CN114574526B

CN114574526B - Construction method of RPSA gene pig-derived mouse model

Info

Publication number: CN114574526B
Application number: CN202210005243.9A
Authority: CN
Inventors: 金晶; 张瑞瑞; 苏会敏; 赵静
Original assignee: Jiangsu Jicui Yaokang Biotechnology Co ltd
Current assignee: Jiangsu Jicui Yaokang Biotechnology Co ltd
Priority date: 2021-01-28
Filing date: 2022-01-04
Publication date: 2024-03-12
Anticipated expiration: 2042-01-04
Also published as: CN114574526A

Abstract

The invention provides a preparation method of an RPSA gene modified swine-derived mouse, and particularly relates to a method for constructing a mouse model capable of expressing swine-derived RPSA by replacing a swine RPSA gene on a fertilized egg of a C57BL/6 background mouse by using homologous recombination and CRISPR/Cas9 technology.

Description

Construction method of RPSA gene pig-derived mouse model

Technical Field

The invention belongs to the technical field of biological medicine, and particularly relates to a construction method of an RPSA gene pig-derived mouse model.

Background

Classical swine fever (Classical swine fever, CSF), also known as swine fever, is a viral disease with high infectivity and mortality caused by classical swine fever virus (Classical swine fever virus, CSFV), and has caused tremendous economic losses in the pig industry worldwide. The world animal health organization is used for determining the infectious diseases as A-type infectious diseases, and China is used for ranking the infectious diseases as A-type infectious diseases, so that the infectious diseases are one of main epidemic diseases which endanger the development of the pig industry in China at present.

Regarding host cell surface receptors that bind CSF viruses, laminin (RPSA) is one of the host cell attachment receptors for CSFV infection. RPSA (also known as LAMR 1) is a cell surface receptor with a highly conserved sequence that mediates high affinity interactions between laminin and cells. Notably, the overexpression of porcine RPSA in a variety of non-porcine kidney cell lines (BHK-21 and CHO-K1, etc.) was performed simultaneously, and no CSFV infection was observed, presumably RPSA only facilitates viral attachment to the cell surface and is an important, but not exclusive, binding receptor for CSFV infection.

In addition, in vitro experiments at home and abroad prove that RPSA inhibits replication of Foot-and-mouth disease virus (FMDV) by inhibiting MAPK signal transduction in FMDV infected cells in the process of Foot-and-mouth disease virus (Foot-and-mouth disease virus, FMDV) infection. Meanwhile, RPSA is a binding receptor for Dengue Virus (Dengue Virus) into hepatocytes.

At present, the effective means for preventing and treating classical swine fever is to kill the virus completely though China obtains better effect in controlling and eliminating classical swine fever by vaccination, and once epidemic situation is found, the virus is killed and treated harmlessly according to relevant regulation regulations of China, thus bringing huge economic pressure to pig industry in China. Under the background that CSFV infection epidemic situation is difficult to radically cure quickly, epidemic situation control mainly depends on strengthening biological safety guarantee precautionary measures of breeding enterprises, chinese swine fever epidemic situation prevention and control are normalized, toxic production is normalized, and how to closely monitor breeding environments also brings great challenges to pig industry.

Vaccine drug research and screening experiments need to be evaluated on animal models, rodents are the most widely applied experimental animal models, and because of small size, short growth and breeding period and easy operation, the vaccine drug research and screening experiments are one of the best experimental animal models, so that at present, no swine-derived mouse model prepared for swine-derived RPSA genes is available, the Rpsa genes of the mice are replaced by the RPSA genes of the pigs through a gene modification method, the Rpsa swine-derived mouse model is prepared, the vaccine drug research and screening method has the functional genes of the pigs, has very important significance for research on infection, invasion, immunity and the like of swine-derived related viruses, and can become an ideal animal model for screening and evaluating swine fever, foot-and-mouth disease and other related drugs and diagnostic products, and new ideas and strategies are brought to development of control epidemic situations.

The CRISPR/Cas9 system gene editing function is mainly applied to genome targeting of a plurality of species, and alleles are subjected to modification (such as knockout, mutation and knock-in) operation, so that various modification models can be quickly and efficiently built to study gene functions or build disease models. Although CRISPR/Cas9 gene editing systems have high cleavage efficiency, they have been commonly used in the creation of gene knockout models, but are faced with more complex genetic modification requirements, for example, when a longer fragment is targeted, the targeting efficiency is significantly reduced as the length of the knockin fragment increases, and if the sequence of the targeting region has a homologous structure in the mouse, a significant off-target effect occurs. In addition, when the CRISPR/Cas9 system containing the donor recombination fragment is directly subjected to micromanipulation on fertilized eggs, the donor fragment can be recombined at a target site, and also has a high probability of being randomly integrated into the genome of a mouse, the integrated site is random, high copy number knockin can occur, and the randomly integrated mouse can have unexpected phenotypes such as ectopic expression of an exogenous gene, silencing or activation of an endogenous gene at a non-target site and the like under the influence of the integrated site and the copy number, so that experimental results are interfered. Therefore, the recombination efficiency of CRISPR/Cas9 system is still to be further explored and optimized, and how to reduce or avoid the random integration probability of donor when targeting, and to increase the detection rate of random integration, certainly presents a series of challenges to gene editors.

