CN116790680A

CN116790680A - Method for constructing male sterile animal model and application

Info

Publication number: CN116790680A
Application number: CN202310724778.6A
Authority: CN
Inventors: 谢春波; 谭跃球; 涂超峰; 何文斌; 易思兵; 蒙岚岚; 谭琛; 程德华
Original assignee: Guang Xiu Gao Xin Life Science Co ltd Hunan; Reproductive and Genetic Hospital of CITIC Xiangya Co Ltd
Current assignee: Guang Xiu Gao Xin Life Science Co ltd Hunan; Reproductive and Genetic Hospital of CITIC Xiangya Co Ltd
Priority date: 2023-06-19
Filing date: 2023-06-19
Publication date: 2023-09-22

Abstract

The application provides a construction method and application of a male sterile animal model. The construction method constructs an animal model simulating the human KIF6c.1325_1326del mutation through a CRISPR/Cas9 system. The male sterile animal model constructed by the method shows obvious abnormal sperm morphology and motility, can be used for researching a molecular mechanism of spermatogenesis disorder caused by KIF6 defect, and provides clinical treatment thought and strategy for patients carrying the gene defect.

Description

Method for constructing male sterile animal model and application

Technical Field

The application relates to the technical field of animal models, in particular to a construction method and application of a male sterile animal model.

Background

Infertility is not only a global medical problem, but also a serious challenge facing the current population and health area. In infertility, male factors account for about 50%, and are often manifested as semen quality abnormalities such as azoospermia, oligospermia, teratospermia. Clinically, the etiology leading to male infertility is very complex, mainly comprising: genetic factors, environmental factors, infectious factors, immune factors, and the like, wherein genetic factors including genetic mutation are important causes of male sterility.

In recent years, the rapid development of high throughput sequencing methods has led to the identification of a number of candidate novel genes associated with male sterility. But these genes would lead to male infertility? How do these genes lead to male infertility? The related problems are to be further studied and explained.

Disclosure of Invention

Based on the above, the application provides a construction method and application of a male sterile animal model simulating human KIF6c.1325_1326del mutation. The male sterile animal model constructed by the method shows obvious abnormal sperm morphology and motility, can be used for researching a molecular mechanism of spermatogenesis disorder caused by KIF6 defect, and provides clinical treatment thought and strategy for patients carrying the gene defect.

The specific technical scheme is as follows:

according to one aspect of the present application, a method of constructing a male sterile animal model is provided that constructs an animal model that mimics the human kif6c.1325_1326del mutation by a CRISPR/Cas9 system.

In one embodiment, the animal used to prepare the male sterile animal model is a mouse; the construction method is used for constructing a male sterile animal model by knocking out the 13 th exon and the 14 th exon of the mouse KIF6 gene through a CRISPR/Cas9 system.

In one embodiment, the construction method comprises the steps of:

designing a first sgRNA recognition fragment and a second sgRNA recognition fragment for the upstream of KIF6 exon13 and downstream of exon14 of the mouse, respectively;

transferring the first sgRNA, the second sgRNA, and Cas9mRNA into a fertilized mouse egg;

transplanting the fertilized eggs into a surrogate female mouse to produce F0 generation; and

Mating the F0 generation with a wild type to obtain an F1 generation heterozygote, and selfing the F1 generation heterozygote to obtain an F2 generation homozygous mutant mouse.

In one embodiment, the nucleotide sequence of the first sgRNA recognition fragment is shown in SEQ ID No. 1; the nucleotide sequence of the second sgRNA recognition fragment is shown as SEQ ID NO. 2.

In one embodiment, the construction method further comprises the steps of:

synthesizing a first double-stranded DNA comprising the first sgRNA recognition fragment and a second double-stranded DNA comprising the second sgRNA recognition fragment;

constructing a first expression vector containing the first double-stranded DNA and a second expression vector containing the second double-stranded DNA;

extracting the DNA of the first expression vector and the second expression vector; and

And taking the DNA of the first expression vector and the second expression vector as a transcription template to obtain the mRNA of the first sgRNA and the mRNA of the second sgRNA.

