CN114592097A

CN114592097A - Primer and probe for identifying novel coronavirus Omicron strain BA.1 and/or BA.3 sublines and application thereof

Info

Publication number: CN114592097A
Application number: CN202210490200.4A
Authority: CN
Inventors: 杨晓明; 王辉; 赵玉秀; 梁宏阳; 王展慧; 郭彦岑; 何振玉; 贺瑶
Original assignee: National Vaccine & Serum Institute Co ltd
Current assignee: National Vaccine & Serum Institute Co ltd
Priority date: 2022-05-07
Filing date: 2022-05-07
Publication date: 2022-06-07
Anticipated expiration: 2042-05-07
Also published as: CN114592097B

Abstract

The invention provides a primer and a probe for identifying a novel coronavirus Omicron strain BA.1 and/or BA.3 subline and application thereof. The primer of the invention comprises a primer with a sequence shown as SEQ ID NO.1 and a primer with a sequence shown as SEQ ID NO. 2. The probe of the invention comprises a probe with a sequence shown as SEQ ID NO. 5. The probe of the invention further comprises a probe with a sequence shown as SEQ ID NO. 6. By using the primer and the probe, the novel coronavirus Omicron strain BA.1 and/or BA.3 sublines can be distinguished from other strains by a PCR method.

Description

Primer and probe for identifying novel coronavirus Omicron strain BA.1 and/or BA.3 sublines and application thereof

Technical Field

The invention relates to a primer and a probe for identifying a novel coronavirus Omicron strain BA.1 and/or BA.3 subline and application thereof, in particular to a primer, a probe, a kit and a detection method for identifying a novel coronavirus Omicron strain BA.1 and/or BA.3 subline, belonging to the technical field of molecular biology detection.

Background

Infection with the novel coronavirus (SARS-CoV-2) causes respiratory symptoms, fever, cough, shortness of breath, dyspnea, etc., and severe cases may cause the novel coronavirus to pneumonia (COVID-19). With the spread of new coronaviruses in the human population, many mutations occur in the viral genome, wherein the mutations occur at the key amino acid sites of the protective antigen S protein, which may result in the enhancement of the spreading capability and pathogenicity of the virus and the reduction of the protective effect of the existing vaccines. Compared with other new corona strains, the infectivity and the transmission capability of the Omicron variant strain are obviously enhanced. There are three sublines of the Omicron strain, BA.1, BA.2 and BA.3, and the prevalence and pathogenicity of the 3 sublines are different. The rapid and accurate identification of the novel coronavirus Omicron strain BA.1 and/or BA.3 sublines has important significance.

Disclosure of Invention

An object of the present invention is to provide a primer for identifying novel coronavirus Omicron strains BA.1 and/or BA.3 sublines.

Another object of the present invention is to provide a probe for identifying novel coronavirus Omicron strain BA.1 and/or BA.3 sublines.

Another object of the present invention is to provide a kit for identifying novel coronavirus Omicron strains BA.1 and/or BA.3 sublines.

Another object of the present invention is to provide the related use of said primers, probes or kit for identifying novel coronavirus Omicron strains BA.1 and/or BA.3 sublines.

In one aspect, the invention provides primers for identifying novel coronavirus Omicron strain BA.1 and/or BA.3 sublines, wherein the primers comprise a primer with a sequence shown as SEQ ID NO.1 and a primer with a sequence shown as SEQ ID NO. 2:

SEQ ID NO.1：5’-GTCTGTGAATTTCAATTTTGTAATG-3’；

SEQ ID NO.2：5’-CTCTGAACTCACTTTCCATCC-3’。

according to a specific embodiment of the present invention, the primer of the present invention further comprises a primer having a sequence shown in SEQ ID NO.3 and a primer having a sequence shown in SEQ ID NO. 4:

SEQ ID NO.3：5’-TAAAATATATTCTAAGCACACGCC-3’；

SEQ ID NO.4：5’-CTACCAATGGTTCTAAAGCC-3’。

the primer for identifying the novel coronavirus Omicron strain BA.1 and/or BA.3 subline is designed aiming at the novel coronavirus Omicron strain BA.1 and/or BA.3 subline S protein. Compared with the prototype strain, the novel coronavirus Omicron strain BA.1 subline has mutation sites: A67V, Delta 69-70, T95I, Delta 142-144, Y145D, N211-, L212I, G339D, S371L, S373P, S375F, K417N, N440K, G446K, S447K, T478K, E484K, Q493K, G496K, Q498K, N501K, Y505K, T547K, D614K, H655, N679K, P681K, N764K, D796K, N856K, Q954K, N969K, L981K. Wherein the Δ 142-144 and Y145D mutation sites are those possessed by the BA.1 and BA.3 sublines, and the N211-and L212I mutation sites are those possessed by the BA.1 subline. Specifically, the primers for identifying the novel coronavirus Omicron strain BA.1 and/or BA.3 sublines are designed based on the delta 142-144 and Y145D mutation sites and the N211-and L212I mutation sites.

