CN114524869B - Toxoplasma microwire protein MIC17a and application thereof - Google Patents

Abstract

The invention discloses toxoplasma microwire protein MIC17a and application thereof, wherein the amino acid sequence of the toxoplasma microwire protein MIC17a is shown as SEQ ID No. 1; the nucleotide sequence of the gene MIC17a for encoding toxoplasma microwire protein is shown as SEQ ID No. 2. The indirect ELISA kit prepared from the protein has the characteristics of high sensitivity, strong specificity, good accuracy and the like in detection of toxoplasmosis in cats.

Description

Toxoplasma microwire protein MIC17a and application thereof

Technical Field

The invention relates to the field of toxoplasmosis detection, in particular to toxoplasmosis microwire body protein MIC17a and application thereof.

Background

Toxoplasma is a zoonotic parasitic protozoa widely distributed worldwide and can cause diseases of people and various animals. It is estimated that about 1/3 of the world's population infects toxoplasma. Infection of toxoplasma by pregnant women or pregnant animals can cause fetal malformation, abortion, miscarriage, etc. Toxoplasmosis can also cause eye diseases, heart diseases, neurological symptoms, malnutrition of the organism, reduced immunity and the like. Cats are the final host of toxoplasma, and oocysts are expelled after infection, and develop into infectious oocysts in the environment for 2-7 days, which is the main transmission route of toxoplasma. Modern people raise cats as pets more and more, so that the probability of people infecting toxoplasma is increased. In addition, the data show that the average flock infection rate is about 10%, the highest infection rate of pigs is generally more than 20%, and some farms are even up to 100%. Studies have shown that the toxoplasma infection rate of farm animals is related to the number of surrounding cats. Therefore, the establishment of the detection method for the toxoplasmosis of the cat is of great significance.

The current detection method for the toxoplasmosis of the cats at home and abroad comprises three methods of etiology detection, molecular biological detection and serology detection:

1. the etiology detection is to detect the oocysts from the feces of the cat, but the method is accurate and reliable, is time-consuming and labor-consuming, has low detection rate and is not suitable for large-scale detection, and meanwhile, has higher biosafety risk due to the zoonotic characteristics of toxoplasma and the high infectivity of the oocysts.

2. The molecular biological method is mainly used for detecting specific nucleic acid fragments of toxoplasmosis in disease materials and is an important means for diagnosing toxoplasmosis in a laboratory. However, since there are few pathogens in blood and body fluid samples and the treatment of fecal samples has a high biosafety risk, this method is not very practical for developing a cat's biopsy in a clinic or the like.

3. Serological methods are used for detecting toxoplasma antibodies or antigens by immunological reactions, and are mainly classified into LAT (latex agglutination test), IHA (indirect hemagglutination test), IFA (indirect immunofluorescence test), ELISA (enzyme-linked immunosorbent test) and the like. The ELISA method has strong sensitivity, high specificity, easy realization of automatic operation, rapidness, simplicity and convenience, no special requirement on operators, capability of processing a large number of samples in a short time, suitability for field investigation and popularization, and wide attention. However, since toxoplasma infects different animals (especially the final host cat and various intermediate hosts) with differences in gene expression, the choice of diagnostic antigen is critical to the accuracy of the assay. The currently reported and used diagnostic methods and kits are multipurpose SAG1 and other antigens which are highly expressed in the tachyzoite stage (the form of toxoplasma in an intermediate host), while cats are the final hosts of toxoplasma, and the gene expression after infection is quite different from that of human, pig, sheep and other intermediate hosts, so that SAG1 and other antigens which are highly expressed in the tachyzoite stage are not necessarily ideal or not as diagnostic antigens of toxoplasmosis in cats. The present invention solves this technical problem.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a toxoplasma microwire protein MIC17a and application thereof, wherein the toxoplasma microwire protein MIC17a is a protein with high expression level in the merozoite period in the sexual reproduction stage of toxoplasma, and the sexual reproduction stage of toxoplasma is only carried out in a cat body, so that the protein MIC17a has good specificity and is suitable for diagnosing toxoplasmosis of the cat; the kit for preparing the indirect enzyme-linked immunosorbent assay for detecting the toxoplasma catenulatus IgG antibody by using the protein MIC17a has the characteristics of strong specificity, high sensitivity and good accuracy.

