CN114561400A

CN114561400A - Red strawberry nitrate transport protein gene FaNRT1.1 and application thereof

Info

Publication number: CN114561400A
Application number: CN202210217173.3A
Authority: CN
Inventors: 方从兵; 孙启涵; 郝福玲; 吴沐谦; 吴思鑫
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2022-03-07
Filing date: 2022-03-07
Publication date: 2022-05-31

Abstract

The invention relates to the technical field of plant genes, in particular to a Fragaria rosenbergii nitrate transporter gene FaNRT1.1 and application thereof, wherein the nucleotide sequence of the Fragaria rosenbergii nitrate transporter gene FaNRT1.1 is shown as SEQIDNO.1, the Fragaria rosenbergii nitrate transporter gene FaNRT1.1 is obtained by cloning from Fragaria rosebergii, and the expression mode and the response mode to different nitrogen forms, nitrate nitrogen, hormones and other abiotic stresses are researched, so that the Fragaria rosebergergii nitrate transporter gene FaNRT1 is applied to screening of germplasm materials, cultivation of high-quality varieties and abiotic stresses according to different response states.

Description

Red strawberry nitrate transport protein gene FaNRT1.1 and application thereof

Technical Field

The invention relates to the technical field of plant genes, in particular to a red strawberry nitrate transporter gene FaNRT1.1 and application thereof.

Background

NRT1.1 is the only proven dual affinity nitrate transporter and putative nitrate receptor. Arabidopsis atnrt1.1 is the first nitrate transporter discovered and most clearly studied for function in the NRT1 family. In 1993, Tsay firstly screens nitrate nitrogen analogue chlorate to obtain a first plant nitrate transport protein gene CHL1(AtNRT1.1) mutant; the gene is cloned and heterologously expressed in Xenopus laevis oocytes, and researches show that the gene is a gene encoding nitrate-induced low-affinity transport protein, and the expression quantity is increased when the pH of the cells is low, and the expression quantity is reduced when the cells are treated by ammonium salt. CHL1 also has the functional characteristics of high-affinity nitrate transport protein, and subsequent researches show that the affinity of CHL1 for nitrate is regulated by the phosphorylation level of Thr at position 101 of the protein, phosphorylated CHL1 has high affinity for nitrate, and dephosphorylated CHL1 has low affinity for nitrate. By NO in the external environment₃ ^-The regulation of phosphorylation by AtNRT1.1 is influenced by concentration, and the protein kinase CIPK23 can respond to low concentration NO3^-Phosphorylating Thr101 site of AtNRT1.1 to inhibit low-affinity NO of AtNRT1.1₃ ^-Transport activity; whereas CIPK8 positively regulated the low affinity transport activity of atnrtt 1.1.

NRT1.1 has been shown by prior studies as a nitrate receptor, and in many organisms NRT1.1 nitrate receptors are commonly involved in the transport and perception of nutrients. Evidence that NRT1.1 is a nitrate receptor was obtained by an NRT1.1 mutant that prevented nitrate uptake, but retained induction of gene expression in response to a nitrate response. NRT1.1 can activate a variety of nitrate sensing and signaling mechanisms required for the regulation of nitrate-responsive genes in arabidopsis roots. NRT1.1 also affects various biological processes such as root development and morphogenesis, auxin transport, seed dormancy, flowering time, stomatal movement, etc. The study of the NRT1.1 gene has been conducted in detail in arabidopsis thaliana, and in other plants. Monocotyledons and true cotyledon plants differ in the number of NRT1.1 genes, most true cotyledon plants have only one NRT1.1 gene, while gramineae plants usually have 3 to 4 NRT1.1 members. The current report indicates that the two putative homologous genes of atnrt1.1(atnpf6.3) in maize, zmnpf6.4 and zmnpf6.6, exhibit different substrate affinities for nitrate and chloride, indicating that there may be functional differences between different members of the NRT1.1 family in maize. OsNRT1.1A (OsNPF6.3) deviates from the previously reported plant NRT1.1 gene in function, and has the functions of up-regulating the expression of nitrate and ammonium nitrogen utilization related genes and flower related genes, participating in the regulation of N utilization and flowering and promoting high yield and early maturing of rice. OsNRT1.1B (OsNPF6.5) is a functional homologue of AtNRT1.1, participates in the utilization of nitrate, and single polymorphism of the gene causes NUE difference between indica rice and japonica rice of Asian cultivated rice (Oryzasativa). The BcNRTT 1.1 gene in Chinese cabbage expresses in the overground part growing point and underground root tip, participates in lateral root development, is regulated and controlled by phosphokinase and participates in initial nitrate reaction, and can regulate BcNRTT 2.1 expression.