In another aspect, the present invention also provides a probe for identifying a novel coronavirus omitron strain ba.1 and/or ba.3 subline, the probe comprising:

a probe having a sequence shown in SEQ ID NO. 5:

SEQ ID NO.5：5’-CCATTTTTGGACCACAAAAAC-3’。

according to a specific embodiment of the present invention, the probe of the present invention may further comprise:

a probe having a sequence shown in SEQ ID NO. 6:

SEQ ID NO.6：5’-GCGTGAGCCAGAAGATCTCC-3’。

according to a specific embodiment of the present invention, the probe of the present invention may further comprise a probe with a sequence shown as SEQ ID No.7 and/or a probe with a sequence shown as SEQ ID No. 8:

SEQ ID NO.7：5’-CATTTTTGGGTGTTTATTACCACAAAAAC-3’。

SEQ ID NO.8：5’-GTGCGTGATCTCCCTCAG-3’。

the probe with the sequence shown in SEQ ID NO.5 is a novel coronavirus Omicron strain BA.1 and BA.3 sublines common probe designed based on the mutation sites of the novel coronavirus Omicron strain BA.1 and BA.3 sublines S genes delta 142-144 and Y145D. The probe having the sequence shown in SEQ ID NO.6 is a probe designed based on the N211-and L212I mutation sites of the S gene of the BA.1 subline of the novel coronavirus strain. The probe having the sequence shown in SEQ ID NO.7 was designed for a novel coronavirus other than the Omicron strains BA.1 and BA.3 sublines. The probe having the sequence shown in SEQ ID NO.8 was designed for a novel coronavirus other than the Omicron strain BA.1 subline.

According to a particular embodiment of the invention, the probe may be modified with a fluorophore, the modification comprising:

the base at the 5 'end of the probe sequence is modified by a fluorescent reporter group, and the base at the 3' end of the probe sequence is modified by a fluorescent quenching group.

According to a particular embodiment of the invention, the fluorescent reporter group of the probe of the sequence shown in SEQ ID NO.7 is different from the fluorescent reporter group of the probe of the sequence shown in SEQ ID NO. 5. The fluorescent reporter group of the probe with the sequence shown in SEQ ID NO.8 is different from the fluorescent reporter group of the probe with the sequence shown in SEQ ID NO. 6.

According to a specific embodiment of the invention, the 5 'end base of the sequence of the novel common probe (the probe with the sequence shown in SEQ ID NO. 5) of the coronavirus Omicron strains BA.1 and BA.3 sublines is modified by a fluorescent reporter group CY5, and the 3' end base of the sequence of the probe is modified by a fluorescent quenching group. Except for Omicron strain BA.1 and BA.3 sublines, the 5 'end base of the sequence of other novel coronavirus probes (the probe with the sequence shown in SEQ ID NO. 7) is modified by a fluorescence reporter group VIC, and the 3' end base of the probe sequence is modified by a fluorescence quenching group.

According to a specific embodiment of the invention, the 5 'end base of the sequence of the novel coronavirus Omicron strain BA.1 subline probe (the probe with the sequence shown as SEQ ID NO. 6) is modified by a fluorescent reporter group CY5, and the 3' end base of the probe sequence is modified by a fluorescent quenching group. Except for the BA.1 subline, the 5 'end base of the sequence of other novel coronavirus probes (the probe with the sequence shown as SEQ ID NO. 8) is modified by a fluorescence reporter group FAM, and the 3' end base of the probe sequence is modified by a fluorescence quenching group.

In another aspect, the present invention also provides a kit for identifying novel coronavirus Omicron strains ba.1 and/or ba.3 sublines, comprising: the primer of the invention and/or the probe of the invention.

According to a specific embodiment of the present invention, the kit of the present invention may further comprise PCR reaction reagents and/or reaction buffers.

According to a specific embodiment of the present invention, the kit further comprises a positive quality control material and a negative quality control material. Preferably, the positive quality control substance comprises a common template of novel coronavirus Omicron strain BA.1 and BA.3 subline S gene standard plasmids, and the negative quality control substance comprises other novel coronavirus S gene standard plasmid templates except BA.1 and BA.3 sublines.

According to a specific embodiment of the present invention, the positive quality control product in the kit of the present invention may further comprise a standard plasmid template for only the S genes of the BA.1 and BA.3 sublines of the novel coronavirus Omicron strain, and the negative quality control product may further comprise a standard plasmid template for the S genes of the novel coronavirus other than the BA.1 and BA.3 sublines.

On the other hand, the invention also provides the application of the primer or the probe or the kit in identifying whether the novel coronavirus Omicron strain BA.1 and/or BA.3 sublines exist in a sample in vitro. Namely, the invention also provides a method for identifying whether the novel coronavirus Omicron strain BA.1 and/or BA.3 sublines exist in a sample in vitro.

According to a specific embodiment of the present invention, in the use of the present invention, the presence or absence of the novel coronavirus Omicron strain BA.1 and/or BA.3 subline in a sample is identified by PCR reaction, the final concentration of the primer in the PCR reaction system is 0.1-10. mu.M, and the final concentration of the probe in the PCR reaction system is 0.1-10. mu.M.

According to a specific embodiment of the present invention, in the application of the present invention, the PCR may be a single PCR, a double PCR, a multiplex PCR, a digital PCR or an RT-PCR.

In some embodiments of the invention, the use of the invention is for identifying the presence of the novel coronavirus omitron strain BA.1 and/or BA.3 sublines in a sample using a primer having a sequence as shown in SEQ ID NO.1 and a primer having a sequence as shown in SEQ ID NO.2, a probe having a sequence as shown in SEQ ID NO.5 and a probe having a sequence as shown in SEQ ID NO. 7. The amplification curve of the probe with the sequence shown in SEQ ID NO.5 is an S-shaped curve, and can be identified as the positive of the novel coronavirus Omicron strain BA.1 and/or BA.3 sublines. Further, the novel coronavirus Omicron strain BA.1 and/or BA.3 subline positive samples can be distinguished from BA.3 subline identification by using a primer having a sequence shown in SEQ ID NO.3 and a primer having a sequence shown in SEQ ID NO.4, a probe having a sequence shown in SEQ ID NO.6 and a probe having a sequence shown in SEQ ID NO. 8. The two PCR reactions are not in sequence.