Disclosure of Invention

A method of constructing a mouse model that can express porcine RPSA by replacing porcine RPSA with murine RPSA gene on fertilized eggs of C57BL/6 background mice using homologous recombination and CRISPR/Cas9 technology.

The specific technical scheme for realizing the invention is as follows:

a construction method of an RPSA gene pig-derived mouse model comprises the steps of replacing an RPSA gene of a pig with the RPSA of the mouse on a fertilized ovum of a C57BL/6 background mouse by homologous recombination and CRISPR/Cas9 technology, and constructing the mouse model capable of expressing the pig-derived RPSA.

The construction method of the RPSA gene swine-derived mouse model comprises the following steps:

1) According to the structure and function of the swine RPSA, the swine RPSA and mouse Rpsa coding regions are selected, the difference sites are identified, and the swine sequence for replacement is determined.

2) Determining a targeting site according to the mouse RPSA gene sequence determined in the step 1), and designing a homologous DNA donor containing the pig-source RPSA gene.

3) Preparing Cas9 or an expression vector thereof based on CRISPR/Cas9 technology; sgrnas for murine sequences were designed in the porcine replacement region. Designing and synthesizing to identify a 5 'end target site and a 3' end target site, and constructing an sgRNA expression vector.

4) And injecting the Cas9/sgRNA system and a targeting vector into fertilized eggs of mice, implanting the fertilized eggs into pseudopregnant female mice, and carrying out genetic identification after birth of the mice to obtain intermediate target mice (positive F0-generation mice).

Preferably, the amino acid sequence of the RPSA swine mice used for substitution is shown in SEQ No.2 (three different sites a241T, a272T and a290T, respectively).

Preferably, the mouse RPSA gene sequence determines the targeting sites to be exon6 and exon7 of the mouse RPSA gene.

Preferably, the 5 'and 3' sgRNA recognition sites are located within the mouse Rpsa gene intron3-4 and downstream of exon7, respectively.

Preferably, the construction of the sgRNA expression vector is performed by cloning the sgRNA sequence into the pUC57kan-T7-delG vector, and constructing the pUC57-sgRNA plasmid.

Preferably, the sgrnas are prepared by transcription by the following method: and (3) performing PCR (polymerase Star or PrimerStar Max) by taking a sgRNA-F, sgRNA-R as a primer and taking a puc57-sgRNA plasmid with correct sequencing as a template, purifying a PCR product, and preparing the sgRNA transcription preparation template. Transcription of sgrnas was performed using the T7-ShortScript in vitro transcription kit (AM 1354).

Preferably, 0.5 day mice fertilized egg targeting vector injection is used.

Preferably, the obtained positive F0 generation mice are bred with wild type C57BL/6J mice, and the born mice are subjected to genotype identification to obtain the RPSA swine-derived mice animal model capable of being inherited stably.

Preferably, the positive swine-derived mice obtained are genotyping identified. And (5) identifying by PCR and sequencing and identifying the PCR product.

A construction method of an RPSA gene pig-derived mouse model comprises the following steps:

1) Exon6 and exon7 of the mouse Rpsa gene were selected as targeting sites and a homologous DNA donor containing the porcine Rpsa gene was designed.

2) Preparing Cas9 or an expression vector thereof; sgrnas for murine sequences were designed in the porcine replacement region. Designing and synthesizing to identify a 5 'end target site and a 3' end target site, and constructing an sgRNA expression vector. The sgRNA recognition sites at both ends are located within the mouse Rpsa gene intron3-4, and downstream of exon7, respectively.

3) The Cas9/sgRNA system and the targeting vector are injected into fertilized eggs of mice for 0.5 day, transplanted into pseudopregnant female mice, and after the mice are born, the gene identification is carried out to obtain the intermediate target positive mice (positive F0 generation mice).

Furthermore, the obtained positive F0 generation mice and wild type C57BL/6J mice can be matched and propagated, and the born mice are subjected to genotype identification to obtain the RPSA swine-derived mice animal model which can be inherited stably.