In view of the above-mentioned drawbacks, the inventors of the present invention have finally obtained the present invention through a long period of research and practice.

Disclosure of Invention

The invention aims to solve the problem of how to research strawberry nitrate transporter related genes and expression and corresponding modes thereof, and provides a red strawberry nitrate transporter gene FaNRT1.1 and application thereof.

In order to realize the purpose, the invention discloses a strawberry nitrate transporter gene FaNRT1.1 with a nucleotide sequence shown as SEQ ID NO. 1.

The amino acid sequence of the product coded by the strawberry nitrate transporter gene FaNRT1.1 is shown in SEQ ID NO. 2.

The invention also discloses application of the strawberry nitrate transporter gene FaNRT1.1 in screening germplasm materials, cultivating high-quality varieties and coping with abiotic stress through different response modes of the gene FaNRT1.1.

Compared with the prior art, the invention has the beneficial effects that: the invention uses N11F and N11R as primers, uses cDNA of red strawberry root as a template, uses LATaq enzyme (Takara) system to amplify NRT1.1 gene, finds about 2000bp non-coding nucleotide sequence at the upstream of FaNRT1.1 homologous sequence from the genome sequence of octaploid strawberry Carmura (Camarose) according to the gene sequence of red strawberry FaNRT1.1, designs specific primers with enzyme cutting sites, analyzes the response mode of the red strawberry FaNRT1.1, can be applied to screening germplasm materials, cultivating high-quality variety and responding to abiotic stress according to different response modes, aNRT1.1 is nitrate signal gene, nitrate transport protein, has no research on the gene in strawberry at home and abroad, is found for the first time in strawberry, has nitrate transport function, and can up-regulate the expression of related genes of nitrogen metabolism by establishing strawberry hairy root induction system, the absorption of nitrate in root systems is promoted, the nitrate content in strawberry fruits is increased, the fruit ripening is promoted, and the method has great significance for improving the quality and the yield of the strawberries.

Drawings

FIG. 1 is an electrophoretic detection map of FaNRT1.1;

FIG. 2 shows the phylogenetic relationship between red strawberry and NRT1.1 of other plants;

FIG. 3 is a FaNRT1.1 protein structure analysis;

FIG. 4 is an electrophoretic map of the FaNRT1.1 promoter;

FIG. 5 is a spatiotemporal expression pattern of FaNRT1.1;

FIG. 6 is a graph of the response pattern of FaNRT1.1 to different nitrogen morphologies;

FIG. 7 is a graph of the response pattern of FaNRT1.1 to short-term induction of nitrate nitrogen;

FIG. 8 is a graph of the response pattern of FaNRT1.1 to long-term treatment of nitrate nitrogen;

FIG. 9 is a graph of FaNRT1.1 response pattern to hormones;

FIG. 10 is a graph of the response pattern of FaNRT1.1 to other abiotic stresses;

FIG. 11 shows FaNRT1.1 subcellular localization;

figure 12 is NAA-induced fanrt1.1 tissue localization analysis.

Detailed Description

The above and further features and advantages of the present invention are described in more detail below with reference to the accompanying drawings.

Cloning and analysis of the gene and promoter of the strawberry nitrate transporter gene FaNRT1.1.

The invention utilizes software FPCR and BioXM2.6 to design specific primers according to the comparison of the transcriptome data of the red strawberry and the NCBI to the genome data of the octaploid strawberry. The NRT1.1 gene was amplified using LATaq enzyme (Takara) system using N11F and N11R as primers and cDNA from red strawberry root as a template.