In some embodiments of the invention, the use of the invention is for identifying the presence of a novel coronavirus, omitron strain ba.1 or ba.3 subline in a sample, said probe comprising a probe having a sequence as shown in SEQ ID No.5 and a probe having a sequence as shown in SEQ ID No. 6;

wherein the amplification curve of the probe with the sequence shown as SEQ ID NO.5 is an S-shaped curve and is identified as the positive of a novel coronavirus Omicron strain BA.1 or BA.3 subline; wherein the amplification curve of the probe with the sequence shown as SEQ ID NO.6 is an S-shaped curve and is identified as the positive of a BA.1 subline of the novel coronavirus Omicron strain; alternatively, the first and second electrodes may be,

wherein the amplification curve of the probe with the sequence shown as SEQ ID NO.5 is an S-shaped curve and is identified as the positive of a novel coronavirus Omicron strain BA.1 or BA.3 subline; wherein the amplification curve of the probe with the sequence shown as SEQ ID NO.6 is an S-shaped curve and is identified as the positive of a BA.1 subline of the novel coronavirus Omicron strain; wherein the amplification curve of the probe with the sequence shown in SEQ ID NO.5 is an S-shaped curve, and the amplification curve of the probe with the sequence shown in SEQ ID NO.6 is a non-S-shaped curve, so that the probe can be identified as the new type coronavirus Omicron strain BA.3 subline positive.

In some embodiments of the invention, the method of authenticating applications of the present invention comprises the steps of:

s1: extracting RNA of a sample to be detected, and reversely transcribing the RNA into cDNA;

s2: preparing a reaction system: add the upstream primer, downstream primer and probe at any concentration ranging from 0.1-10. mu.M to the system, add the sample cDNA at any concentration ranging from 1pg to 1. mu.g, add commercial qPCR premix enzyme, and finally add ddH₂O adjusting the total volume of the reaction system to any volume within the range of 10-20 mul;

s3: setting reaction conditions: setting reaction conditions according to the used qPCR premixed enzyme;

s4: and (4) analyzing results: the analysis is carried out according to the amplification channels of the Omicron strains BA.1 and BA.3 sublines, the amplification channel of the BA.1 subline, the amplification channels of other novel coronaviruses except the BA.1 and BA.3 sublines and the amplification channels of other novel coronaviruses except the BA.1 subline, and the results are recorded.

The invention designs different probes aiming at the sites of the S proteins delta 142-144 and Y145D of the subfamily BA.1 and BA.3 of the Omicron strain and the corresponding regions of other novel coronaviruses except the subfamily BA.1 and BA.3; and different probes were designed for the N211-and L212I-mutation sites of the S gene of the BA.1 subline and for other novel coronaviruses except for the BA.1 subline of the Omicron strain. And observing the amplification results of the Omicron strain BA.1 and/or BA.3 sublines, or other novel coronaviruses except the BA.1 and BA.3 sublines, or the BA.1 subline, or other novel coronaviruses except the BA.1 subline through different fluorescence channels. The amplification curve in the amplification result is a typical S-shaped curve, and the amplification result is a positive result; the amplification curve in the amplification result is not a typical "S-shaped" curve, and is a negative result.

In some embodiments of the invention, the sample tested is a BA.3 subline when the amplification curves of the Omicron strains BA.1 and BA.3 subline amplification channels of the sample tested are typical "sigmoid" curves, and at the same time the amplification curve of the BA.1 subline channel is not a typical "sigmoid" curve.

In some specific embodiments of the invention, the invention selects a gene sequence synthetic plasmid in the BA.1 and BA.3 sublines or other novel coronavirus S proteins except the BA.1 and BA.3 sublines as a standard substance respectively, and verifies the linearity, detection limit and specificity (specificity) of the dual probe qPCR method. As can be seen from the specificity verification experiment of the qPCR method, the identification method provided by the invention has better linearity, the detection limit is 0.03 pg/mu l, and the identification method can effectively identify the Omicron strain BA.1 and/or BA.3 sublines and other novel coronaviruses except the BA.1 and BA.3 sublines.

The technical scheme of the invention has the following beneficial effects:

the invention has the advantages of low cost, simple operation, low requirement on instruments and equipment, short detection period and accurate and reliable result. The identification applications described herein may be for non-diagnostic purposes, or for diagnostic purposes. Applications for non-diagnostic purposes may include, for example, the rapid identification of virus species in the production of novel inactivated coronavirus vaccines, as well as the identification of inactivated novel coronavirus stocks. In addition, the invention can be applied to the identification of the Omicron strain BA.1 and/or BA.3 sublines and other novel coronavirus strains in the novel coronavirus nucleic acid screening process, and the sample to be identified can be an isolated sample from human or animals or an environmental sample from non-hosts. The invention can rapidly and accurately distinguish the novel coronavirus Omicron strain BA.1 and/or BA.3 sublines from other novel coronavirus identification. The popularization and the application of the invention can save a great deal of time and cost for detection personnel, scientific research workers and medical workers in the vaccine production process.

Drawings

FIG. 1 is a schematic diagram of the experimental design scheme of the primers and probes of the present invention for identifying the strains BA.1 and/or BA.3 sublines of Omicron.