Further, the target site sequence of the gRNA on the RPSA in step 2) is shown in the following table:

TABLE 1 sgRNA sequences

sgRNA name	sgRNA sequence (5 '. Fwdarw.3')	PAM
			Rpsa-5S1	GAGATAGTTTTGGTACGTGG	TGG
Rpsa-5S2	GTTGAGATAGTTTTGGTACG	TGG
			Rpsa-3S1	ATTACGGCCACAGCCTATTA	AGG
Rpsa-3S2	ATCTACTCATATTCCTTAAT	AGG

Each sgRNA sequence was cloned into pUC57kan-T7-delG vector to construct a pUC57-sgRNA plasmid.

Furthermore, the sgRNA transcription preparation method is to use PrimerStar or PrimerStar Max system, sgRNA-F, sgRNA-R as a primer, and the properly sequenced puc57-sgRNA plasmid as a template to carry out PCR, and purify the PCR product to prepare the sgRNA transcription preparation template. Transcription of sgrnas was performed using the T7-ShortScript in vitro transcription kit (AM 1354).

Further, the pig-derived mice are identified for genotype.

Further, genotyping of swine mice includes: the obtained rat tail genomic DNA of the positive mice was designed and PCR identification after mid-targeting was performed using two pairs of primers, respectively. The genotyping primers designed and used are shown in the following table.

Table 2 RPSA pig-derived mouse genotype identification primers

Note that: KI is the mid-target genotype; WT is wild-type.

The primer Rpsa-wt-tF1/Rpsa-wt-tR1 was located outside the 5' homology arm and inside the intron6-7, respectively, and the PCR product resulting from the amplification of this primer was sequenced. Sequencing and analyzing the targeting region and the exon6 swine derived site, and if the targeting region is consistent with the theoretical sequence, indicating that the target vector is effectively recombined at the 5' of the mouse genome; the PCR products from this primer amplification were sequenced with Rpsa-wt-tF2/Rpsa-wt-tR2 located outside the intron6-7 and 3' homology arms, respectively, and the sequencing primers are described in Table 3 below. Sequencing analysis of the targeting region and the exon7 swine derived site, consistent with the theoretical sequence, shows that the target vector is effectively recombined in the 3' of the mouse genome. Mice positive for both-end PCR amplification and sequencing were positive mice.

TABLE 3 sequencing primers

Primer name	Primer sequences
			Rpsa-wt-tF3	CTGCCATTTGGGTGTGTGGAAT(SEQID NO.13)	Sequencing of 5' full Length product
Rpsa-wt-seqR1	AACCCATGTGTTCACATGCTTA(SEQID NO.14)	Sequencing of 3' full Length product

Further, QPCR was performed on mice positive for the target.

Drawings

Fig. 1: and constructing a targeting strategy of a mouse model capable of expressing the pig-derived RPSA.

Fig. 2: identifying an electrophoresis pattern of pRPSA PCR 5 end and pRPSA 3 end, wherein a WT negative control is genomic DNA; TRANS 2K PLUS II band: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp.

Fig. 3: pRPSA PCR 5-end sequencing alignment map.

Fig. 4: pRPSA PCR 3 end 272 th codon locus sequencing alignment map.

Fig. 5: pRPSA PCR 3 end 290 th codon site sequencing alignment map.

The CRISPR/Cas9 gene editing system has high cutting activity, is designed and constructed aiming at a target gene, can guide Cas9 protein to carry out high-efficiency cutting at a target gene locus, so as to manufacture a gene knockout model, and if exogenous sequences need to be knocked in the target gene locus, a recombination donor vector needs to be constructed simultaneously, the vector needs to comprise homologous arm structures and insertion fragments at two sides of an insertion locus, and the vector is injected into fertilized eggs together with the sgRNA and the Cas9 for recombination through the in vitro constructed donor vector.

The Rpsa gene of the mouse is positioned on chromosome 9, a structure homologous to Rpsa of the mouse exists in a plurality of chromosome sites such as chromosome 3, chromosome 17, chromosome 10, chromosome X, chromosome 4 and chromosome 14, a gRNA is designed in a region where point mutation is located, a target-off effect is inevitably brought, in order to avoid the target-off caused by homologous sequences, the target-off region is expanded, gRNA sites are designed at the downstream of intron3-4 and exon7 of the Rpsa gene respectively, so that the specificity of sequences of homologous arms and cleavage sites is ensured, but the longer the insert, the lower the recombination efficiency is, and in general cases, the recombination difficulty is greatly improved when the length of the insert is greater than 1 kb. And the gRNA is designed at the site of exogenous gene insertion, the donor is manufactured, the closer the gRNA is to the knock-in site, the higher the recombination efficiency is, the length of the donor gene sequence designed for avoiding the off-target effect is 3424bp, and the mice offspring obtained after microinjection and transplantation are successfully verified to obtain the positive mice (F0 generation) through detection means of PCR and sequencing.

The invention verifies the correct integration of target site genes by PCR and sequencing methods, and simultaneously carries out QPCR detection on mice with positive target, detects the possibility of other site integration in the genome of the mice, and further verifies that positive mice are correct targets, and other non-target sites of the positive mice are inserted randomly.