The PCR amplification product was subjected to 1% agarose gel electrophoresis detection, the gel block of the band of the desired length was cut, and the desired fragment was recovered using a Tiangen agarose gel DNA recovery kit (TIANgelMidiPurificationkit). Connecting the target fragment recovered from the gel with a pMDTM19-T vector, transforming Escherichia coli (E.coli) DH5 alpha competent cells, screening on an Amp resistant culture dish, and detecting colony PCR reaction. Selecting bacterial colony containing target fragment, shaking again, extracting plasmid by using Tiangen plasmid miniprep kit (TIANProminipalamid kit) method, sequencing by Shanghai biological engineering Co., Ltd, and storing bacterial liquid and plasmid at-80 deg.C for use. Designing an upstream primer and a downstream primer of the FaNRT1.1 gene according to strawberry transcriptome data, carrying out PCR amplification, and finding out that the sequence of 1799bp is obtained by cDNA cloning of the FaNRT1.1 gene of the strawberry with the red color through sequencing, wherein the electrophoresis detection result is shown in figure 1. The fanrtt 1.1 was found to be located on chromosome 5 within the strawberry genome by alignment with the red strawberry transcriptome. Phylogenetic analysis of NRT family genes can find that FaNRT1.1(FaNPF6.3.3) and Arabidopsis AtNRT1.1(AtNPF6.3) cluster more closely, which indicates that the cloned NRT family genes of red strawberry are reasonable in name and belong to NRT1/PTR (NPF) family.

The cloned red strawberry NRT1.1 was subjected to BLAST alignment analysis of ncbi (national center for biotechnology information) with other plant NRT1.1 amino acid sequences, and to clustering comparison of data using MEGA7.0 software, phylogenetic tree construction using adjacency, and clustering analysis was performed 1000 times by using Bootstrap method resampling.

The bioinformatics analysis is carried out by using software or a website, and mainly comprises the following steps: homologous sequence analysis, amino acid sequence analysis, transmembrane domain analysis, protein secondary structure analysis and the like. Performing sequence comparison analysis by using DNAMAN5.2 software; sequence alignment and open reading frame analysis using NCBI and bioxm2.6; analyzing the isoelectric point and the molecular weight of a gene sequence by using pI/Mwtool; analyzing the transmembrane region of the amino acid sequence by using a TMHMMServervev.2.0 tool; analyzing an amino acid sequence signal peptide by using SignalP4.1; analyzing the protein domain using SMART tools; protein secondary structure analysis was performed using the SOPMA tool; species homology alignments were performed using NCBI.

The cloned fanrt1.1 was phylogenetically analyzed with the amino acid sequence of NRT1.1 of other plants (as shown in fig. 2) and found that the species most closely related to red strawberry are forest strawberry (Fragariavesca) and Chinese rose (Rosachinensis), followed by almond (prunuussuri), sweet cherry (prunus), wild peach (prunus persica), plum blossom (pruusmum), apple (malus domestica) and white pear (pyrus xbretscheideri), and further followed by quercus robur (quercusuber), walnut (jugslanregion), pari grape (vitisia), cocoa (theobromacao), hemp (cannabissiva), pigeon pea (canuaja jajan) and arabidopsis thaliana. Although there is significant variability between species, there are many conserved domains, and it can be seen that the cloned fanrt1.1 maintains some homology during evolution.

Bioinformatics analysis found that: FaNRT1.1 contains a 1767bp complete open reading frame and encodes 588 amino acids; the coded amino acid sequence has an isoelectric point of 9.08, and the molecular weight of the protein is 64617.47; predicted to have 12 transmembrane helices (TMHs), with a predicted number of Amino Acids (AAs) in the transmembrane helix of 252.29324; the amino acid sequence is free of signal peptide; the results of the prediction of the protein domain of FaNRT1.1 (as shown in FIG. 3) show that the transmembrane regions are 46-68, 73-92, 99-121, 146-168, 189-211, 215-237, 337-359, 374-396, 417-436, 456-478, 499-521 and 541-563, and the less complex regions are 575-584; the protein secondary structure of FaNRT1.1 found 39.63% for alpha-helix, 20.07% for extended chain, 8.50% for beta-turn, and 31.80% for random coil.

According to the obtained gene sequence of the FaNRT1.1 of the red strawberry, a noncoding nucleotide sequence of about 2000bp at the upstream of the FaNRT1.1 homologous sequence is found from the genome sequence of the octaploid strawberry Kamilo (Camarose), and a specific primer with an enzyme cutting site is designed. The DNA of red strawberry leaves is used as a template, N11PF (CCCAAGCTTAAATTAAGTTCTAAACCCATGC) and N11PR (GGAATTCTGCCCTATATAGTTTTGAGCGCC) are used as primers, PCR amplification is carried out, and the promoter of FaNRT1.1 is cloned.