FIG. 2 is a standard curve of amplification channel common to the Omicron strain BA.1 and BA.3 sublines for PCR reactions using primers and probes for identifying the invention of the Omicron strain BA.1 and/or BA.3 sublines.

FIG. 3 is a standard curve of the amplification pathway of novel coronavirus other than the BA.1 and BA.3 sublines for PCR reaction using primers and probes of the invention which identify the BA.1 and/or BA.3 sublines of the Omicron strain.

FIG. 4 shows the results of a specificity (specificity) verification experiment of the dual probe qPCR method using primers and probes of the invention identifying the Omicron strain BA.1 and/or BA.3 sublines.

FIG. 5 shows the detection of inactivated Omicron strain BA.1 subline virus stock by dual probe qPCR using primers and probes of the invention for identifying Omicron strain BA.1 and/or BA.3 sublines.

FIG. 6 shows a schematic diagram of the experimental design scheme for identifying the primers and probes of the invention of the Omicron strain BA.1 subline.

FIG. 7 is a standard curve of amplification channel of the Omicron strain BA.1 subline by PCR reaction using primers and probes for identifying the invention of the Omicron strain BA.1 subline.

FIG. 8 is a standard curve of amplification pathways of other novel coronaviruses than the BA.1 subline in which PCR reaction is carried out using primers and probes for identifying the BA.1 subline of the Omicron strain.

FIG. 9 shows the results of specificity verification experiments for the dual probe qPCR method using primers and probes of the invention identifying the BA.1 subline of the Omicron strain.

FIG. 10 shows the detection of inactivated Omicron strain BA.1 subline virus stock by dual probe qPCR using primers and probes identifying the invention of Omicron strain BA.1 subline.

Detailed Description

The technical solutions of the present invention will be described in detail below in order to clearly understand the technical features, objects, and advantages of the present invention, but the present invention should not be construed as limiting the implementable scope of the present invention. The present invention has been described generally and/or specifically with respect to materials used in the experiments and the methods of testing. The method operations, not specified in detail, are carried out according to the conventional operations of the prior art in the field or as suggested by the manufacturer's specifications.

Example 1

This example provides a method for identifying novel coronaviruses other than SARS-CoV-2 and Omicron strain BA.1 and/or BA.3 sublines. The design scheme of the primer, the probe and the fluorescent label is shown in figure 1.

Experimental samples: the cDNA of the sample to be tested, the common template (SEQ ID NO. 9) of the Omicron strain BA.1 and BA.3 subline S gene standard plasmids and the standard plasmid templates (SEQ ID NO. 10) of other novel coronavirus S genes except the BA.1 and BA.3 sublines.

Obtaining the cDNA of a sample to be tested: respectively taking 200 mul of cell culture of a novel coronavirus prototype strain, an Omicron BA.1 subline strain, a Delta strain and a Beta strain, extracting RNA by using a commercial RNA kit, reversely transcribing the RNA into cDNA by using the commercial reverse transcription kit, storing the extracted RNA and cDNA in a refrigerator at 60 ℃ below zero, and avoiding repeated freeze thawing before use.

Acquisition of standard plasmids: the common template (SEQ ID NO. 9) of Omicron strain BA.1 and BA.3 subline S gene standard plasmids and the standard plasmid templates (SEQ ID NO. 10) of other novel coronavirus S genes except the BA.1 and BA.3 sublines are directly biosynthesized by the engine family. The sequences of the standard plasmids are as follows:

SEQ ID NO.9：

ttaccctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttcttttccaatgttacttggttccatgttatctctgggaccaatggtactaagaggtttgataaccctgtcctaccatttaatgatggtgtttattttgcttccattgagaagtctaacataataagaggctggatttttggtactactttagattcgaagacccagtccctacttattgttaataacgctactaatgttgttattaaagtctgtgaatttcaattttgtaatgatccatttttggaccacaaaaacaacaaaagttggatggaaagtgagttcagagtttattctagtgcgaataattgcacttttgaatatgtctctcagccttttcttatggaccttgaaggaaaacagggtaatttcaaaaatcttagggaatttgtgtttaagaatattgatggttattttaaaatatattctaagcacacgcctattatagtgcgtgagccagaagatctccctcagggtttttcggctttagaaccattggtagatttgccaataggtattaacatcactaggtttcaaactttacttgctttacatagaagttatttgactcctggtgattcttcttcaggttggacagctggtgctgcagcttattatgtgggttatcttcaacctaggacttttctattaaaatataatgaaaatggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttgaaatccttcactgtagaaaaaggaatctatcaaacttctaactttagagtccaaccaacagaatctattgttagatttcctaatattacaaacttgtgcccttttgatgaagtttttaacgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatataatctcgcaccatttttcacttttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatcgctccagggcaaactggaaatattgctgattataattataaattaccagatgattttacaggctgcgttatagcttggaattctaacaagcttgattctaaggttagtggtaattataattacctgtatagattgtttaggaagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtaacaaaccttgtaatggtgttgcaggttttaattgttactttcctttacgatcatatagtttccgacccacttatggtgttggtcaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaaaaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtgatccacagacacttgagattcttgacattacaccatgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttctttatcagggtgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttggcgtgtttattctacaggttctaatgtttttcaaacacgtgcaggctgtttaataggggctgaatatgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagactcagactaagtctcatcggcgggcacgtagtgtagctagtcaatccatcattgcctacactatgtcacttggtgcagaaaattcagttgctt；

SEQ ID NO.10：

TTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATT。

qPCR amplification: the reaction system and reaction conditions are shown in Table 1, wherein the amount of the forward primer, the reverse primer and the probe added to the reaction system may be any one of concentrations in the range of 0.1 to 10. mu.M, the total reaction system may be any one of volumes in the range of 10 to 20. mu.l, and the amount of the sample cDNA added may be any one of concentrations in the range of 1pg to 1. mu.g. The qPCR premixed enzyme used this time was Perfect Start II Probe qPCR SuperMix (Cat No.: AQ 711) from all-gold Bio Inc., wherein the annealing temperature was selected from any one of the temperatures in the range of 52-60 ℃.