The mouse provided by the invention has the pig functional genes, the knocked-in genes are from pig RPSA genes and are knocked in the Rpsa gene locus of the mouse, and as the self regulatory elements of the mouse are reserved, the self regulatory mechanism of the mouse is utilized to control the expression of pig RPSA, meanwhile, the Rpsa genes of the mouse are silenced, and the cross reaction of medicines caused by the species amino acid homology relationship can be avoided. The model has the functional genes of pigs, and has important guiding significance for researches such as infection, invasion, immunity, drug development and the like of swine related viruses.

The construction method for constructing the mouse model capable of expressing the swine RPSA by replacing the swine RPSA gene on the fertilized eggs of the C57BL/6 background mice by using the homologous recombination and CRISPR/Cas9 technology has the advantages of high recombination efficiency, reduction or avoidance of the random integration probability of the donor during targeting, high detection rate of random integration and capability of accurately and efficiently constructing the RPSA gene swine mouse model.

Detailed Description

The following examples illustrate the specific steps of the present invention, but are not limited thereto.

The terms used in the present invention generally have meanings commonly understood by those of ordinary skill in the art unless otherwise indicated.

The invention is described in further detail below in connection with specific embodiments and with reference to the data. It should be understood that the following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

In the following examples, various processes and methods, which are not described in detail, are conventional methods well known in the art.

The invention will be further illustrated with reference to specific examples.

Example 1 determination of the substitution region of the obtained porcine fragment and the inserted porcine sequence

According to the structure and function of the swine RPSA, three differential sites of swine RPSA and mouse Rpsa coding regions are selected, the three differential sites of the swine RPSA gene are respectively A241T, A272T and A290T, the other regions all retain the murine structure, and the wild type sequence of the mouse is shown as SEQ No. 1. SEQ No.1:

Msgaldvlqmkeedvlkflaagthlggtnldfqmeqyiykrksdgiyiinlkrtweklllaaraivaienpadvsvissrntgqravlkfaaatgatpiagrftpgtftnqiqaafreprllvvtdpradhqplteasyvnlptialcntdsplryvdiaipcnnkgahsvglmwwmlarevlrmrgtisrehpwevmpdlyfyrdpeeiekeeqaaaekavtkeefqgewtapapeftaaqpevadwsegvqvpsvpiqqfptedwsaqpatedwsaaptaqatewvgattews

the corresponding nucleotide sequence is SEQ ID NO.3:

ATGTCCGGAGCCCTTGACGTCCTGCAGATGAAGGAGGAGGATGTCCTCAAATTCCTTGCTGCGGGAACCCACTTAGGTGGCACCAACCTTGACTTTCAGATGGAGCAGTACATCTACAAAAGGAAAAGTGACGGTATCTACATCATAAACCTGAAGAGGACCTGGGAGAAGCTGTTGCTCGCAGCTCGAGCTATTGTTGCCATCGAGAATCCTGCTGACGTCAGCGTCATCTCCTCCAGGAACACTGGCCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACAGGAGCCACTCCGATCGCTGGCCGCTTCACACCTGGGACCTTCACTAACCAGATCCAAGCAGCCTTCAGGGAGCCACGGCTTCTAGTGGTGACCGATCCCAGGGCTGACCATCAGCCACTCACAGAGGCCTCTTATGTCAACCTGCCCACCATTGCTCTGTGTAACACAGATTCTCCCCTGCGCTATGTGGACATTGCCATCCCATGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTGGCCAGGGAAGTACTCCGCATGCGAGGTACTATCTCCCGTGAGCACCCCTGGGAGGTCATGCCTGATCTTTACTTCTACAGAGACCCAGAGGAGATTGAGAAGGAGGAGCAGGCTGCTGCTGAGAAGGCTGTGACCAAGGAGGAATTCCAGGGTGAATGGACCGCACCAGCTCCTGAGTTCACTGCTGCTCAGCCTGAGGTGGCCGACTGGTCTGAGGGTGTGCAGGTTCCCTCTGTGCCCATCCAGCAGTTCCCCACGGAAGACTGGAGTGCACAGCCAGCCACTGAGGATTGGTCAGCAGCTCCCACAGCGCAGGCCACTGAGTGGGTTGGAGCCACCACTGAGTGGTCCTGA

EXAMPLE 2 determination of the porcine-derived RPSA protein sequence obtained

And (3) replacing the corresponding region of the B6 murine Rpsa with three different sites of the porcine RPSA gene by utilizing homologous recombination, wherein the rest sequences all keep the sequence of the B6 mouse, and the amino acid sequence of the RPSA porcine mice with successful targeting is shown as SEQ No. 2.