PCR amplification was performed using red strawberry DNA as a template, N11PF and N11PR primers. The amplified product was detected by electrophoresis, and a band was found to appear around 2000bp (FIG. 4). After clone transformation, sequencing and sequence comparison, the FaNRT1.1 gene promoter of 2064bp (without 16bp primer region) is obtained.

The FaNRT1.1 promoter regulatory element is subjected to prediction analysis through promoter online analysis software PlantCARE and PLACE.

Promoter cis-acting element analysis using plantarcae (as shown in table 1) revealed many different functional cis-acting elements on the fanrt1.1 promoter. There are important transcription factor MYB family binding site Myb-binding site, 9 kinds of cis-acting elements related to photoresponse such as AE-Box, ATC-motif, G-Box and LAMP-element, hormone response elements (methyl jasmonate, salicylic acid and abscisic acid) such as CGTCA-motif, TCA-element and ABRE, elements related to expression of AuxRR-core and CAT-Box with auxin and meristem, anti-adversity response element of TC-richrepeat, and promoter core elements such as CAAT-Box and TATA-Box. It is presumed that the expression of the FaNRT1.1 gene is regulated by various factors such as light and hormones.

TABLE 1 FaNRT1.1 Gene promoter PlantCARE cis-element analysis

To analyze some of the specific cis-acting elements of interest, a PLACE was used simultaneously (see Table 2). Wherein, various BOX elements with a large number such as CAATBOX1, CCAATBOX1, ACGTABOX, GATABOX and GTGANTG10 have the related functions of heat shock, chlorophyll combination and the like; MYB cis-acting elements such as MYBCORE, MYBPZM, MYB1AT and MYBST1,has the related functions of MybSt1 binding site, water stress response, flavonoid biosynthesis and the like; 12 WRKY71OS sites can be combined with a transcription factor WRKY71 to influence a gibberellin signal channel; ltreecto 15 and LTREATLTI78 of the LTRE class can respond to low temperatures; DRE2COREZMRAB17 and drectrcoreat of DRE class can respond to drought; CACTFTPPCA1 in CACT belongs to the key component of phosphoenolpyruvate carboxylase remote cis-regulatory element Mem 1; dofcezm and NTBBF1ARROLB in DOF can enhance cytoplasmic phosphokinase initiation and auxin induction; ABRERATCAL in ABRE can be Ca²⁺Responding to the up-regulation; MYCCONSENSUS in MYC can induce transcription at low temperature; CBFHV in CBF participates in dehydration reaction; the root-specific regulatory element is ROOTMOTIFTAPOX1 in ROOTmotif.

TABLE 2 analysis of cis-elements of the promoter PLACE of the FaNRT1.1 Gene

Expression mode of Eryan strawberry nitrate transporter gene FaNRTF2.7

In addition, in the red strawberry plant which normally grows in the greenhouse, the expression pattern of the gene is analyzed by taking roots (whole roots, root), stems (shortened stems), stolons (stolons), buds (bud), leaves (mixture of young leaves and mature leaves, leaf), flowers (flower), fruits (mature fruits) and seeds of lean fruits (ache), taking FaACT as an internal reference gene and adopting FaNRT2.7 quantitative primers. Furthermore, young roots (young root, YR) and mature roots (MatureRoot, MR), young leaves (YL, YL), mature leaves (MatureLeaves, ML) and old leaves (OldLeaves, OL) were taken for further expression analysis of the fanrt1.1 gene.

Young roots and mature leaves of 30d were treated with Control (Nd), Nitrate (Nitrate, Ni), Ammonium (Ai) and Nitrate-Ammonium (Na) nitrogen, and subjected to farrt 1.1 response pattern analysis for long-term treatment of different nitrogen forms for 30d, and leaves (mature leaves), flowers, small green fruits and mature fruits were subjected to farrt 2.7 response pattern analysis for different nitrogen forms for 30 d. And young roots, mature roots, young leaves, mature leaves, flowers and fruits (mature fruits) are taken to analyze the response degree of FaNRT1.1 to nitrate nitrogen in detail.

