactc agg 23

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caccgtgaaa actatcgtcg tactc 25

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaacgagtac gacgatagtt ttcac 25

<210> 4

<211> 23

<212> DNA

<213> Mouse hepatitis virus

<400> 4

cattgaggct gtgccgcccc agg 23

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

caccgcattg aggctgtgcc gcccc 25

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaacggggcg gcacagcctc aatgc 25

<210> 7

<211> 23

<212> DNA

<213> Mouse hepatitis virus

<400> 7

gcaaaggctc caagcgccag ggg 23

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caccgcaaag gctccaagcg ccag 24

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aaacctggcg cttggagcct ttgc 24

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

taatacgact cactataggg tgaaaactat cgtcgtactc 40

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aaaagcaccg actcggtgcc 20

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctggtacaag ggaaacacta cg 22

<210> 13

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

caccatgaag gatatgggag tctac 25

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

actatcgtcg tactcaggcg 20

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gattctcatg gtttcctcag gcag 24

Claims

1. A preparation method of a mouse for resisting mouse hepatitis virus is characterized in that gene knockout is carried out by using CRISPR/Cas9 technology and sgRNA sites with nucleotide sequences shown as SEQ ID NO:1, and the method comprises the following steps:

s1, annealing and phosphorylating a primer with a nucleotide sequence shown as SEQ ID NO 2-3, and then connecting the primer to a linearized CRISPR/Cas9 vector to obtain a recombinant vector;

2. The preparation method of claim 1, wherein the CRISPR/Cas9 vector is pX330-U6-Chimeric _ BB-CBh-hSpCas 9.

3. The method of claim 2, wherein pX330-U6-Chimeric _ BB-CBh-hspsca 9 is linearized with an endonuclease BbsI.

4. The method according to claim 1, wherein the sgRNA used in step S4 is used at a concentration of 25 to 100g/μ L; the Cas9 mRNA concentration in the step S4 is 30-100 ng/. mu.L.