SEQ No.2：

###

ATGTCCGGAGCCCTTGACGTCCTGCAGATGAAGGAGGAGGATGTCCTCAAATTCCTTGCTGCGGGAACCCACTTAGGTGGCACCAACCTTGACTTTCAGATGGAGCAGTACATCTACAAAAGGAAAAGTGACGGTATCTACATCATAAACCTGAAGAGGACCTGGGAGAAGCTGTTGCTCGCAGCTCGAGCTATTGTTGCCATCGAGAATCCTGCTGACGTCAGCGTCATCTCCTCCAGGAACACTGGCCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACAGGAGCCACTCCGATCGCTGGCCGCTTCACACCTGGGACCTTCACTAACCAGATCCAAGCAGCCTTCAGGGAGCCACGGCTTCTAGTGGTGACCGATCCCAGGGCTGACCATCAGCCACTCACAGAGGCCTCTTATGTCAACCTGCCCACCATTGCTCTGTGTAACACAGATTCTCCCCTGCGCTATGTGGACATTGCCATCCCATGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTGGCCAGGGAAGTACTCCGCATGCGAGGTACTATCTCCCGTGAGCACCCCTGGGAGGTCATGCCTGATCTTTACTTCTACAGAGACCCAGAGGAGATTGAGAAGGAGGAGCAGGCTGCTGCTGAGAAGGCTGTGACCAAGGAGGAATTCCAGGGTGAATGGACCGCACCAGCTCCTGAGTTCACTGCTACTCAGCCTGAGGTGGCCGACTGGTCTGAGGGTGTGCAGGTTCCCTCTGTGCCCATCCAGCAGTTCCCCACGGAAGACTGGAGTGCACAGCCAACCACTGAGGATTGGTCAGCAGCTCCCACAGCGCAGGCCACTGAGTGGGTTGGAACAACCACTGAGTGGTCCTGA

EXAMPLE 3 vector injection grafting Positive mice were obtained

1) Selecting exon6 and exon7 of the Rpsa gene of the mouse as target sites, and designing a homologous DNA donor containing the RPSA gene of a pig source and an identification scheme;

2) Preparing Cas9 or an expression vector thereof based on CRISPR/Cas9 technology; sgrnas for murine sequences were designed in the porcine replacement region. Designing and synthesizing to identify a 5 'end target site and a 3' end target site, and constructing an sgRNA expression vector. The recognition sites for the sgrnas at both ends are located within the mouse Rpsa gene intron3-4, and downstream from exon7, respectively, and the target site sequences for each sgRNA on Rpsa are shown in table 1. Each sgRNA sequence was cloned into pUC57kan-T7-delG vector to construct a pUC57-sgRNA plasmid.

TABLE 1 sgRNA sequences

The preparation method of sgRNA transcription comprises the following steps: and (3) performing PCR (polymerase Star or PrimerStar Max) by taking a sgRNA-F, sgRNA-R as a primer and taking a puc57-sgRNA plasmid with correct sequencing as a template, purifying a PCR product, and preparing the sgRNA transcription preparation template. Transcription of sgrnas was performed using the T7-ShortScript in vitro transcription kit (AM 1354).

3) The Cas9/sgRNA system and the targeting vector are injected into fertilized eggs of mice for 0.5 day, transplanted into pseudopregnant female mice, and after the mice are born, the medium-target mice screened by the gene identification are positive F0-generation mice.

4) And breeding the obtained positive F0-generation mice and wild C57BL/6J mice, and carrying out genotype identification on the born mice to obtain the RPSA swine-derived mice animal model capable of being inherited stably.

Example 4 porcine-derived mice were genotyping.

Performing PCR identification (the details of the primers are shown in table 2) after the obtained rat tail genome DNA of the positive rat is subjected to mid-targeting by using two pairs of primers, wherein the primers Rpsa-wt-tF1/Rpsa-wt-tR1 are respectively positioned outside a 5 'homology arm and in intron6-7, sequencing a PCR product generated by amplifying the primers (the details of the sequencing primers are shown in table 3), sequencing and analyzing a targeting region and an exon6 swine-derived site, and indicating that the target vector is effectively recombined in the 5' of the rat genome when the target vector is consistent with a theoretical sequence; rpsa-wt-tF2/Rpsa-wt-tR2 are respectively positioned outside the intron6-7 and 3 'homology arms, and the PCR products generated by the primer amplification are sequenced (the sequencing primer is shown in Table 3), the sequencing analysis targeting region and the exon7 swine derived site are consistent with the theoretical sequence, so that the target vector is effectively recombined in the 3' of the mouse genome. Mice positive for both-end PCR amplification and sequencing were positive mice.

Table 2 RPSA pig-derived mouse genotype identification primers

Note that: KI is the mid-target genotype; WT is wild-type.