In one embodiment, the step of synthesizing the first double-stranded DNA and the second double-stranded DNA comprises:

adding a sticky end sequence to the 5' end of the first sgRNA recognition fragment to form a fragment with a nucleotide sequence shown as SEQ ID NO. 3; adding cohesive end sequences at two ends of the complementary sequence of the first sgRNA recognition fragment to form a fragment with a nucleotide sequence shown as SEQ ID NO. 4; annealing the first sgRNA with the sticky end and the complementary sequence with the sticky end to form a first double-stranded DNA;

adding a sticky end sequence to the 5' end of the second sgRNA recognition fragment to form a fragment with a nucleotide sequence shown as SEQ ID NO. 5; adding cohesive end sequences at two ends of the complementary sequence of the second sgRNA recognition fragment to form a fragment with a nucleotide sequence shown as SEQ ID NO. 6; annealing the cohesive terminated second sgRNA and its cohesive terminated complementary sequence to form a second double stranded DNA.

In one embodiment, the Cas9mRNA is synthesized by:

providing a linearized Cas9 expression vector as a transcription template;

and (3) performing in vitro transcription by using a primer pair with nucleotide sequences shown as SEQ ID NO. 7-8 to synthesize the Cas9mRNA.

In one embodiment, the construction method further comprises the steps of:

the primer pair with the nucleotide sequence shown as SEQ ID NO. 9-10 is used for identifying the genotype of the F1 generation heterozygote.

In one embodiment, the construction method further comprises the steps of:

the primer pair with the nucleotide sequence shown as SEQ ID NO. 9-12 is used for identifying the genotype of the F2 generation homozygote.

According to another aspect of the application, there is provided an application of a male sterile animal model constructed by the above-mentioned method for constructing a male sterile animal model in screening a drug for treating a disease associated with male sterility.

Compared with the prior art, the application has the following beneficial effects:

applicant found from studies that male sterile patients with oligospermia carry KIF6 (nm_ 145027): a double allele mutation of 1325_6del (p.T442Sfs.3) which causes the KIF6 protein to introduce a stop codon at the 442 th amino acid site, the encoded protein is truncated; based on the above, a mouse mutation model with protein variation similar to the KIF6 mutation is constructed, and can be used for researching the function of the KIF6 gene in the spermatogenesis process.

Drawings

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present application, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic diagram of a mouse model constructed using CRISPR/Cas9 technology to mimic the KIF6c.1325_1326del (p.T442S fs 3) mutation carried by male sterile patients;

FIG. 2 is a western blot diagram demonstrating that both patients with a KIF6c.1325_1326del (p.T442Sfs.3) mutation and mutations carried by mutant mice can produce truncated proteins;

FIG. 3 is a plasmid map of pX 330;

FIG. 4 is a graph of agarose gel electrophoresis detection of the F1 generation of the KIF6 mutant mouse model;

FIG. 5 is a plot of the sequencing peaks for the F1 generation of the KIF6 mutant mouse model;

FIG. 6 is a schematic representation of the localization of an identification primer to the KIF6 gene;

FIG. 7 is a graph showing the genotyping results for the F2 generation of the mutant KIF6 mouse model;

FIG. 8 is a graph of fertility identification results for KIF6 mutant mice;

FIG. 9 shows the detection of the KIF6 gene in different mice by RT-PCRExpression; a is gel electrophoresis detection diagram of RT-PCR amplified product, and B is Kif6 ^mut/mut Mice and Kif6 ^wt/mut A KIF6 expression analysis result graph of mice;

FIG. 10 shows Kif6 ^wt/wt Mouse, kif6 ^wt/mut Mice and Kif6 ^mut/mut Comparison figures of body types of mice;

FIG. 11 is a graph of testicular tissue size and statistical analysis of different mice;

FIG. 12 shows Kif6 ^mut/mut Mice and Kif6 ^wt/mut Comparison graphs of the number, morphology and motility of epididymal sperm of mice; a is a statistical analysis chart of the number of sperms, B is a statistical analysis chart of the proportion of sperms moving forward, C is a statistical analysis chart of the curve movement speed of sperms, D is a statistical analysis chart of the linear movement speed of sperms, E is a statistical analysis chart of the average movement speed of sperms, F is a statistical analysis chart of the average swing amplitude of sperms, G is a statistical analysis chart of the proportion of sperms moving linearly on average, and H is a statistical analysis chart of the proportion of sperms at rest.

Detailed Description

The detailed description of the present application will be provided to make the above objects, features and advantages of the present application more obvious and understandable. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. The present application may be embodied in many other forms than described herein and similarly modified by those skilled in the art without departing from the spirit of the application, whereby the application is not limited to the specific embodiments disclosed below.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the description of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Unless otherwise specifically indicated, the various raw materials, reagents, instruments, equipment and the like used in the present application are commercially available or may be prepared by existing methods.