As shown in fig. 6A, in the case of the red strawberry seedlings treated with different nitrogen forms for 30 days, the expression level of the fanrt1.1 gene was significantly increased after the nitrate nitrogen treatment in the roots, and the expression level of the gene was significantly increased after the nitrate nitrogen-ammonium nitrogen treatment. The difference is more obvious in leaves, and after the treatment of nitrate nitrogen and the treatment of nitrate nitrogen-ammonium nitrogen, the expression level of the FaNRT1.1 gene is greatly increased. In addition, after 1h of treatment under different nitrogen forms of hydroponics (fig. 6B), the expression level of the fanrt1.1 gene was significantly increased and the degree of increase was similar after treatment with both nitrate nitrogen and nitrate nitrogen-ammonium nitrogen. From this, it is known that the FaNRT1.1 gene responds to nitrate and nitrate-containing nitrogen morphology treatments.

After the strawberry tissue culture seedlings are treated by nitrate nitrogen with different concentrations, the expression condition of the FaNRT1.1 gene is shown in figure 7. FaNRT1.1 gene expression decreased after 7 days of starvation culture. Then, with the nitrate supply of different HN and LN being restored, the expression of the gene has a process of ascending and descending within 48h, and reaches the expression peak of the FaNRT1.1 gene at 1h and 3h respectively.

On the basis of the finding that FaNRT1.1 responds to nitrate in response to different nitrogen morphologies, nitrate nitrogen and a control long-term treatment were taken for further study. As shown in fig. 8, the relative expression level of the fanrt1.1 gene in the radicle, mature root, cotyledon, mature leaf, flower and fruit (mature fruit) after nitrate nitrogen treatment was all significantly or very significantly higher than that of the control treatment. Especially in the blades, the rise is most pronounced. Relative to the control treatment, the relative expression level of FaNRT1.1 gene in young leaves after nitrate nitrogen treatment increased by 1.48 times, and the gene expression level in mature leaves increased by 6.64 times. Secondly, the relative expression level of the fanrtt 1.1 gene also increased significantly in flowers and fruits, by 1-fold and 0.59-fold respectively. The relative expression of the fanrt1.1 gene increased only to a significant level in roots, only 14% and 12% in young and mature roots, respectively.

Selecting small strawberry seedlings with more hydroponic roots after water culture of strawberry stolons for 2 weeks, firstly treating the small strawberry seedlings for 48 hours by using a nitrogen-free nutrient solution, then respectively treating the water culture seedlings of the strawberries by using 4 different forms of nitrogen, selecting the water culture roots of the strawberries treated by various nitrogen for 1 hour, and carrying out FaNRT1.1 response mode analysis on the different forms of nitrogen for 1 hour.

Transplanting red-color strawberry seedling grown under normal tissue culture condition onto nitrogen-free culture medium, starving for 7d, and respectively recovering to 0.1mM (LN) and 10mM MO₃ ^-(HN) on the culture medium, taking samples of whole strawberry seedlings under normal culture conditions (Control), starvation 7d (Starvation) and recovery nitrogen for 1h, 3h, 6h, 12h, 24h and 48h respectively, and detecting the short-term expression condition of the FaNRT1.1 gene under different nitrate concentrations.

Because the promoter region has a plurality of hormone response elements, the strawberry is subjected to hormone treatment, and the response mode of the NRT gene of the strawberry to the hormone is explored. Separately spraying Gibberellin (GA) 0.05% to leaves and fruits of strawberry cultivated in greenhouse₃) 0.05% naphthylacetic acid (NAA), 0.1mM abscisic acid (ABA), 0.1mM Salicylic Acid (SA) and 0.1mM methyl jasmonate (MeJA), and spray water was used as a control. And (3) extracting RNA from leaves and fruits after 24h treatment, detecting the expression condition of the NRT gene by fluorescent quantitative PCR, and performing hormone response analysis.

Inoculating strawberry seedling grown on MS culture medium to the medium containing 0.8mM CdCl₂Or 0.05mg/LPbCl₂In the new MS culture medium, the whole strawberry plant is sampled for 6h and 24h respectively, and the heavy metal response analysis of the NRT gene is carried out.

