CN113943838A

CN113943838A - New coronavirus Ormckh mutation sequence detection technology based on multiple fluorescence quantitative ARMS-PCR technology and application thereof

Info

Publication number: CN113943838A
Application number: CN202111497771.2A
Authority: CN
Inventors: 孔祥宾; 李万帅; 汤丽丽
Original assignee: Changzhou Guoyao Medical Laboratory Co ltd
Current assignee: Changzhou Guoyao Medical Laboratory Co ltd
Priority date: 2021-12-09
Filing date: 2021-12-09
Publication date: 2022-01-18

Abstract

The invention provides a new coronavirus Ormckronk (Omicron) mutation sequence detection technology based on a multiple fluorescence quantitative ARMS-PCR technology and application thereof. The invention mainly aims at the specific mutation types of the S gene of the existing Ormcron (Omicron) variant strain, such as sequence position 23599, sequence change T > G, sequence position 23048, sequence change G > A, sequence position 23202, sequence change C > A, sequence position 22898 and sequence change G > A, and carries out single-tube or multi-tube multiplex detection on the basis of the fluorescence quantitative ARMS-PCR technology. The kit can well identify new key mutation of the current epidemic new coronavirus Ormckh strain, has good specificity and has positive significance for mutation monitoring of the new coronavirus (Ormckh).

Description

New coronavirus Ormckh mutation sequence detection technology based on multiple fluorescence quantitative ARMS-PCR technology and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to a new coronavirus Ormcken nucleic acid mutation type detection technology based on a multiple fluorescence quantitative ARMS-PCR technology and application thereof.

Background

The outbreak of new respiratory diseases from 12 months in 2019 has been diagnosed globally for over nine million cases in 1 and middle months in 2021, and the main clinical symptoms are fever, hypodynamia and dry cough. The etiology of the coronavirus is confirmed to be a novel coronavirus through separation and identification, and the international committee on virus taxonomy designates the coronavirus as SARS-CoV-2. This is the seventh coronavirus currently found in humans, of which there are mainly 6, of which 229E, OC43, NL63, HKU1 are four of the less pathogenic, which cause mild respiratory disease, and the two remaining SARS and MERS coronaviruses, which cause severe respiratory disease.

Because the new crown pneumonia epidemic situation continuously explodes in the world and RNA virus is easier to mutate in the replication process, the mutation sites of the new crown virus continuously appear, and the concerned variant strains of the world health organizations such as Alpha, Beta, Gamma, Delta and the like appear in succession. This poses certain risks for both vaccine preventive efficacy and virus monitoring. A new variant of SARS-CoV-2 coronavirus was recently discovered in south Africa and spread rapidly. A number of key mutations were found in this variant, beyond those contained in all previous variant strains. With widespread global attention, the world health organization named this variety Omicron. The mutation of spike protein, a key protein of this variant directly involved in infecting human cells, had 32 mutations, whereas only 15 mutations were reported in the last 10 months for delta variants. 32 of the spike protein mutations are multiply coincident with the Delta and Alpha variant strains, and therefore, the mutant may be characterized by enhanced replication capacity. The RBD has mutations of K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K and the like, is a mutant strain with the most RBD mutations and can influence antibody recognition and vaccination. The mutations of H655Y, N679K and P681H near the Furin cleavage site may enhance the replication ability and infectivity of the virus. Among them, 446G > S, 547T > K, 496G > S, 679N > K key new mutations involved in the function of S protein are especially important. Aiming at the case that the new coronavirus is detected to be positive, whether the new coronavirus belongs to the Ormckh mutant strain and whether the new coronavirus belongs to the four key mutation types are determined, and the method has important significance for virus monitoring.

The multiple fluorescence quantitative ARMS-PCR detection technologies combine the advantages of ARMS-PCR sensitivity, DNA hybridization specificity and single-tube multiple or multi-tube rapid detection, are detection technologies with high acceptance degree in current clinical examination, and are widely applied to scientific research and clinical detection. However, most of the products on the market at present are common new coronavirus detection products, and no new coronavirus Ormcken virus and new mutation type technical products are involved.