CRISPR is an adaptive immune system of bacteria and archaea against phage infection. In this system, single-stranded guide RNAs (sgrnas) direct endonucleases to specific genomic sequences and cleave DNA near PAM sequences (protospacer adjacent motif) to form Double-strand-DNA breaks (DSBs), which can then be used to introduce mutation information in exogenous templates into genomic DNA using homologous recombination repair mechanisms.

WES (whole exome sequencing ): the method is characterized in that the sequence capturing technology is utilized to capture and enrich the DNA of the exon region of the whole genome, and then high-throughput sequencing is carried out, so that genetic variation SNP (single nucleotide polymorphism) related to protein functional variation can be directly found.

RT-PCR (reverse transcription-polymerase chain reaction, reverse transcription polymerase chain reaction: a technique combining reverse transcription (reverse transcription) of RNA and polymerase chain amplification (PCR) of cDNA, firstly extracting total RNA in tissues or cells, using mRNA therein as a template, reverse transcription into cDNA using Oligo (dT) or random primers, and then carrying out PCR amplification using cDNA as a template to obtain a target gene or detect gene expression.

Applicant found a double allelic mutation (c1325_ 1326del[p.T442S fs*3) of kinesin family member KIF6 (Kinesin family member, kinesin family member 6) in 1 patient with oligospermia infertility by whole exome sequencing (whole exome sequencing, WES)]). KIF6 was originally thought to be a coronary heart disease susceptibility gene, but subsequent studies confirmed that this association did not exist; zebra fish with KIF6 mutations survived without significant heart defects, but juvenile scoliosis was found. In 2018, konjikusic et al identified homozygous frameshift mutations in KIF6 gene in 1 male infant suffering from neurodevelopmental disorder and mental disorder, KIF6 knockout mice did not have heart abnormality-related phenotype, but exhibited severe hydrocephalus due to ventricular cilia defect. Konjikuic et al constructed Kif6 by CRISPR-Cas9 ^p.G555fs Mutant mice, all homozygous mutant mice (7) developed hydrocephalus phenotype at 14 days post-natal and became severe with age; at 28 days, the brain of the mutant mice was significantly larger than the littermate control group,therefore, it was not experimentally observed in mice 28 days later (45 days were required for completion of the first wave of spermatogenesis in mice), and it was not clear whether KIF6 gene deficiency was the cause of spermatogenesis disorder and male infertility. Thus, it is unclear whether mutations in the KIF6 gene affect spermatogenesis, which in turn leads to male infertility.

Based on this, some embodiments of the present application provide a method of constructing a male sterile animal model.

In some of these embodiments, the above-described methods of constructing a male sterile animal model construct an animal model that mimics the human KIF6c.1325_1326del mutation via a CRISPR/Cas9 system.

The applicant found through research that male sterile patients with clinical oligospermia and teratospermia carry a biallelic mutation of kif6c.1325_1326del (p.t442s fs 3), which causes KIF6 protein to introduce a stop codon at amino acid position 442, and protein truncation occurs. An animal model is constructed based on the protein variation caused by the mutation site, and can be used for researching whether the KIF6 gene is associated with male sterility related diseases.

In some embodiments, the animal used to prepare the male sterile animal model is a mouse.

In some of these embodiments, the male sterile animal model is constructed by knocking out exon13 and exon14 of the mouse KIF6 gene.

Bioinformatics prediction shows that after knocking out the 13 th to 14 th exons of the mouse KIF6 gene, the coded KIF6 protein introduces a stop codon at 486 th amino acid site, so that the translated KIF6 protein is truncated. The KIF6 protein encoded by the KIF6 c.1325_6del mutation is obtained by introducing a stop codon at the 442 th amino acid position, so that the translated KIF6 protein is truncated. Both are loss-of-function mutations, so animal models constructed by knocking out exons 13 to 14 of the mouse KIF6 gene can mimic the human KIF6c.1325_1326del mutation and be used to explore the role of the gene in spermatogenesis.