TABLE 3 sequencing primers

Primer name	Primer sequences
			Rpsa-wt-tF3	CTGCCATTTGGGTGTGTGGAAT	Sequencing of 5' full Length product
Rpsa-wt-seqR1	AACCCATGTGTTCACATGCTTA	Sequencing of 3' full Length product

The PCR reaction system and the reaction conditions are shown in the following table:

TABLE 4 PCR reaction System

Reagent (Vazyme P112-03)	Volume (mul)	Specification of specification
			2×Taq Master Mix，Dye Plus	12.5	\
ddH2O	9.5	\
			Primer A(10pmol/μl)	1	10pmol/μl
Primer B(10pmol/μl)	1	10pmol/μl
			Template(≈100ng/μl)	1	≈100ng/μl

TABLE 5 PCR reaction conditions

EXAMPLE 5QPCR

pRPSA mouse model PCR identification results:

the PCR amplification results of the 5-end and the 3-end are shown in the figure 2, and the figure 2 shows the identification electrophoresis patterns of the 5-end and the 3-end of pRPSA PCR. WT negative control is genomic DNA; TRANS 2K PLUS II band: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp.

The pRPSA PCR 5-end sequencing comparison map is shown in the figure 3, the arrow indicates the mutation site of the exon6 swine origin site, and the 241 th codon is mutated from GCT to ACT;

the sequencing comparison map of the 272 rd codon of the pRPSA PCR 3 end is shown in figures 4 and 5, the shading indicates the mutation site of the exon7 swine origin site, the 272 rd codon is mutated from GCC to ACC, and the 290 th codon is mutated from GCC to ACA;

results: successful acquisition of B6 background 3 positive mice were obtained. pRPSA rat DNA identification electrophoretogram, 5 'and 3' identification of target bands were positive, and sequencing comparison showed positive mice with correct mid-target.

The Cas9/sgRNA system and targeting vector were injected into fertilized eggs of 0.5 day mice, a total of 3 microinjection and transplantation were performed, and the three transplantation had 9, 9 and 17F 0 mice, respectively, and since the existing data (MGI) showed that homozygous mice knocked out the Rpsa gene had a phenotype of embryonic death, the birth rate was significantly lower from the data shown by the three transplantation. After further PCR and sequencing detection, 1, 0 and 2 positive mice are obtained respectively, and the overall positive rate is 8.6%.

The transplantation, birth and positive rates are shown in Table 6 below.

TABLE 6 transplantation, birth and Positive Rate

From the above results, it can be seen that the gRNA designed near the point mutation effectively avoids the off-target effect, and the gRNA with the expanded targeting region is involved, so that the specificity of the homology arm and the cleavage site sequence can be ensured, and the recombination efficiency is high. Meanwhile, through verification, the condition that positive mice have orthotopic forward recombination is eliminated, and the positive mice are ensured to be correctly targeted without random insertion of other non-target sites.

Sequence listing

<110> Jiangsu Jizhikang biotechnology Co., ltd

<120> construction method of RPSA gene pig-derived mouse model

<130> 20210125

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 295

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Ser Gly Ala Leu Asp Val Leu Gln Met Lys Glu Glu Asp Val Leu