The sequence of the upstream primer (142/145-F) is shown as SEQ ID NO. 1; the sequence of the downstream primer (142/145-R) is shown as SEQ ID NO. 2; the sequences of the probes of the Omicron strain BA.1 and/or BA.3 subline (142/145-P-Omicron strain BA.1 and/or BA.3 subline) are shown in SEQ ID NO. 5; the sequences of novel coronavirus probes (142/145-P-other novel coronaviruses) other than the BA.1 and BA.3 sublines are shown in SEQ ID NO. 7.

SEQ ID NO.1（142/145-F）：GTCTGTGAATTTCAATTTTGTAATG；

SEQ ID NO.2（142/145-R）：CTCTGAACTCACTTTCCATCC；

SEQ ID NO.5 (142/145-P-Omicron strains BA.1 and BA.3 sublines): CCATTTTTGGACCACAAAAAC, respectively;

SEQ ID NO.7 (142/145-P-other novel coronaviruses): CATTTTTGGGTGTTTATTACCACAAAAAC are provided.

TABLE 1 reaction System and reaction conditions

And (4) analyzing results: taking the Roche480 instrument as an example, the sample type (unknown sample, standard, negative control or positive control) of each detection hole is set after the experiment is finished, wherein the concentration of the standard needs to be set. Opening an analysis interface, selecting a fluorescence channel used by the probe, and adjusting a Noise band value according to an amplification image to ensure the amplification efficiency and R of the generated standard curve²Both the value and the slope are within acceptable ranges. The invention relates to a dual probe qPCR method, which analyzes and records the results of amplification channels of an Omicron strain BA.1 and/or BA.3 sublines and other novel coronavirus amplification channels except the BA.1 and BA.3 sublines in one reaction.

And (4) judging a result: the amplification curve in the amplification result is a typical S-shaped curve, and the amplification result is a positive result; the amplification curve in the amplification result is not a typical "S-shaped" curve, and is a negative result. The specific result interpretation method is shown in Table 2.

TABLE 2 determination of results

Adding a sample to be detected into a reaction system for computer detection, and if positive amplification occurs in a CY5 channel and positive amplification does not occur in a VIC channel in a detection result, displaying that the sample is an Omicron strain BA.1 and/or BA.3 subline but not other novel coronaviruses; if positive amplification occurs in the VIC channel and positive amplification does not occur in the CY5 channel, the sample is shown to be not an Omicron strain BA.1 and/or BA.3 subline. The method can quickly and accurately identify the Omicron strain BA.1 and/or BA.3 sublines.

This example demonstrates the method of the dual probe qPCR of the present invention. The results are shown in FIGS. 2 to 4. FIG. 2 is a standard curve of amplification channel of Omicron strain BA.1 and/or BA.3 sublines, R²0.99, amplification efficiency of 0.92, and slope of-3.531. FIG. 3 is a standard curve of the amplification pathway of other novel coronaviruses, R²The amplification efficiency was 0.955 with a slope of-3.436 at 1. From FIGS. 2 and 3, it can be seen that the detection limit of the present invention is 0.03pg/μ l and has good linearity. FIG. 4 is specificity (specificity) verification of the dual probe qPCR method, and the result shows that the Omicron strain BA.1 subline sample has positive amplification in Omicron strain BA.1 and/or BA.3 subline amplification channels, and has negative amplification in other novel coronavirus strain amplification channels; the prototype strain sample, the Delta strain sample and the Beta strain sample have negative amplification in an amplification channel of an Omicron strain BA.1 and/or BA.3 subline, and have positive amplification in an amplification channel of other novel coronavirus strains, which shows that the invention has good specificity and can accurately identify the BA.1 and/or BA.3 sublines of the Omicron strain. The primers and the probes are used for detecting the inactivated Omicron strain BA.1 subline virus stock solution by a dual probe qPCR method, the detection result is shown in figure 5, and the method is suitable for identifying the inactivated Omicron strain BA.1 subline vaccine stock solution.

And further identifying whether the novel coronavirus Omicron strain BA.1 subline or BA.3 subline exists in the positive sample of the novel coronavirus Omicron strain BA.1 and/or BA.3 subline by adopting a primer with a sequence shown as SEQ ID NO.3, a primer with a sequence shown as SEQ ID NO.4, a probe with a sequence shown as SEQ ID NO.6 and a probe with a sequence shown as SEQ ID NO. 8. The design scheme of the primer, the probe and the fluorescent label is shown in figure 6. The specific operation comprises the following steps:

experimental samples: and (3) obtaining a positive sample of the novel coronavirus Omicron strain BA.1 and/or BA.3 sublines to be detected.