In some embodiments, the method for constructing a male sterile animal model comprises the following steps:

designing a first sgRNA recognition fragment and a second sgRNA recognition fragment for the upstream of KIF6 exon13 and downstream of exon14 of the mouse, respectively; and

Transferring the first sgRNA, the second sgRNA and Cas9mRNA into a fertilized egg of a mouse;

transplanting fertilized eggs into a surrogate female mouse to produce F0 generation; and

The sgrnas between 2 coiled-coil domains of the mouse KIF6 protein were targeted to obtain a truncated protein comprising only the N-terminal driving motor domain and 1 coiled-coil domain near the N-terminal, capable of mimicking the biallelic mutation (c1325_ 1326del[p.T442S fs*3) of KIF6 in male sterile patients.

In some specific examples, the nucleotide sequence of the first sgRNA recognition fragment is shown in SEQ ID No. 1; the nucleotide sequence of the second sgRNA recognition fragment is shown in SEQ ID NO. 2.

Specifically, the nucleotide sequence shown in SEQ ID NO.1 is: 5'-GACCCGTCATTAAGTTGACA-3'; the nucleotide sequence shown in SEQ ID NO.2 is: 5'-ACCCTATCAATTGTACCTGG-3'.

By adopting the two sgRNA recognition fragments of the specific sequences, specific knockout and knock-in of the specific sequences of the 13 th and 14 th exons of the mouse KIF6 gene can be rapidly and accurately carried out, and the KIF6 (NM_ 145027) carried by male sterile patients can be simulated: 1325_1326del (p.t442s fs 3) biallelic mutation.

In some specific examples, the above construction method further includes the following steps:

synthesizing a first double-stranded DNA comprising a first sgRNA recognition fragment and a second double-stranded DNA comprising a second sgRNA recognition fragment;

constructing a first expression vector containing a first double-stranded DNA and a second expression vector containing a second double-stranded DNA;

And taking the DNA of the first expression vector and the second expression vector as transcription templates to obtain the mRNA of the first sgRNA and the mRNA of the second sgRNA.

In some specific examples, the step of synthesizing the first double-stranded DNA and the second double-stranded DNA includes:

Specifically, the nucleotide sequence shown in SEQ ID NO.3 is:

5’-CACCTAATACGACTCACTATAGGGGACCCGTCATTAAGTTGACA-3’；

the nucleotide sequence shown in SEQ ID NO.4 is:

5’-AAACTTGTCAACTTAATGACGGGTCCCCTATAGTGAGTCGTATTA-3’；

the nucleotide sequence shown in SEQ ID NO.5 is:

5’-CACCTAATACGACTCACTATAGGGACCCTATCAATTGTACCTGG-3’；

the nucleotide sequence shown in SEQ ID NO.6 is:

5’-AAACTCCAGGTACAATTGATAGGGTCCCTATAGTGAGTCGTATTA-3’。

mRNA for the sgRNA is obtained by constructing an expression vector containing the recognition fragment of the sgRNA and transcribing it in vitro.

In some specific examples thereof, the Cas9mRNA described above is synthesized by:

providing a linearized Cas9 expression vector as a transcription template;

Specifically, the nucleotide sequence shown in SEQ ID NO.7 is:

5’-TTAATACGACTCACTATAGGGATGGACTATAAGGACCACGAC-3’；

specifically, the nucleotide sequence shown in SEQ ID NO.8 is:

5’-GCGAGCTCTAGGAATTCTTAC-3’。

in some specific examples, the above construction method further includes the following steps: the primer pair with the nucleotide sequence shown as SEQ ID NO. 9-10 is used for identifying the genotype of the F1 generation mice.

Specifically, the nucleotide sequence shown in SEQ ID NO.9 is:

5’-TGTTCTGAGTAGTAGCCATCTCT-3’；

the nucleotide sequence shown in SEQ ID NO.10 is:

5’-TGTGCAAGCATCTAATCCATCAC-3’。

in some specific examples, the above construction method further includes the following steps: the primer pair with the nucleotide sequence shown as SEQ ID NO. 9-12 is used for identifying the genotype of the F2-generation mice.

Specifically, the nucleotide sequence shown in SEQ ID NO.11 is:

5’-CTAAGGCATTTAGCCTGGGAGAA-3’；

specifically, the nucleotide sequence shown in SEQ ID NO.12 is:

5’-GGTACCCTCGCTTGCTTACTC-3’。

in some specific examples, the method of identification described above is PCR amplification or Sanger sequencing.