Disclosure of Invention

In view of the above-mentioned disadvantages of the prior art, the present invention aims to provide a novel coronavirus (Ormcken) nucleic acid mutation gene type detection technique based on fluorescence quantitative ARMS-PCR technology and its application.

The invention provides a kit for detecting S gene mutation types of nucleic acids of Ormckh virus strain of new coronavirus, wherein the kit comprises any one or more of the following primers and probe sets, wherein the primers in each set comprise a forward primer and a reverse primer, and two ends of each probe are respectively marked with a fluorescence reporter group/fluorescence quencher group:

a. for detecting S gene mutation types: primers and probes of sequence position 23599, sequence variation T > G; wherein the nucleotide sequence of the forward primer is as follows: the nucleotide sequence of the reverse primer is shown as SEQ ID No.2, and the nucleotide sequence of the probe is shown as SEQ ID No. 3;

b. for detecting S gene mutation types: primers and probes of sequence position 23048, sequence variation G > A; wherein the nucleotide sequence of the forward primer is as follows: the nucleotide sequence of the reverse primer is shown as SEQ ID No.5, and the nucleotide sequence of the probe is shown as SEQ ID No. 6;

c. for detecting S gene mutation types: primers and probes of sequence position 23202, sequence variation C > a; wherein the nucleotide sequence of the forward primer is as follows: the nucleotide sequence of the reverse primer is shown as SEQ ID No.8, and the nucleotide sequence of the probe is shown as SEQ ID No. 9;

d. for detecting S gene mutation types: primers and probes of sequence position 22898, sequence variation G > A; wherein the nucleotide sequence of the forward primer is as follows: SEQ ID No.10, the nucleotide sequence of the reverse primer is shown as SEQ ID No.11, and the nucleotide sequence of the probe is shown as SEQ ID No. 12.

The gene sequence of the S gene of the new coronavirus is referred to GenBank: MW533315.1 and the gene sequence of the S gene variation is referred to GenBank: OL 672836.1.

Further, the kit contains all four groups of primers and probes, especially when the 4 mutation sites are required to be detected simultaneously. For example, when it is desired to determine the specific mutation type of the S gene, it is necessary to simultaneously detect the above 4 sites.

Further, the fluorescence reporter/fluorescence Quencher is selected from BHQ1, BHQ2, BHQ3, Dabcy1, Tamra and Quencer fluorescence Quencher selected from FAM, VIC or HEX, ROX, NED, CY3 or CY5 fluorescence reporter/MGB or non-MGB, and the fluorescence reporter on each probe in the kit is different from each other.

Further, the kit also comprises any one or more of the following components: PCR reaction solution, enzyme mixed solution, positive control and negative control.

Further, the PCR reaction solution comprises a buffer solution and MgCl₂dUTP and M dNTPs; the enzyme mixed solution comprises Taq enzyme, reverse transcriptase and UNG enzyme, wherein the Taq enzyme is hot start Taq enzyme, the reverse transcriptase is DNA polymerase dependent on RNA, and the UNG enzyme is uracil-N-glycosylase.

Further, the positive control is selected from any one or more of the following:

or pseudoviruses containing mutated sequences of the novel coronaviruses. For example, a non-replicating lentivirus containing a mutated sequence of the S gene of a novel coronavirus.

Further, the negative control is a pseudovirus containing a portion of the S gene sequence of the new coronavirus, e.g., a non-replicating lentivirus containing the S gene of the new coronavirus.

Further, the kit also comprises a primer probe for detecting the internal reference gene.

Further, the probe comprises any one or more of the polynucleotides with nucleotide sequences shown as SEQ ID No.13, SEQ ID No.14 and SEQ ID No 15. And each primer for detecting the reference gene is consistent with the primer for detecting the corresponding mutant gene.

In another aspect of the invention, the kit as described above is provided for use in detecting any one or several of the following novel coronavirus nucleic acid S gene mutation types: s gene mutation type: a. sequence position 23599, sequence variation T > G, b. sequence position 23048, sequence variation G > a, C. sequence position 23202, sequence variation C > a, d. sequence position 22898, sequence variation G > a.