Acquisition of standard plasmids: omicron strain BA.1 subline S gene standard plasmid (SEQ ID NO. 9) and other novel coronavirus S gene standard plasmids (SEQ ID NO. 10) except BA.1 subline are directly biosynthesized by Oncology.

qPCR amplification: the reaction system and reaction conditions are shown in Table 3, wherein the amount of the forward primer, the reverse primer and the probe added to the reaction system may be any one of concentrations in the range of 0.1 to 10. mu.M, the total reaction system may be any one of volumes in the range of 10 to 20. mu.l, and the amount of the sample cDNA added may be any one of concentrations in the range of 1pg to 1. mu.g. The qPCR premixed enzyme used this time was Perfect Start II Probe qPCR SuperMix (Cat No.: AQ 711) from all-gold Bio Inc., wherein the annealing temperature was selected from any one of the temperatures in the range of 52-60 ℃.

The sequence of the upstream primer (211/212-F) is shown as SEQ ID NO. 3; the sequence of the downstream primer (211/212-R) is shown as SEQ ID NO. 4; the sequence of the Omicron strain BA.1 subline probe (211/212-P-Omicron strain BA.1 subline) is shown as SEQ ID NO. 6; the sequences of other novel coronavirus probes (211/212-P-other novel coronaviruses) except the BA.1 subline are shown in SEQ ID NO. 8.

SEQ ID NO.3（211/212-F）：TAAAATATATTCTAAGCACACGCC；

SEQ ID NO.4（211/212-R）：CTACCAATGGTTCTAAAGCC；

SEQ ID NO.6 (211/212-P-Omicron strain BA.1 subline): GCGTGAGCCAGAAGATCTCC, respectively;

SEQ ID NO.8 (211/212-P-other novel coronaviruses): GTGCGTGATCTCCCTCAG are provided.

TABLE 3 reaction System and reaction conditions

And (4) analyzing results: taking the Roche480 instrument as an example,and (3) setting the sample type (to-be-detected sample, standard substance, negative control or positive control) of each detection hole after the experiment is finished, wherein the concentration of the standard substance needs to be set. Opening an analysis interface, selecting a fluorescence channel used by the probe, and adjusting a Noise band value according to an amplification image to ensure the amplification efficiency and R of the generated standard curve²Both the value and the slope are within acceptable ranges. The invention relates to a dual probe qPCR method, which analyzes and records the results of an Omicron strain BA.1 subline amplification channel and other novel coronavirus amplification channels except the BA.1 subline in one reaction.

And (4) judging a result: the amplification curve in the amplification result is a typical S-shaped curve, and the amplification result is a positive result; the amplification curve in the amplification result is not a typical "S-shaped" curve, and is a negative result. The specific result interpretation method is shown in Table 4.

TABLE 4 determination of results

Adding a sample to be detected into a reaction system for computer detection, and if positive amplification occurs in a CY5 channel and positive amplification does not occur in an FAM channel in a detection result, displaying that the sample is an Omicron strain BA.1 subline but not other novel coronaviruses; if the FAM channel is positively amplified but the CY5 channel is not positively amplified, the sample is not an Omicron strain BA.1 subline. The method can quickly and accurately identify the Omicron strain BA.1 subline in one reaction.

This example demonstrates the method of the dual probe qPCR of the present invention. The results are shown in FIGS. 7-9. FIG. 7 is a standard curve of amplification channel of the Omicron strain BA.1 subline, R²At 0.98, the amplification efficiency was 0.918, and the slope was-3.535. FIG. 8 is a standard curve of the amplification pathway of other novel coronaviruses, R²It was 0.98, the amplification efficiency was 0.967, and the slope was-3.404. From FIGS. 7 and 8, it can be seen that the detection limit of the present invention is 0.03pg/μ l and has good linearity. FIG. 9 shows specificity (specificity) verification of the dual probe qPCR method, and results show that the amplification of the Omicron strain BA.1 subline sample in the Omicron strain BA.1 sublinePositive amplification appears in the channel, and negative amplification appears in other novel coronavirus amplification channels; the prototype strain, the Beta strain and the Delta strain samples are subjected to negative amplification in an Omicron strain BA.1 subline amplification channel and are subjected to positive amplification in other novel coronavirus amplification channels, which shows that the method has good specificity and can accurately identify the Omicron strain BA.1 subline. The primer and the probe are used for detecting the inactivated Omicron strain BA.1 subline virus stock solution by a dual probe qPCR method, and the result is shown in figure 10, so that the method is suitable for identifying the inactivated Omicron strain BA.1 subline vaccine stock solution.

Sequence listing

<110> limited liability company of Beijing institute of biological products

<120> primers and probes for identifying novel coronavirus Omicron strain BA.1 and/or BA.3 sublines, and applications thereof