The method for constructing the male sterile animal model has at least the following advantages:

by targeting sgrnas between 2 coiled-coil domains of the mouse KIF6 protein to obtain a truncated protein comprising only the N-terminal kinesin motor domain and 1 coiled-coil domain near the N-terminal, a male sterile animal model of KIF6 gene mutation was constructed that was able to mimic the biallelic mutation (c1325_ 1326del[p.T442S fs*3) of KIF6 in male sterile patients.

Compared with the wild type, the sperm proportion of forward movement, curve movement, linear movement, average movement speed, average swing amplitude and average linear movement of the sperm in the male sterile animal model constructed by the method is reduced, and the sperm proportion of the static sperm is obviously increased. The surface male sterile animal model can be used for researching and analyzing the molecular mechanism of spermatogenesis disorder, and provides a new idea for diagnosis and treatment of male sterile patients.

Some embodiments of the application also provide an application of the male sterile animal model constructed by the method in screening medicines for treating male sterility related diseases.

The present application will be further described with reference to specific examples and comparative examples, which should not be construed as limiting the scope of the application.

Example 1: construction of KIF6 mutant mouse model

(1) Preliminary localization of sgrnas

Human KIF6 protein consists of 814 amino acids, including 1 kinesin motor domain (Kinesin motor domain) and 3 coded-coil domains, patient KIF6 (nm_ 145027): the 1325_1326del (p.t442s fs 3) mutation results in the production of truncated proteins (comprising only the N-terminal kinesin motor domain and 1 coiled-coil domain near the N-terminal). The mouse KIF6 protein consists of 802 amino acids, including 1 kinesin motor domain (Kinesin motor domain) and 2 coiled-coil domains.

Further, applicants utilized CRISPR/Cas9 technology to mimic KIF6 (nm_ 145027) found by WES sequencing in 1 case of feeble teratospermia male infertility patients: double allele mutation of 1325_1326del (p.T442Sfs.3) construction of KIF6 Gene mutant mice (Kif6) ^mut/mut ) 2 sgrnas were designed to target the Exon13 upstream and Exon14 downstream of KIF6 gene, respectively, to disrupt the 1 coiled-coil domain near the C-terminus in the mouse KIF6 protein to obtain a truncated protein comprising only the N-terminal kinesin motor domain and 1 coiled-coil domain near the N-terminus.

Bioinformatics prediction shows that the deletion of 13 th and 14 th exons of mutant mouse KIF6 gene leads to the introduction of a stop codon into coded KIF6 protein at 486 th amino acid site, resulting in the truncation of translated KIF6 protein; the KIF6 protein encoded by the KIF6c.1325_1326del mutation introduces a stop codon at the 442 th amino acid site, so that the translated KIF6 protein is truncated (shown in FIG. 1); both are loss-of-function mutations.

In vitro overexpression plasmid transfection HEK293 cell experiments also revealed patient-carried KIF6 (nm_ 145027): both the 1325_1326del (p.t442s fs×3) mutation and the mouse carried mutant sequence resulted in truncated protein production (as shown in fig. 2). The mutant mice described above were shown to mimic the KIF6c.1325_1326del mutation in male patients and were used to study the role of KIF6 in spermatogenesis.

(2) Design of target KIF6 mutation site sgRNA

Searching for the target KIF6 (GenBank: NM-177052.3; ensembl: ENSMUST 00000162854.2) on an http:// crispor.tefor.net/website established at Zhang Feng, designing and synthesizing a first sgRNA (PAM is NGG) upstream of Exon13 for KIF6, designing and synthesizing a second sgRNA (PAM is NGG) downstream of Exon14 for KIF 6; 2 sgrnas with better cleavage efficiency and lower probability of off-target were predicted at the CCtop website. Wherein the nucleotide sequence of the first sgRNA is shown as SEQ ID NO.1, and the cleavage efficiency is 0.57; the nucleotide sequence of the second sgRNA is shown as SEQ ID NO.2, and the cleavage efficiency is 0.68.

Because the transcription of the sgRNA template requires a T7 promoter, the 5' ends of the first sgRNA and the second sgRNA are respectively added with a T7 promoter sequence, and the synthetic nucleotide sequences are shown as SEQ ID NO.3 and SEQ ID NO.5, which are respectively named as Kif6-sgRNA-1-F and Kif6-sgRNA-2-F; respectively adding cohesive ends at two ends of complementary sequences of the first sgRNA and the second sgRNA, and synthesizing sequences with nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.6, which are respectively named as Kif6-sgRNA-1-R and Kif6-sgRNA-2-R; for transcription of sgrnas. The sequence information is shown in table 1.