In another aspect, the invention provides the use of the kit as described above in the preparation of a product for detecting any one or several of the following novel coronavirus nucleic acid S gene mutation types: s gene mutation type: a. sequence position 23599, sequence variation T > G, b. sequence position 23048, sequence variation G > a, C. sequence position 23202, sequence variation C > a, d. sequence position 22898, sequence variation G > a.

As described above, the method for detecting the new coronavirus Ormcken nucleic acid mutation gene has the following beneficial effects:

(1) the kit can simultaneously detect the Oncorks gene mutation type of the new coronavirus, and fills the blank that the existing fluorescent quantitative PCR product can only detect the pathogen of the new coronavirus but cannot detect multiple gene mutation types of the Oncorks.

(2) The invention also has the advantages of high sensitivity, good specificity, strong repeatability, quick and objective detection result, cost saving and the like, and has great application prospect in the field of in vitro diagnosis of the new mutation type of the Ormcken gene of the new coronavirus.

(3) The kit is simple and convenient to operate and can effectively prevent pollution, the ARMS-PCR fluorescence detection time (from the sample treatment) is only 2-3 hours, the PCR fluorescence detection is a totally closed operation, and a tube cover can not be opened any more after a sample nucleic acid extract to be detected is added, so that the pollution generation chance is reduced. UNG enzyme is added into the reaction solution, so that the pollution of the amplification product is prevented.

Drawings

FIG. 1 is a graph showing the amplification of mutant 446G > S of the S gene of novel coronavirus at various concentrations.

FIG. 2 is a graph showing the amplification of the mutant form 547T > K of the S gene of the novel coronavirus at various concentrations.

FIG. 3 is a graph of the amplification of the novel coronavirus S gene mutant 496G > S at different concentrations.

FIG. 4 is a graph of amplification curves of the novel coronavirus S gene mutant 679N > K at different concentrations.

FIG. 5 is a graph of amplification of test kits for various viruses containing the 446G > S mutant in example 3.

FIG. 6 is a graph of the amplification of test cassettes for various viruses containing 547T > K mutants in example 3.

FIG. 7 is a graph of the amplification of test kits for various viruses containing a 496G > S mutant in example 3.

FIG. 8 is a graph of the amplification of test kits for various viruses containing 679N > K mutants in example 3.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention. It is to be understood that the processing equipment or apparatus not specifically identified in the following examples is conventional in the art. Furthermore, it is to be understood that one or more method steps mentioned in the present invention does not exclude that other method steps may also be present before or after the combined steps or that other method steps may also be inserted between these explicitly mentioned steps, unless otherwise indicated; it is also to be understood that a combined connection between one or more devices/apparatus as referred to in the present application does not exclude that further devices/apparatus may be present before or after the combined device/apparatus or that further devices/apparatus may be interposed between two devices/apparatus explicitly referred to, unless otherwise indicated. Moreover, unless otherwise indicated, the numbering of the various method steps is merely a convenient tool for identifying the various method steps, and is not intended to limit the order in which the method steps are arranged or the scope of the invention in which the invention may be practiced, and changes or modifications in the relative relationship may be made without substantially changing the technical content.

Example 1 detection kit and use thereof

The kit comprises the following components:

PCR reaction liquid, enzyme mixed liquid, mutant gene multiplex reaction liquid, internal standard reaction liquid, positive control I and negative control II;

the PCR reaction solution contained 10 Xbuffer solution, 25mM MgCl₂10mM dUTP and 10mM dNTPs; the enzyme mixed solution comprises Taq enzyme, reverse transcriptase and UNG enzyme, the mutant gene multiplex reaction solution, the upstream and downstream primers of the internal standard reaction solution and the probe are proportioned as follows: 4:4: 1; the forward primer was 300nM, the reverse primer 300nM and probe 100 nM.

The nucleotide sequences of primers and probes for the novel coronavirus mutant gene used in this example can be found in table 1.