Potted strawberries were subjected to additional abiotic stress. Salt stress treatment was performed by watering semi-dry strawberries potted in 0.3M NaCl using clear water as a control, and after 24h a Salt treated (Salt) sample was taken. Using potted strawberries in a greenhouse at 23-27 ℃ as a control, taking the potted strawberries growing under the condition, respectively placing the potted strawberries under illumination culture at 4 ℃ and 42 ℃ for treatment for 24h, and sampling materials responding to Low Temperature (LT) and high temperature (Heat). Taking potted strawberries with the water content of 0.8g of water per gram of soil, carrying out water shortage treatment (WD) for 144 hours to reduce the water content to 0.15g of water per gram of soil, watering again, carrying out Rehydration (RW) after 24 hours, and respectively sampling WD and RW for drought stress response. The 14h light/10 h dark potted strawberries were treated in the dark for 48h as dark treatment (D), and the recovered light was sampled at 1h and 6h, respectively, as L1 and L6, for photoresponse analysis.

As shown in fig. 9, spraying clear water as Control, ABA, SA and NAA can significantly improve the gene expression of fanrtt 1.1 in leaves; in the fruit, GA is sprayed₃NAA can greatly improve the gene expression of FaNRT1.1, and ABA and SA can greatly reduce the gene expression of FaNRT1.1 when sprayed; the extent of fanrt1.1 response to hormones in the leaves was more pronounced. These results may indicate that FaNRT1.1 gene expression may be affected by ABA, GA₃Induction of hormones SA and NAA.

Separating arabidopsis protoplast, adding plasmid containing fluorescent signal overexpression vector pCAMBIA1302-FaNRT1.1, transfecting with polyethylene glycol (PEG), culturing at 22 deg.C under weak light for about 18h, and taking pictures and analyzing subcellular localization by laser confocal microscope.

The arabidopsis thaliana is infected by agrobacterium containing pCAMBIA1391Z-proFaNRT1.1 vector, the specific infection method refers to 4.1.9.1, an inflorescence infection method is adopted, seeds received after infection are screened by HYG resistance, and positive plants are identified. Extracting DNA, and performing PCR amplification identification by using N11PF and N11PR as primers. And (4) determining a stable transgenic arabidopsis material, carrying out GUS staining, and observing a colored tissue.

In order to verify GUS staining effect, Arabidopsis thaliana was used in a sterile plate, and purified water (Control), 0.05% gibberellin (GA3), 0.05% naphthylacetic acid (NAA), 0.1mM abscisic acid (ABA), 0.1mM Salicylic Acid (SA), 0.1mM methyl jasmonate (MeJA), 0.3M NaCl, 0.8mM Cl₂And 0.05mg/LPbCl₂And (4) spraying, and taking corresponding arabidopsis thaliana after 1d to perform GUS staining, decoloring and microscopic observation to record GUS staining conditions under different treatment conditions.

The localization of fanrt1.1 to the plasma membrane was found using arabidopsis protoplasts for subcellular localization analysis (fig. 11).

Arabidopsis thaliana is infected by agrobacterium inflorescence method containing pCAMBIA1391Z-proFaNRT1.1 vector, positive plants of T2 generation are screened and identified, and histochemical staining is carried out on Arabidopsis thaliana plants. In general, no portion that could be stained by GUS was observed in all tissues of normally grown Arabidopsis (see FIGS. 12A-B); after Arabidopsis thaliana was treated with 0.05% NAA spray for 1D (see FIGS. 12C-D), it was observed that the root system and veins of Arabidopsis thaliana could be stained with GUS. It could be shown that FaNRT1.1 could be expressed under NAA-induced conditions and the expression was highest in roots.

The foregoing is merely a preferred embodiment of the invention, which is intended to be illustrative and not limiting. It will be understood by those skilled in the art that various changes, modifications and equivalents may be made therein without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> agriculture university of Anhui

<120> Hongyan strawberry nitrate transporter gene FaNRT1.1 and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1799