1 5 10 15

Lys Phe Leu Ala Ala Gly Thr His Leu Gly Gly Thr Asn Leu Asp Phe

20 25 30

Gln Met Glu Gln Tyr Ile Tyr Lys Arg Lys Ser Asp Gly Ile Tyr Ile

35 40 45

Ile Asn Leu Lys Arg Thr Trp Glu Lys Leu Leu Leu Ala Ala Arg Ala

50 55 60

Ile Val Ala Ile Glu Asn Pro Ala Asp Val Ser Val Ile Ser Ser Arg

65 70 75 80

Asn Thr Gly Gln Arg Ala Val Leu Lys Phe Ala Ala Ala Thr Gly Ala

85 90 95

Thr Pro Ile Ala Gly Arg Phe Thr Pro Gly Thr Phe Thr Asn Gln Ile

100 105 110

Gln Ala Ala Phe Arg Glu Pro Arg Leu Leu Val Val Thr Asp Pro Arg

115 120 125

Ala Asp His Gln Pro Leu Thr Glu Ala Ser Tyr Val Asn Leu Pro Thr

130 135 140

Ile Ala Leu Cys Asn Thr Asp Ser Pro Leu Arg Tyr Val Asp Ile Ala

145 150 155 160

Ile Pro Cys Asn Asn Lys Gly Ala His Ser Val Gly Leu Met Trp Trp

165 170 175

Met Leu Ala Arg Glu Val Leu Arg Met Arg Gly Thr Ile Ser Arg Glu

180 185 190

His Pro Trp Glu Val Met Pro Asp Leu Tyr Phe Tyr Arg Asp Pro Glu

195 200 205

Glu Ile Glu Lys Glu Glu Gln Ala Ala Ala Glu Lys Ala Val Thr Lys

210 215 220

Glu Glu Phe Gln Gly Glu Trp Thr Ala Pro Ala Pro Glu Phe Thr Ala

225 230 235 240

Ala Gln Pro Glu Val Ala Asp Trp Ser Glu Gly Val Gln Val Pro Ser

245 250 255

Val Pro Ile Gln Gln Phe Pro Thr Glu Asp Trp Ser Ala Gln Pro Ala

260 265 270

Thr Glu Asp Trp Ser Ala Ala Pro Thr Ala Gln Ala Thr Glu Trp Val

275 280 285

Gly Ala Thr Thr Glu Trp Ser

290 295

<210> 2

<211> 295

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Ser Gly Ala Leu Asp Val Leu Gln Met Lys Glu Glu Asp Val Leu

1 5 10 15

Lys Phe Leu Ala Ala Gly Thr His Leu Gly Gly Thr Asn Leu Asp Phe

20 25 30

Gln Met Glu Gln Tyr Ile Tyr Lys Arg Lys Ser Asp Gly Ile Tyr Ile

35 40 45

Ile Asn Leu Lys Arg Thr Trp Glu Lys Leu Leu Leu Ala Ala Arg Ala

50 55 60

Ile Val Ala Ile Glu Asn Pro Ala Asp Val Ser Val Ile Ser Ser Arg

65 70 75 80

Asn Thr Gly Gln Arg Ala Val Leu Lys Phe Ala Ala Ala Thr Gly Ala

85 90 95

Thr Pro Ile Ala Gly Arg Phe Thr Pro Gly Thr Phe Thr Asn Gln Ile

100 105 110

Gln Ala Ala Phe Arg Glu Pro Arg Leu Leu Val Val Thr Asp Pro Arg

115 120 125

Ala Asp His Gln Pro Leu Thr Glu Ala Ser Tyr Val Asn Leu Pro Thr

130 135 140

Ile Ala Leu Cys Asn Thr Asp Ser Pro Leu Arg Tyr Val Asp Ile Ala

145 150 155 160

Ile Pro Cys Asn Asn Lys Gly Ala His Ser Val Gly Leu Met Trp Trp

165 170 175

Met Leu Ala Arg Glu Val Leu Arg Met Arg Gly Thr Ile Ser Arg Glu

180 185 190

His Pro Trp Glu Val Met Pro Asp Leu Tyr Phe Tyr Arg Asp Pro Glu

195 200 205

Glu Ile Glu Lys Glu Glu Gln Ala Ala Ala Glu Lys Ala Val Thr Lys

210 215 220

Glu Glu Phe Gln Gly Glu Trp Thr Ala Pro Ala Pro Glu Phe Thr Ala

225 230 235 240

Thr Gln Pro Glu Val Ala Asp Trp Ser Glu Gly Val Gln Val Pro Ser

245 250 255

Val Pro Ile Gln Gln Phe Pro Thr Glu Asp Trp Ser Ala Gln Pro Thr

260 265 270

Thr Glu Asp Trp Ser Ala Ala Pro Thr Ala Gln Ala Thr Glu Trp Val

275 280 285

Gly Thr Thr Thr Glu Trp Ser

290 295

<210> 3

<211> 888

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgtccggag cccttgacgt cctgcagatg aaggaggagg atgtcctcaa attccttgct 60

gcgggaaccc acttaggtgg caccaacctt gactttcaga tggagcagta catctacaaa 120

aggaaaagtg acggtatcta catcataaac ctgaagagga cctgggagaa gctgttgctc 180

gcagctcgag ctattgttgc catcgagaat cctgctgacg tcagcgtcat ctcctccagg 240

aacactggcc agcgagctgt gctgaagttt gctgctgcca caggagccac tccgatcgct 300

ggccgcttca cacctgggac cttcactaac cagatccaag cagccttcag ggagccacgg 360

cttctagtgg tgaccgatcc cagggctgac catcagccac tcacagaggc ctcttatgtc 420

aacctgccca ccattgctct gtgtaacaca gattctcccc tgcgctatgt ggacattgcc 480

atcccatgca acaacaaggg agctcactca gtgggtctga tgtggtggat gctggccagg 540

gaagtactcc gcatgcgagg tactatctcc cgtgagcacc cctgggaggt catgcctgat 600

ctttacttct acagagaccc agaggagatt gagaaggagg agcaggctgc tgctgagaag 660

gctgtgacca aggaggaatt ccagggtgaa tggaccgcac cagctcctga gttcactgct 720

gctcagcctg aggtggccga ctggtctgag ggtgtgcagg ttccctctgt gcccatccag 780

cagttcccca cggaagactg gagtgcacag ccagccactg aggattggtc agcagctccc 840

acagcgcagg ccactgagtg ggttggagcc accactgagt ggtcctga 888

<210> 4

<211> 888

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atgtccggag cccttgacgt cctgcagatg aaggaggagg atgtcctcaa attccttgct 60