TABLE 1 multiple reaction solution for mutant genes

679NK-F	TAGGGGCTGAATATGTCAACAACTC	SEQ ID No.1
			679NK-R	CGTGCCCGCCGATGAGACT	SEQ ID No.2
679NK–P	X1-ATAACTAGCGCATATACCTGCACCAATGGGTA-Y1	SEQ ID No.3
			496GS-F	TGAGAGAGATATTTCAACTGAAATCTATC	SEQ ID No.4
496GS-R	AACACCATAAGTGGGTCGGAAACT	SEQ ID No.5
			496GS-P	X2-CCTGCAACACCATTACAAGGTTTGTTACCGGC–Y2	SEQ ID No.6
547TK-F	GTGTCAATTTCAACTTCAATGGTTTAAA	SEQ ID No.7
			547TK-R	CCAAATTGTTGGAAAGGCAGAAACT	SEQ ID No.8
547TK-P	X3-CACAGGTGTTCTTACTGAGT–Y3	SEQ ID No.9
			446GS-F	GAATTCTAACAAGCTTGATTCTAAGGTTA	SEQ ID No.10
446GS-R	GGCCTGATAGATTTCAGTTGAAATATCT	SEQ ID No.11
			446GS-P	X4-TTACCTGTATAGATTGTTTAGGAA–Y4	SEQ ID No12

Note: x1, X2, X3, X4, X5, X6, X7 and X8 are fluorescence reporters, and Y1, Y2, Y3, Y4, Y5, Y6, Y7 and Y8 are fluorescence quenchers.

TABLE 2 internal standard reaction solution

β-actin-F	GCACTCTTCCAGCCTTCCTT	SEQ ID No13
			β-actin-R	CGGATGTCCACGTCACACTT	SEQ ID No.14
β-actin–P	X1-CCTGGGCATGGAGTCCTGTGGCATC–Y1	SEQ ID No.15

Note: x1 is a fluorescence reporter group, and Y1 is a fluorescence quencher group.

Positive control: comprises the following components (all known gene sequences): the pseudovirus containing the mutant sequence of the new coronavirus is a non-replicative lentivirus of the mutant sequence of the S gene of the new coronavirus;

negative controlThe pseudovirus containing the new coronavirus is a non-replicative lentivirus of an S gene of the new coronavirus.

Use of the kit

Firstly, collecting and storing samples, wherein the requirements are as follows:

1. throat swab: the bilateral pharyngeal tonsils and the posterior pharyngeal wall were wiped simultaneously with 2 plastic rod swabs of polypropylene fibre heads, the swab heads were dipped into tubes containing 3ml of sampling solution, the tails were discarded, and the caps were screwed down.

2. A nasal swab: the plastic rod swabs of 1 polypropylene fiber head are gently inserted into the nasal passage at the nasal palate, and slowly rotated and withdrawn after staying for a moment. Another plastic rod swab with a polypropylene fiber tip was used to collect the other nostril in the same manner. The two swabs were immersed in the same tube containing 3ml of the sample solution, the tail was discarded, and the cap was screwed on.

The sample (throat swab/nasal swab) is the sample to be tested. The sample should be detected immediately after collection, or stored at-20 deg.C for detection, with a storage period of no more than 4 months, and should be stored at-70 deg.C for long term. And (4) avoiding repeated freeze thawing of the sample, and carrying out low-temperature transportation by using dry ice or ice bags.

Second, detection method

1. Reagent preparation (reagent preparation zone)

Table 3 reaction solution preparation 1 (sample test):

components of reaction solution	Addition (μ l/reaction)
		PCR reaction solution	5
S mutant gene multiplex reaction solution	5
		Enzyme mixture	5
Total volume	15

Table 4 reaction solution preparation 2 (negative control):

table 5 reaction solution preparation 3 (positive control):

components of reaction solution	Addition (. mu.l)/reaction
		PCR reaction solution	5
S mutant gene multiplex reaction solution	5
		Enzyme mixture	5
Total volume	15

Table 6 reaction solution preparation 4 (sample test):

components of reaction solution	Addition (μ l/reaction)
		PCR reaction solution	5
Internal standard reaction liquid	5
		Enzyme mixture	5
Total volume	15

Table 7 reaction solution preparation 5 (negative control):

components of reaction solution	Addition (. mu.l)/reaction
		PCR reaction solution	5
Internal standard reaction liquid	5
		Enzyme mixture	5
Total volume	15