<130> GAI22CN0634

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 1

gtctgtgaat ttcaattttg taatg 25

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 2

ctctgaactc actttccatc c 21

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 3

taaaatatat tctaagcaca cgcc 24

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 4

ctaccaatgg ttctaaagcc 20

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 5

ccatttttgg accacaaaaa c 21

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 6

gcgtgagcca gaagatctcc 20

<210> 7

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 7

catttttggg tgtttattac cacaaaaac 29

<210> 8

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Probe

<400> 8

gtgcgtgatc tccctcag 18

<210> 9

<211> 2000

<212> DNA

<213> Artificial sequence

<220>

<223> Omicron strain BA.1 and BA.3 subline S gene standard plasmid

<400> 9

ttaccctgac aaagttttca gatcctcagt tttacattca actcaggact tgttcttacc 60

tttcttttcc aatgttactt ggttccatgt tatctctggg accaatggta ctaagaggtt 120

tgataaccct gtcctaccat ttaatgatgg tgtttatttt gcttccattg agaagtctaa 180

cataataaga ggctggattt ttggtactac tttagattcg aagacccagt ccctacttat 240

tgttaataac gctactaatg ttgttattaa agtctgtgaa tttcaatttt gtaatgatcc 300

atttttggac cacaaaaaca acaaaagttg gatggaaagt gagttcagag tttattctag 360

tgcgaataat tgcacttttg aatatgtctc tcagcctttt cttatggacc ttgaaggaaa 420

acagggtaat ttcaaaaatc ttagggaatt tgtgtttaag aatattgatg gttattttaa 480

aatatattct aagcacacgc ctattatagt gcgtgagcca gaagatctcc ctcagggttt 540

ttcggcttta gaaccattgg tagatttgcc aataggtatt aacatcacta ggtttcaaac 600

tttacttgct ttacatagaa gttatttgac tcctggtgat tcttcttcag gttggacagc 660

tggtgctgca gcttattatg tgggttatct tcaacctagg acttttctat taaaatataa 720

tgaaaatgga accattacag atgctgtaga ctgtgcactt gaccctctct cagaaacaaa 780

gtgtacgttg aaatccttca ctgtagaaaa aggaatctat caaacttcta actttagagt 840

ccaaccaaca gaatctattg ttagatttcc taatattaca aacttgtgcc cttttgatga 900

agtttttaac gccaccagat ttgcatctgt ttatgcttgg aacaggaaga gaatcagcaa 960

ctgtgttgct gattattctg tcctatataa tctcgcacca tttttcactt ttaagtgtta 1020

tggagtgtct cctactaaat taaatgatct ctgctttact aatgtctatg cagattcatt 1080

tgtaattaga ggtgatgaag tcagacaaat cgctccaggg caaactggaa atattgctga 1140

ttataattat aaattaccag atgattttac aggctgcgtt atagcttgga attctaacaa 1200

gcttgattct aaggttagtg gtaattataa ttacctgtat agattgttta ggaagtctaa 1260

tctcaaacct tttgagagag atatttcaac tgaaatctat caggccggta acaaaccttg 1320

taatggtgtt gcaggtttta attgttactt tcctttacga tcatatagtt tccgacccac 1380

ttatggtgtt ggtcaccaac catacagagt agtagtactt tcttttgaac ttctacatgc 1440

accagcaact gtttgtggac ctaaaaagtc tactaatttg gttaaaaaca aatgtgtcaa 1500

tttcaacttc aatggtttaa aaggcacagg tgttcttact gagtctaaca aaaagtttct 1560

gcctttccaa caatttggca gagacattgc tgacactact gatgctgtcc gtgatccaca 1620

gacacttgag attcttgaca ttacaccatg ttcttttggt ggtgtcagtg ttataacacc 1680

aggaacaaat acttctaacc aggttgctgt tctttatcag ggtgttaact gcacagaagt 1740

ccctgttgct attcatgcag atcaacttac tcctacttgg cgtgtttatt ctacaggttc 1800

taatgttttt caaacacgtg caggctgttt aataggggct gaatatgtca acaactcata 1860

tgagtgtgac atacccattg gtgcaggtat atgcgctagt tatcagactc agactaagtc 1920

tcatcggcgg gcacgtagtg tagctagtca atccatcatt gcctacacta tgtcacttgg 1980

tgcagaaaat tcagttgctt 2000

<210> 10

<211> 2000

<212> DNA

<213> Artificial sequence

<220>

<223> novel coronavirus S gene standard plasmid other than Omicron strain BA.1 and BA.3 sublines