TABLE 1

(3) Construction of expression vectors

The sgrnas anneal to form double stranded DNA: the transcription template sequences of the first sgRNA (Kif 6-sgRNA-1-F and Kif 6-sgRNA-1-R) and the transcription template sequences of the second sgRNA (Kif 6-sgRNA-2-F and Kif 6-sgRNA-2-R) are respectively diluted to a final concentration of 100umol/L, 10uL of each of the forward (F) and reverse (R) chains is added into a PCR tube, sealed by a sealing film, placed into 500 mL-600 mL boiled water, and naturally annealed to room temperature to form a first double-stranded DNA (dsDNA) and a second double-stranded DNA.

Tangential restriction of pX330 vector BbsI: the BbsI enzyme is utilized to tangentially linearize the pX330 cloning vector (the plasmid map of the pX330 in FIG. 3), the enzyme digestion reaction system is shown in Table 2, the prepared reaction reagents are mixed and centrifuged, and the mixture is placed into a water bath kettle at 37 ℃ for incubation for 0.5h, and the mixture is oscillated once at intervals and centrifuged to prevent liquid drops from evaporating onto a pipe cover.

TABLE 2

Name of the name	Dosage of
		pX330	3μg
BbsI-HF	1.5μL
		10×NEBuffer	5μL
ddH ₂ O	Make up to 50 mu L

Ligation was performed according to the reaction system shown in Table 3, and the reaction was carried out at 16℃for 3 hours, followed by cyclization to construct an expression vector: and constructing a first expression vector by taking the first double-stranded DNA as a template, and constructing a second expression vector by taking the second double-stranded DNA as a template.

TABLE 3 Table 3

(4) In vitro transcription amplification of sgRNA

Selecting enzyme cutting sites at the downstream of the sgRNA template sequence, and linearizing the first expression vector and the second expression vector by KpnI endonuclease, wherein RNA transcripts with different lengths can be obtained by taking non-linearized circular plasmids as templates, and the enzyme cutting linearization can ensure that the sgRNA mRNA transcripts with determined lengths and sequences are obtained; the reaction system is shown in Table 4, the prepared reaction reagents are mixed and centrifuged, and the mixture is placed in a water bath kettle at 37 ℃ for incubation for 0.5h, and the mixture is oscillated and centrifuged once at intervals. And respectively extracting the DNA of the linearized first expression vector and the DNA of the linearized second expression vector to serve as templates for in vitro transcription of the sgRNA.

TABLE 4 Table 4

Composition of the components	Dosage of
		First expression vector or second expression vector	3μg
KpnI	1.5μL
		10×NEBuffer	5μL
ddH ₂ O	Make up to 50 mu L

According to the step requirements of the MEGAshortscript T kit, in vitro transcription reactions were performed in PCR tubes according to the reaction system of table 5: incubation was carried out overnight at 37℃to obtain maximum yield. After the incubation was completed, 1. Mu.L of TURBO DNase was added to the system and incubated at 37℃for 15 minutes to remove the DNA template. Subsequently, phenol-chloroform extraction/NH was used ₄ The first sgRNA or the second sgRNA was purified by OAc precipitation and dissolved in 10. Mu.L to 20. Mu.L RNase-free water. The sgRNA mRNA was obtained by in vitro transcription.

TABLE 5

(5) In vitro transcription of Cas9mRNA

Linearizing pX330 with NotI endonuclease, mixing the prepared reagents, centrifuging, incubating in a 37 deg.C water bath for 0.5h, oscillating once at intervals, and centrifuging.

TABLE 6

A T7 promoter is introduced into a primer for amplifying a Cas9 sequence (the primer sequence is shown in table 7), the Cas9 sequence in the linearized pX330 vector is amplified by using T7-Cas9-F/R, and the amplified product is T7-Cas9, which is used as a template for Cas9 in vitro transcription. And recovering the T7-Cas9 product using a QIAquick PCR product purification kit.

TABLE 7

Using the purified T7-Cas9 product as a template, it was transcribed into Cas9mRNA using mMESSAGE mMACHINETMT7ULTRA transcription kit: incubating for 2h at 37℃according to the transcription system configuration shown in Table 8; mu.L of TURBO DNase was added and incubated at 37℃for 30 minutes.