<212> DNA

<213> Fragaria x ananassa

<400> 1

atgactactc tccgggaaac cgaagggaaa acactcccag atgcctggga ctaccagggc 60

cagcctgcag accggtccac caccggcggc tggacttctg ccgccatgat tctaggtgga 120

gaagcatgtg agaggttaac gacgctggga attgcggtga acttggtgac ttatctgacc 180

ggtaccatgc acctgggcaa tgcaacctct gcaaataccg tcaccaactt tctcggcact 240

tcttttatgc tctgcttgct cggcggcttt gtcgccgaca cctttcttgg aaggtacctt 300

accattgcca tctttgccac cgttcaagca actggggcaa caatattgac aatctccacc 360

gtagtaccta gcctccgacc acccaattgc accgccggct ccgactcacc ttgcattcct 420

gcaagcggca agcagctaat ggttctttac ctggcactgt acctcaccgc ccttggcaca 480

ggtggcctta aatcaagcgt ttccggcttc ggctctgacc agtttgatga ctcaaacaaa 540

gtagaaagaa aacaaatgac aaatttcttt aattggttct tcttctttat aagcataggc 600

tcactcgccg ctgtcaccat tcttgtatat atcgaagaca acttgggaag acaatggggg 660

tacggaatct gtgcctgtgc aattgtgtta ggcctcgttg tgttcttgtc cggcacaaga 720

cggtaccgtt tcaagaaact ggcggggagc cctttgacac agtttgcggc ggtgtttgtg 780

gcggcgtgga agaagaggaa cattgatttg ccgtcagacc tgtcgttgct gtataacgtt 840

gatgatggac agaagaagat gcagaagcag aaattgcccc attccaaaca gttccgtttc 900

ttggataagg cagcaatcaa gatcccggaa agtgccagca gcactagaat gatggtaaac 960

aagtggagtt tatcaaccct aactgatgtt gaggaagtca aaatgataat cggaatgcta 1020

ccagtttggg ccaccaccat attgttttgg acagtgtatg ctcaaatgac cacattctca 1080

gtgtcacaag caacctccat ggaccgtaaa attggctcat ttcagatccc acctgcctcc 1140

ctcactgttt tctttgtagg cagcattctt ttgactgtcc cagtttatga tagaatcgta 1200

gtcccagcag caagaaagct actcaaaaac ccccaaggac tgaccccatt gcagaggatt 1260

ggggtcggtc tagtgctctc aatctttgcc atggtggcag cggcactcac agagctgaag 1320

cgcttgaggg ccgcacgatc tcatgggctg acggataatc cgacagccga gatcccgtta 1380

agcgtcttct ggctggtccc tcaatttttc ttagtaggat caggagaggc cttcacttac 1440

attggccaac tcgacttctt tctgagggag tgccctaagg ggatgaagac tatgagcact 1500

ggactgtttt tgagcaccct ttcactaggg tttttcttca gctcagcttt ggtgaccata 1560

gtgcataagg tgactgggga taggaagcca tggcttgcag ataatcttaa tcagggaaag 1620

ctttatgatt tttactggct tttggcaatt ttgagtgctc tgaatctgct gatttacttg 1680

gcctgtgcca agtggtatgt gtacaaggac aagaggcttg ctgaggaggg catagaattg 1740

gaggaagtag agatttgtgc ccattaacgt gttagtcttc cagttgcttg gctagctag 1799

<210> 2

<211> 588

<212> PRT

<213> Fragaria x ananassa

<400> 2

Met Thr Thr Leu Arg Glu Thr Glu Gly Lys Thr Leu Pro Asp Ala Trp

1 5 10 15

Asp Tyr Gln Gly Gln Pro Ala Asp Arg Ser Thr Thr Gly Gly Trp Thr

20 25 30

Ser Ala Ala Met Ile Leu Gly Gly Glu Ala Cys Glu Arg Leu Thr Thr

35 40 45

Leu Gly Ile Ala Val Asn Leu Val Thr Tyr Leu Thr Gly Thr Met His

50 55 60

Leu Gly Asn Ala Thr Ser Ala Asn Thr Val Thr Asn Phe Leu Gly Thr

65 70 75 80

Ser Phe Met Leu Cys Leu Leu Gly Gly Phe Val Ala Asp Thr Phe Leu

85 90 95

Gly Arg Tyr Leu Thr Ile Ala Ile Phe Ala Thr Val Gln Ala Thr Gly

100 105 110

Ala Thr Ile Leu Thr Ile Ser Thr Val Val Pro Ser Leu Arg Pro Pro

115 120 125