<400> 10

ttaccctgac aaagttttca gatcctcagt tttacattca actcaggact tgttcttacc 60

tttcttttcc aatgttactt ggttccatgc tatacatgtc tctgggacca atggtactaa 120

gaggtttgat aaccctgtcc taccatttaa tgatggtgtt tattttgctt ccactgagaa 180

gtctaacata ataagaggct ggatttttgg tactacttta gattcgaaga cccagtccct 240

acttattgtt aataacgcta ctaatgttgt tattaaagtc tgtgaatttc aattttgtaa 300

tgatccattt ttgggtgttt attaccacaa aaacaacaaa agttggatgg aaagtgagtt 360

cagagtttat tctagtgcga ataattgcac ttttgaatat gtctctcagc cttttcttat 420

ggaccttgaa ggaaaacagg gtaatttcaa aaatcttagg gaatttgtgt ttaagaatat 480

tgatggttat tttaaaatat attctaagca cacgcctatt aatttagtgc gtgatctccc 540

tcagggtttt tcggctttag aaccattggt agatttgcca ataggtatta acatcactag 600

gtttcaaact ttacttgctt tacatagaag ttatttgact cctggtgatt cttcttcagg 660

ttggacagct ggtgctgcag cttattatgt gggttatctt caacctagga cttttctatt 720

aaaatataat gaaaatggaa ccattacaga tgctgtagac tgtgcacttg accctctctc 780

agaaacaaag tgtacgttga aatccttcac tgtagaaaaa ggaatctatc aaacttctaa 840

ctttagagtc caaccaacag aatctattgt tagatttcct aatattacaa acttgtgccc 900

ttttggtgaa gtttttaacg ccaccagatt tgcatctgtt tatgcttgga acaggaagag 960

aatcagcaac tgtgttgctg attattctgt cctatataat tccgcatcat tttccacttt 1020

taagtgttat ggagtgtctc ctactaaatt aaatgatctc tgctttacta atgtctatgc 1080

agattcattt gtaattagag gtgatgaagt cagacaaatc gctccagggc aaactggaaa 1140

gattgctgat tataattata aattaccaga tgattttaca ggctgcgtta tagcttggaa 1200

ttctaacaat cttgattcta aggttggtgg taattataat tacctgtata gattgtttag 1260

gaagtctaat ctcaaacctt ttgagagaga tatttcaact gaaatctatc aggccggtag 1320

cacaccttgt aatggtgttg aaggttttaa ttgttacttt cctttacaat catatggttt 1380

ccaacccact aatggtgttg gttaccaacc atacagagta gtagtacttt cttttgaact 1440

tctacatgca ccagcaactg tttgtggacc taaaaagtct actaatttgg ttaaaaacaa 1500

atgtgtcaat ttcaacttca atggtttaac aggcacaggt gttcttactg agtctaacaa 1560

aaagtttctg cctttccaac aatttggcag agacattgct gacactactg atgctgtccg 1620

tgatccacag acacttgaga ttcttgacat tacaccatgt tcttttggtg gtgtcagtgt 1680

tataacacca ggaacaaata cttctaacca ggttgctgtt ctttatcagg atgttaactg 1740

cacagaagtc cctgttgcta ttcatgcaga tcaacttact cctacttggc gtgtttattc 1800

tacaggttct aatgtttttc aaacacgtgc aggctgttta ataggggctg aacatgtcaa 1860

caactcatat gagtgtgaca tacccattgg tgcaggtata tgcgctagtt atcagactca 1920

gactaattct cctcggcggg cacgtagtgt agctagtcaa tccatcattg cctacactat 1980

gtcacttggt gcagaaaatt 2000

Claims

1. A primer for identifying a novel coronavirus Omicron strain BA.1 and/or BA.3 subline is characterized by comprising a primer with a sequence shown as SEQ ID NO.1 and a primer with a sequence shown as SEQ ID NO. 2:

SEQ ID NO.1：5’-GTCTGTGAATTTCAATTTTGTAATG-3’；

SEQ ID NO.2：5’-CTCTGAACTCACTTTCCATCC-3’。

2. the primer according to claim 1, wherein the primer further comprises a primer having a sequence shown as SEQ ID No.3 and a primer having a sequence shown as SEQ ID No. 4:

SEQ ID NO.3：5’-TAAAATATATTCTAAGCACACGCC-3’；

SEQ ID NO.4：5’-CTACCAATGGTTCTAAAGCC-3’。

3. a probe for identifying a novel coronavirus Omicron strain ba.1 and/or ba.3 subline, comprising:

a probe having a sequence shown in SEQ ID NO. 5:

SEQ ID NO.5：5’-CCATTTTTGGACCACAAAAAC-3’。

4. the probe of claim 3, further comprising:

a probe having a sequence shown in SEQ ID NO. 6:

SEQ ID NO.6：5’-GCGTGAGCCAGAAGATCTCC-3’。

5. the probe according to claim 3 or 4, wherein the probe further comprises a probe of the sequence shown in SEQ ID No.7 and/or a probe of the sequence shown in SEQ ID No. 8:

SEQ ID NO.7：5’-CATTTTTGGGTGTTTATTACCACAAAAAC-3’；

SEQ ID NO.8：5’-GTGCGTGATCTCCCTCAG-3’。

6. the probe of claim 3 or 4, wherein the probe is modified with a fluorophore, the modification comprising:

7. A kit for identifying a novel coronavirus Omicron strain ba.1 and/or ba.3 sublines, said kit comprising: the primer of claim 1 or 2, and/or the probe of any one of claims 3-6;

the kit also comprises a positive quality control product and a negative quality control product.

8. Use of the primers of claim 1 or 2 or the probes of any of claims 3 to 6 or the kit of claim 7 for non-diagnostic purposes for the in vitro identification of the presence of the novel coronavirus Omicron strain ba.1 and/or ba.3 sublines in a sample.

9. The use according to claim 8, wherein the presence or absence of the novel coronavirus Omicron strain BA.1 and/or BA.3 subline in the sample is identified by PCR reaction, the final concentration of the primer in the PCR reaction system is 0.1-10 μ M, and the final concentration of the probe in the PCR reaction system is 0.1-10 μ M;

the PCR is a single PCR, a multiple PCR, a digital PCR or an RT-PCR.

10. Use according to claim 9, for identifying the presence in a sample of a novel coronavirus, strain ba.1 and/or ba.3 subline, said probes comprising a probe having the sequence shown in SEQ ID No.5 and a probe having the sequence shown in SEQ ID No. 6;

wherein the amplification curve of the probe with the sequence shown as SEQ ID NO.5 is an S-shaped curve and is identified as the positive of a novel coronavirus Omicron strain BA.1 or BA.3 subline; wherein the amplification curve of the probe with the sequence shown as SEQ ID NO.6 is an S-shaped curve and is identified as positive in a BA.1 subline of the novel coronavirus Omicron strain; alternatively, the first and second electrodes may be,

wherein the amplification curve of the probe with the sequence shown as SEQ ID NO.5 is an S-type curve, and the amplification curve of the probe with the sequence shown as SEQ ID NO.6 is a non-S-type curve, so that the novel coronavirus Omicron strain BA.3 subline is identified as positive.