TABLE 8

Reagent(s)	Volume of
		T7 2×NTP/ARCA	10μL
10×T7 Reaction Buffer	2μL
		T7-Cas9 products	1μg
T7 Enzyme Mix	2μL
		Nuclease-free H ₂ O	Make up to 20 mu L

Poly (A) tails were added to the reaction products described above, followed by tailing reagents in the order indicated in Table 9. After mixing, 2.5. Mu.L of the mixture was removed and 4. Mu. L E-PAP was added; mixing well, incubating at 37 ℃ for 45 minutes. SubsequentlyExtraction of NH Using phenol-chloroform ₄ Purifying the Cas9mRNA by OAc precipitation; the precipitate was dissolved with 10. Mu.L to 20. Mu.L RNase-free water.

TABLE 9

(6) Microinjection and identification of F0 mice: diluting the first sgRNA mRNA and the second sgRNA mRNA obtained by amplification in the step (4) and the Cas9mRNA synthesized in the step (5) respectively to obtain 25 ng/. Mu.L of the first sgRNA mRNA and the second sgRNA mRNA and 100 ng/. Mu.L of the Cas9mRNA, and taking 10 mu.L of each to obtain 30 mu.L of total microinjection mixture. Fertilized eggs are obtained from the uterus of donor female mice 0.5 days after mating, fertilized eggs with good morphology and moderate development state are selected and transferred into a culture medium of an injection dish, and microinjection mixed solution is injected into the fertilized eggs; subsequently, the fertilized eggs after microinjection are returned to the oviduct of the surrogate mice; and carrying out PCR and sequencing identification on the mice after birth to obtain positive F0-generation mice.

(7) Breeding and identification of F1 mice: and (3) breeding the neutral mature positive F0 mice in the step (6) with wild mice for one generation respectively, and carrying out PCR and sequencing verification on the F1 generation mice. The F1 mice will be used for further propagation to obtain KIF6 homozygous mutant mice (Kif 6 ^mut/mut )。

The targeted region of the mouse KIF6 locus was PCR amplified using specific primers shown in table 10. The accuracy of targeting was confirmed by sequencing the PCR products. Toe DNA of F1-generation mice was amplified (the successful band size for targeting was about 500bp, the wild-type band size was 75740 bp) using Kif6-F1 and Kif6-R1 primers, and FIG. 4 is a 1% agarose gel electrophoresis chart of the amplified products; FIG. 5 is a graph of the sequencing peaks of the K1 sample, wherein the sequencing results of K1, K2, K3 and K4 show that the F1 generation mice are successfully constructed.

Table 10

Sequence number	Name of the name	Sequence (5 '-3')
			SEQ ID NO.9	Kif6-F1	TGTTCTGAGTAGTAGCCATCTCT
SEQ ID NO.10	Kif6-R1	TGTGCAAGCATCTAATCCATCAC

(8) Identification of F2 mice

F1 generation heterozygote male mouse (Kif 6) ^wt/mut ) After the heterozygote female mice were caged, genotype identification was performed on the F2 mice born using the primer pairs shown in Table 10 and Table 11, respectively (the localization of each primer on the KIF6 gene is shown in FIG. 6). The detection results are shown in FIG. 7 (male sex rat, female sex rat, -/-means Kif 6) ^mut/mut Mice, +/-refer to Kif6 ^wt/mut A mouse); heterozygous mice (Kif 6) ^wt ^/mut ) Two-item bands with the sizes of 500bp and 349bp can be amplified; homozygous mice (Kif 6) ^mut/mut ) Only the target band of 500bp in size can be amplified.

TABLE 11

Sequence number	Name of the name	Sequence (5 '-3')
			SEQ ID NO.11	Kif6-F2	CTAAGGCATTTAGCCTGGGAGAA
SEQ ID NO.12	Kif6-R2	GGTACCCTCGCTTGCTTACTC

Example 2: detection and identification of KIF6 mutant mice

(1) Fertility detection: the toe DNA of the mice was extracted and genotyping was performed by agarose gel electrophoresis in combination with Sanger sequencing. Kif6 was used ^mut/mut Male mice were housed in wild female mice for 3 months, and Kif6 was evaluated ^mut/mut Whether the male mice are fertile. The results are shown in FIG. 8, which shows the results with Kif6 ^wt/wt Male mouse and Kif6 ^wt/mut Compared with male mice, kif6 ^mut/mut Male mice were completely sterile.