gcgggaaccc acttaggtgg caccaacctt gactttcaga tggagcagta catctacaaa 120

aggaaaagtg acggtatcta catcataaac ctgaagagga cctgggagaa gctgttgctc 180

gcagctcgag ctattgttgc catcgagaat cctgctgacg tcagcgtcat ctcctccagg 240

aacactggcc agcgagctgt gctgaagttt gctgctgcca caggagccac tccgatcgct 300

ggccgcttca cacctgggac cttcactaac cagatccaag cagccttcag ggagccacgg 360

cttctagtgg tgaccgatcc cagggctgac catcagccac tcacagaggc ctcttatgtc 420

aacctgccca ccattgctct gtgtaacaca gattctcccc tgcgctatgt ggacattgcc 480

atcccatgca acaacaaggg agctcactca gtgggtctga tgtggtggat gctggccagg 540

gaagtactcc gcatgcgagg tactatctcc cgtgagcacc cctgggaggt catgcctgat 600

ctttacttct acagagaccc agaggagatt gagaaggagg agcaggctgc tgctgagaag 660

gctgtgacca aggaggaatt ccagggtgaa tggaccgcac cagctcctga gttcactgct 720

actcagcctg aggtggccga ctggtctgag ggtgtgcagg ttccctctgt gcccatccag 780

cagttcccca cggaagactg gagtgcacag ccaaccactg aggattggtc agcagctccc 840

acagcgcagg ccactgagtg ggttggaaca accactgagt ggtcctga 888

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gagatagttt tggtacgtgg 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gttgagatag ttttggtacg 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

attacggcca cagcctatta 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

atctactcat attccttaat 20

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aaagtgacgg tcagttgcca cct 23

<210> 10

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

actgtaaaag ctccctggca gc 22

<210> 11

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

ggatacactg tgtcttgaca ctgctc 26

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

cacttggaga ctctgggaaa gct 23

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

ctgccatttg ggtgtgtgga at 22

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

aacccatgtg ttcacatgct ta 22

Claims

1. A construction method of an RPSA gene pig-derived mouse model is characterized in that the pig RPSA is replaced with the mouse RPSA gene on fertilized eggs of a C57BL/6 background mouse by homologous recombination and CRISPR/Cas9 technology, and a mouse model capable of expressing pig-derived RPSA is constructed;

the method comprises the following steps:

1) According to the structure and the function of the swine RPSA, selecting swine RPSA and mouse Rpsa coding regions, identifying difference sites and determining swine sequences for replacement;

the amino acid sequence of the RPSA swine-derived mice used for replacement is shown as SEQ ID No. 2;

2) Determining a targeting site according to the mouse RPSA gene sequence determined in the step 1), and designing a homologous DNA donor containing the pig-source RPSA gene;

the mouse RPSA gene sequence determines that the targeting sites are exon6 and exon7 of the mouse Rpsa gene;

3) Preparing Cas9 or an expression vector thereof based on CRISPR/Cas9 technology; designing sgRNA aiming at a murine sequence in a swine-derived substitution region, designing and synthesizing and identifying a 5 '-end target site and a 3' -end target site, and constructing a sgRNA expression vector;

the sgRNA sequence is as follows:

Rpsa-5S1：GAGATAGTTTTGGTACGTGG

Rpsa-5S2：GTTGAGATAGTTTTGGTACG

Rpsa-3S1：ATTACGGCCACAGCCTATTA

Rpsa-3S2：ATCTACTCATATTCCTTAAT；

the 5 'and 3' sgRNA recognition sites are located within the mouse Rpsa gene intron3-4 and downstream of exon7, respectively;

constructing a sgRNA expression vector, namely cloning a sgRNA sequence into a pUC57kan-T7-delG vector, and constructing a pUC57-sgRNA plasmid;

4) Injecting the Cas9/sgRNA system and the targeting vector into fertilized eggs of mice for 0.5 day, implanting the fertilized eggs into pseudopregnant female mice, carrying out genetic identification after the mice are born, obtaining a medium-target mice, namely positive F0-generation mice, carrying out mating propagation on the obtained positive F0-generation mice and wild type C57BL/6J mice, and carrying out genotype identification on the born mice to obtain the RPSA swine-derived mice animal model capable of being inherited stably.

2. Use of the construction method of claim 1 for obtaining a mouse model for vaccine drug development, said use being for non-disease diagnosis or treatment purposes.

3. Use according to claim 2 for screening or evaluating drugs and diagnostic products related to swine fever or foot and mouth disease for non-disease diagnostic or therapeutic purposes.