Table 8 reaction solution preparation 6 (positive control):

components of reaction solution	Addition (. mu.l)/reaction
		PCR reaction solution	5
Internal standard multiple reaction liquid	5
		Enzyme mixture	5
Total volume	15

2. Sample processing (sample processing zone) (three-level protection)

Three-level protective articles need to be worn before entering the buffer room of the experimental area, and the user can enter the buffer room. The wearing sequence is as follows: hand hygiene → wearing disposable protective cap → wearing N95 protective mask (for tightness detection) → wearing disposable one-piece protective suit → wearing disposable shoe cover → wearing disposable waterproof boot → wearing first layer of latex gloves (for tightness inspection) → wearing protective eyepiece or protective face shield → wearing second layer of latex gloves (for tightness inspection).

Before the experiment, 2000mg/L chlorine-containing disinfectant is used for disinfecting the table top, the table top and the ground. The disinfectant needs to be prepared fresh every day, and the effective time does not exceed 24 hours. The pretreatment, extraction and sample adding of the specimen are finished in a biological safety cabinet. The 2 testers cooperate to operate together, the operation process is gentle, and splashing is avoided. After the experiment personnel operates or finishes processing the specimen, the outer layer glove is needed to be removed, and the biological safety cabinet can be drawn out by hand after the glove is replaced. The operation inside the biological safety cabinet is completed by a laboratory technician A, and the operation outside the biological safety cabinet is completed by the assistance of a laboratory technician B. In the extraction process, 75% ethanol or alcohol compound quick-drying hand disinfectant is required to be used for disinfection every time the biosafety cabinet enters or exits the extraction process.

2.1 examination of specimens (experimenter a): the specimen transport box transported to the laboratory should be opened within the biosafety cabinet. After the transfer box is opened, 2000mg/L chlorine-containing disinfectant is used for spraying and disinfecting the inner wall of the transfer barrel and the specimen collection sealing bag. After the specimen collection tube is taken out, whether the outer wall of the specimen tube is damaged or not and whether the tube opening is leaked or not should be firstly checked. After confirming no leakage, the outer surface of the sample tube was sterilized by spraying and wiping with 75% ethanol. If leakage is found, the sample is immediately covered by absorbent paper, and a chlorine-containing disinfectant with the effective chlorine content of 5000mg/L is sprayed for disinfection treatment, so that the sample cannot be continuously detected, the sample is immediately sealed and packaged after unqualified record is made, and the sample is destroyed after pressure steam sterilization treatment.

2.2 specimen inactivation treatment (experimenter B): the specimen is put into an incubator at 56 ℃ for 30min for inactivation. The specimen is gently shaken for 1 time every 10min in the period to ensure that the specimen is uniformly inactivated; after inactivation, the specimen is kept stand to room temperature to allow the aerosol to settle, then the surface is wiped by 75% ethanol, and the specimen is put back into the biological safety cabinet.

2.3 nucleic acid extraction

2.3.1 Prior to the experiment, proteinase K was removed from 4 ℃ and equilibrated to room temperature.

2.3.2

48-person board: remove 1 pre-packaged 96 deep well plate and add 10. mu.L proteinase K to each well in a corresponding number of sample wells in the first and seventh columns.

96-person plate: remove the prepackaged lysate plate and add 10. mu.L proteinase K to each well.

2.3.3

48-person board: the 96 deep well plate was moved to a biosafety cabinet and 2000. mu.L of sample was added to each well in a corresponding number of sample wells in the first and seventh columns.

96-person plate: 2000. mu.L of each sample was added to each well.

2.3.4

48-person board: after loading, the 96-well plate was moved to the DOF-9648 instrument (position a1 at the top left), the sleeve was inserted, and the "new coronavirus" program was clicked to run the nucleic acid extractor.

96-person plate: after sample adding is finished, the five plates are respectively placed at the correct positions of DOF-9696pro according to the setting of the instrument, a magnetic needle sleeve is inserted on the lysis solution plate, calibration is clicked, and after debugging is finished, an operation program is clicked to extract nucleic acid.