(2)Kif6 ^mut/mut Male mouse phenotype identification: 3 wild male mice (Kif 6) ^wt/wt ) Heterozygous male mouse (Kif 6) ^wt/mut ) And homozygous mutant male mice (Kif 6) ^mut/mut ) Photographing and weighing, and observing the development condition of the mutant mice; next, kif6wt/mut male mice and Kif6 were taken separately ^mut/mut Shooting and weighing testis and epididymal tissues of male mice, and performing statistical analysis; simultaneously, RNA extraction is carried out on testis tissues, and the testis tissues are used for verifying the expression level of KIF6 by RT-PCR. The results are shown in FIG. 9, kif6 ^mut/mut Failure to detect expression of KIF6 gene in male mice; as shown in FIG. 10, with Kif6 ^wt/wt Male mouse and Kif6 ^wt/mut In comparison to male mice, most mutant mice showed no significant abnormalities in growth development (signs and body weight), and only 20% (2/10) of the mutant mice exhibited a hydrocephalus phenotype. As shown in FIG. 11, kif6 ^mut/mut Male mouse testisAnd epididymal size was not seen as significant abnormalities.

(3) Sperm motility analysis: using CASA (Computer-aided sperm analysis, computer assisted sperm analysis) camera system to obtain 8-10 week old epididymal sperm of mice, comparing Kif6 ^mut/mut Male mouse and Kif6 ^wt/mut Motion ability of epididymal sperm of male mouse, and statistical analysis of Kif6 ^mut/mut Whether the number, the motility and the movement track of the epididymal sperm of the mice are abnormal or not.

The results are shown in FIG. 12, which shows the results with Kif6 ^wt/mut Compared with male mice, kif6 ^mut/mut The number of epididymal sperms of the male mice is obviously reduced (A); and Kif6 ^mut/mut The sperm proportion (B), the curve movement speed (C), the linear movement speed (D), the average movement speed (E), the average swing amplitude (F) and the average linear movement sperm proportion (G) of the epididymis of the male mouse are higher than those of Kif6 ^wt/mut Male mice were significantly reduced, while resting sperm count (H) was lower than Kif6 ^wt/mut The male mice were significantly increased.

The results indicate that KIF6 is involved in the regulation of sperm motility; the KIF6 mutant mice constructed by the application can be used for further exploring the molecular mechanism of the spermatogenesis disorder caused by the KIF6 defect and the treatment strategy of the patient carrying the gene defect.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the application, which are described in detail and are not to be construed as limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Accordingly, the scope of protection of the present application is to be determined by the appended claims.

Claims

1. A method for constructing a male sterile animal model, which is characterized in that the method constructs an animal model simulating human KIF6c.1325_1326del mutation through a CRISPR/Cas9 system.

2. The method for constructing a male sterile animal model according to claim 1, wherein the animal used for preparing the male sterile animal model is a mouse; the construction method constructs the male sterile animal model by knocking out the 13 th exon and the 14 th exon of the mouse KIF6 gene.

3. The method for constructing a male sterile animal model according to claim 2, wherein the method for constructing comprises the steps of:

designing a first sgRNA recognition fragment and a second sgRNA recognition fragment aiming at the upstream of a 13 th exon and the downstream of a 14 th exon of a mouse KIF6 gene respectively;

4. The method for constructing a male sterile animal model according to claim 3, wherein the nucleotide sequence of the first sgRNA recognition fragment is shown in SEQ ID No. 1; the nucleotide sequence of the second sgRNA recognition fragment is shown as SEQ ID NO. 2.

5. The method for constructing a male sterile animal model according to claim 3, further comprising the steps of:

6. The method of constructing a male sterile animal model according to claim 5, wherein the step of synthesizing the first double-stranded DNA and the second double-stranded DNA comprises:

7. The method of constructing a male sterile animal model according to any one of claims 3 to 6, wherein the Cas9mRNA is synthesized by:

providing a linearized Cas9 expression vector as a transcription template;

8. The method for constructing a male sterile animal model according to any one of claims 3 to 6, further comprising the steps of:

9. The method for constructing a male sterile animal model according to any one of claims 3 to 6, further comprising the steps of:

10. Use of a male sterile animal model constructed by the method for constructing a male sterile animal model according to any one of claims 1 to 9 for screening a medicament for treating a male sterility-related disease.