Asn Cys Thr Ala Gly Ser Asp Ser Pro Cys Ile Pro Ala Ser Gly Lys

130 135 140

Gln Leu Met Val Leu Tyr Leu Ala Leu Tyr Leu Thr Ala Leu Gly Thr

145 150 155 160

Gly Gly Leu Lys Ser Ser Val Ser Gly Phe Gly Ser Asp Gln Phe Asp

165 170 175

Asp Ser Asn Lys Val Glu Arg Lys Gln Met Thr Asn Phe Phe Asn Trp

180 185 190

Phe Phe Phe Phe Ile Ser Ile Gly Ser Leu Ala Ala Val Thr Ile Leu

195 200 205

Val Tyr Ile Glu Asp Asn Leu Gly Arg Gln Trp Gly Tyr Gly Ile Cys

210 215 220

Ala Cys Ala Ile Val Leu Gly Leu Val Val Phe Leu Ser Gly Thr Arg

225 230 235 240

Arg Tyr Arg Phe Lys Lys Leu Ala Gly Ser Pro Leu Thr Gln Phe Ala

245 250 255

Ala Val Phe Val Ala Ala Trp Lys Lys Arg Asn Ile Asp Leu Pro Ser

260 265 270

Asp Leu Ser Leu Leu Tyr Asn Val Asp Asp Gly Gln Lys Lys Met Gln

275 280 285

Lys Gln Lys Leu Pro His Ser Lys Gln Phe Arg Phe Leu Asp Lys Ala

290 295 300

Ala Ile Lys Ile Pro Glu Ser Ala Ser Ser Thr Arg Met Met Val Asn

305 310 315 320

Lys Trp Ser Leu Ser Thr Leu Thr Asp Val Glu Glu Val Lys Met Ile

325 330 335

Ile Gly Met Leu Pro Val Trp Ala Thr Thr Ile Leu Phe Trp Thr Val

340 345 350

Tyr Ala Gln Met Thr Thr Phe Ser Val Ser Gln Ala Thr Ser Met Asp

355 360 365

Arg Lys Ile Gly Ser Phe Gln Ile Pro Pro Ala Ser Leu Thr Val Phe

370 375 380

Phe Val Gly Ser Ile Leu Leu Thr Val Pro Val Tyr Asp Arg Ile Val

385 390 395 400

Val Pro Ala Ala Arg Lys Leu Leu Lys Asn Pro Gln Gly Leu Thr Pro

405 410 415

Leu Gln Arg Ile Gly Val Gly Leu Val Leu Ser Ile Phe Ala Met Val

420 425 430

Ala Ala Ala Leu Thr Glu Leu Lys Arg Leu Arg Ala Ala Arg Ser His

435 440 445

Gly Leu Thr Asp Asn Pro Thr Ala Glu Ile Pro Leu Ser Val Phe Trp

450 455 460

Leu Val Pro Gln Phe Phe Leu Val Gly Ser Gly Glu Ala Phe Thr Tyr

465 470 475 480

Ile Gly Gln Leu Asp Phe Phe Leu Arg Glu Cys Pro Lys Gly Met Lys

485 490 495

Thr Met Ser Thr Gly Leu Phe Leu Ser Thr Leu Ser Leu Gly Phe Phe

500 505 510

Phe Ser Ser Ala Leu Val Thr Ile Val His Lys Val Thr Gly Asp Arg

515 520 525

Lys Pro Trp Leu Ala Asp Asn Leu Asn Gln Gly Lys Leu Tyr Asp Phe

530 535 540

Tyr Trp Leu Leu Ala Ile Leu Ser Ala Leu Asn Leu Leu Ile Tyr Leu

545 550 555 560

Ala Cys Ala Lys Trp Tyr Val Tyr Lys Asp Lys Arg Leu Ala Glu Glu

565 570 575

Gly Ile Glu Leu Glu Glu Val Glu Ile Cys Ala His

580 585

Claims

1. The strawberry nitrate transporter gene FaNRT1.1 is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.

2. The product encoded by the strawberry nitrate transporter gene FaNRT1.1, according to claim 1, wherein the amino acid sequence of the encoded product is shown in SEQ ID No. 2.

3. The application of the strawberry nitrate transporter gene FaNRT1.1 for the skin color of claim 1, which is characterized in that the application of the gene FaNRT1.1 in screening germplasm materials, cultivating high-quality varieties and coping with abiotic stress is realized through different response modes of the gene FaNRT1.1.