2.3.5

After the operation of the instrument is finished, the eluent plate is the extracted nucleic acid. Immediately after the nucleic acid extraction is completed, the extract is subjected to a membrane sealing treatment.

2.3.6 in the biological safety cabinet, 5 μ L of nucleic acid sample to be detected is added into the PCR amplification tube, the final volume is 20 μ L each tube, the tube cover is covered tightly, and the tube is centrifuged at low speed instantaneously and detected on the RT-PCR instrument.

2.4 after the detection is finished, the experimenter uses 75% ethanol to sterilize the outer gloves, and takes off the outer gloves and puts the gloves into a garbage can. And sealing medical waste generated in the safety cabinet by using a three-layer garbage bag, and transferring the medical waste to a high-pressure sterilization room for sterilization. The working table surface is wiped by 75 percent ethanol, and 2000mg/L of available chlorine disinfectant is sprayed on the ground. The disinfection of plastic or organic glass material articles is carried out by wiping or spraying with 2000mg/L chlorine-containing disinfectant. Opening ultraviolet lamp of transfer window, ultraviolet lamp of biological safety cabinet, ultraviolet lamp of nucleic acid extraction instrument, movable ultraviolet disinfection vehicle, and ultraviolet lamp of laboratory, and setting ultraviolet irradiation for 60 min.

2.5 when the laboratory sample preparation room is left after the experiment of the laboratory worker is finished, the personal three-level protective articles should be taken off in the buffer zone in sequence, and the sequence is as follows: hand hygiene → wearing new disposable latex gloves → picking protective glasses, and putting in 75% ethanol for soaking and disinfection → taking off disposable conjoined protective clothing (from top to bottom, turning from inside to outside) → taking off outer gloves → hand hygiene → picking N95 protective mask → picking off disposable protective cap → taking off disposable shoe cover → taking off gloves → hand hygiene.

3PCR amplification (319 amplification Chamber) (second level protection)

When the patient enters the experimental area, the patient needs to wear an N95 protective mask, a disposable protective cap, a disposable isolation gown worn outside the special work clothes of the laboratory, disposable shoe covers and latex gloves (for checking the tightness).

TABLE 9 fluorescence detection channel selection and amplification cycle parameter settings

Note: no ROX correction is not selected, and the quenching group is selected from None.

And after the setting is finished, saving the file and operating the reaction program.

Third, analysis of test results

Under the condition that the instrument is normal and the negative reference product, the positive reference product and the internal standard curve are normal

1. And when the CT is less than or equal to 36, judging that the pathogen of the corresponding channel is positive.

2. If the CT is more than 36 and less than or equal to 40, the test is repeated again, and the result is the same, the result is judged to be positive.

3. When Ct is more than 40 or no amplification exists, the result is judged to be negative.

The result is judged to be positive, which indicates that the corresponding mutant gene exists, and the negative indicates that no corresponding mutant gene exists. The presence of all four mutant genes in the pathogen indicates that the sample is positive for the Ormckhen (Omicron) variant of the new coronavirus, and more stringent precautions are recommended.

The detection results of 10 cases of simulated samples are consistent with clinical expectation, the sensitivity and the specificity of the kit are shown, and no obvious cross reaction exists between primer probes. The 10 samples of this experiment were from home-made mock samples.

EXAMPLE 2 sensitivity test of the kit

The positive reference substance is a non-replicative lentivirus of a corresponding mutant sequence of a new coronavirus S gene, and is synthesized by a professional organization; the 10-fold gradient was diluted to 500 copies per ml (the jump amplification curve on the right in the figure).

The kit is used for detection.

The detection result shows that: the kit has good sensitivity for detecting corresponding mutant sequences (446G > S, 547T > K, 496G > S and 679N > K) of the S gene of the novel coronavirus, the copy number per milliliter is up to 500, and the CT value changes in a gradient manner along with the reduction of the concentration. See fig. 1, 2, 3, 4.

EXAMPLE 3 specificity test of the kit

In order to detect the specificity of the nucleic acid detection kit (fluorescent PCR method) of the present invention, rhinovirus, enterovirus, adenovirus, respiratory syncytial virus, influenza virus (types A and B), parainfluenza virus, and the like are detected using the kit (fluorescent PCR method).

The detection result shows that: the detection kit can specifically amplify corresponding mutant sequences (446G > S, 547T > K, 496G > S and 679N > K) without cross reaction with nucleic acids of other viruses in respiratory tract, and is shown in figure 5, figure 6, figure 7 and figure 8.

The results show that the kit is generally applicable to clinic, and has the advantages of good sensitivity, high specificity, high accuracy and time-saving and labor-saving operation process.

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions set forth herein, as well as variations of the methods and compositions of the present invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Sequence listing

<110> laboratory Limited of the State national drug medical laboratory

<120> new coronavirus Ormcken mutation sequence detection technology based on multiple fluorescence quantitative ARMS-PCR technology and application thereof

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

taggggctga atatgtcaac aactc 25

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgtgcccgcc gatgagact 19

<210> 3

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ataactagcg catatacctg caccaatggg ta 32

<210> 4

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgagagagat atttcaactg aaatctatc 29

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aacaccataa gtgggtcgga aact 24

<210> 6

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cctgcaacac cattacaagg tttgttaccg gc 32

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtgtcaattt caacttcaat ggtttaaa 28

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ccaaattgtt ggaaaggcag aaact 25

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cacaggtgtt cttactgagt 20

<210> 10

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gaattctaac aagcttgatt ctaaggtta 29

<210> 11

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggcctgatag atttcagttg aaatatct 28

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ttacctgtat agattgttta ggaa 24

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gcactcttcc agccttcctt 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cggatgtcca cgtcacactt 20

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cctgggcatg gagtcctgtg gcatc 25

Claims

1. A kit for detecting S gene mutation types of new coronavirus nucleic acids is characterized by comprising any one or more of the following primers and probes, wherein the primers in each group comprise a forward primer and a reverse primer, and two ends of each probe are respectively marked with a fluorescence reporter group/a fluorescence quenching group:

2. The kit of claim 1, wherein the fluorescence reporter/Quencher is selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra and Quencher fluorescence Quencher selected from FAM, VIC or HEX, ROX, NED, CY3 or CY5 fluorescence reporter/MGB or non-MGB and wherein the fluorescence reporter on each of the probes in the kit is different from the fluorescence Quencher on the kit.

3. The kit according to claim 1, wherein the kit further comprises any one or more of the following components: PCR reaction solution, enzyme mixed solution, positive control and negative control.

4. The kit according to claim 3, wherein the PCR reaction solution comprises buffer solution, MgCl₂dUTP and dNTPs; the enzyme mixture comprises Taq enzyme, reverse transcriptase and UNG enzyme.

5. The kit of claim 3, wherein the positive control is a pseudovirus comprising a mutated sequence of a novel coronavirus.

6. The kit of claim 3, wherein the negative control is a pseudovirus comprising a portion of the gene sequence of the neocoronavirus.

7. The kit of claim 1, further comprising a probe for detecting an internal standard.

8. The kit according to claim 7, wherein the probe comprises any one or more of the polynucleotides having the nucleotide sequences shown as SEQ ID No.13, SEQ ID No.14 and SEQ ID No. 15.

9. Use of a kit according to any one of claims 1 to 8 for the detection of any one or several of the following types of mutations in the S gene of a novel coronavirus nucleic acid: a, S gene mutation type: sequence position 23599, sequence variation T > G; b.S Gene mutation types: sequence position 23048, sequence variation G > a; c.S Gene mutation types: column position 23202, sequence variation C > a; d.S Gene mutation types: sequence position 22898, sequence variation G > a.

10. Use of a kit according to any one of claims 1 to 8 for the preparation of a product for detecting any one or more of the following types of mutations in the S gene of a novel coronavirus nucleic acid: a.S Gene mutation types: sequence position 23599, sequence variation T > G; b.S Gene mutation types: sequence position 23048, sequence variation G > a; c.S Gene mutation types: sequence position 23202, sequence variation C > a; d.S Gene mutation types: sequence position 22898, sequence variation G > a.