In order to achieve the aim, the invention designs the toxoplasma microwire body protein MIC17a, and the amino acid sequence of the toxoplasma microwire body protein MIC17a is shown as SEQ ID No. 1.

The nucleotide sequence of the gene MIC17a for encoding the toxoplasma gondii microwire body protein MIC17a is shown as SEQ ID No. 2.

The invention also provides application of the toxoplasmosis microwire body protein MIC17a in immunodetection of toxoplasmosis in cats.

The invention also provides application of the toxoplasma microwire protein MIC17a in preparing an indirect enzyme-linked immunosorbent assay kit for detecting the toxoplasma felis specific IgG antibody.

The invention also provides an indirect ELISA kit for detecting the toxoplasma cat specific IgG antibody, which comprises an ELISA plate coated with the toxoplasma cat microwire body protein MIC17a, a concentrated washing solution, a positive control, a negative control, a diluent, a concentrated ELISA antibody, a chromogenic solution and a stop solution.

Further, in the kit, the following components are prepared:

the positive control is the positive serum of toxoplasma cat,

the negative control is toxoplasma cat negative serum,

the concentrated enzyme-labeled antibody is HRP sheep anti-cat IgG;

concentrating the washing liquid: adding 0.5mL of Tween-20 into 1000mL of PBS buffer solution, uniformly mixing, and preserving at 4 ℃;

sealing liquid: 0.1g of bovine serum albumin is dissolved in 100mL of washing solution;

dilution liquid: 0.1g of bovine serum albumin is dissolved in 100mL of washing solution;

substrate buffer: 24.3mL of 0.1mol/L citric acid, 25.7mL of 0.2mol/L sodium dihydrogen phosphate, and ddH ₂ O was constant to 50mL.

Color development liquid: the TMB mother liquor and the substrate buffer solution are mixed according to the proportion of 1:19,0.2 mu L of 30% hydrogen peroxide is added into each milliliter of substrate color development solution, and the preparation process needs to be carried out in an existing mode, and the preparation process is carried out in a dark place.

Stop solution: 625. Mu.L of 40% hydrofluoric acid in 100mL ddH ₂ O.

The invention also provides a method for detecting the specific IgG antibody of toxoplasma catenulatum by using the kit, which comprises the following steps:

1) Adding 98 mu L of diluent into a plurality of holes of the ELISA plate, and then adding 2 mu L of sample to be detected, positive control and negative control into corresponding holes respectively; incubating;

2) Removing the liquid in the holes, adding 300 mu L of washing liquid to wash the plate, and repeating for a plurality of times;

3) Adding 100 mu L of enzyme-labeled antibody into the hole, and incubating;

4) Removing the liquid in the holes, adding 300 mu L of washing liquid to wash the plate, and repeating for a plurality of times;

5) Adding 100 mu L of color development solution to the hole, and incubating; add 50. Mu.L of stop solution to the wells to stop the reaction;

6) The absorbance was read and recorded at a wavelength of 630nm,

if the OD of the sample S to be measured _{630 value} OD of negative control N _{630 value} Judging positive if the value is more than or equal to 2.55; otherwise, the result is negative.

The invention has the beneficial effects that:

1. the kit has high sensitivity: the result shows that the sensitivity of the detection method of the MIC17a-iELISA kit disclosed by the invention is greater than 1:200, meets the requirement of field detection.

2. The kit has good specificity: the detection method of the kit does not cross react with cat plague, cat coccidium and the like.

3. The kit of the invention is rapid and simple: the automatic operation is easy to realize, no special requirement is required for operators, and a large number of samples can be processed in a short time.

4. The detection result of the kit is simple: the catfish positive/negative can be qualitatively judged directly according to the reading size (ratio).

Drawings

FIG. 1 shows the result of PCR amplification of the coding sequence of toxoplasma MIC17a,

in the figure: lane M, DNA molecular mass standard; MIC17a coding sequence amplification product.

FIG. 2 shows the PCR amplification result of pET28a,

in the figure: lane M, DNA molecular mass standard; 1pET28a vector amplification product.

FIG. 3 shows the identification result of recombinant plasmid pET28a-MIC17a,

in the figure: lane M, protein standard; plasmid cleavage products pET28a-MIC17 a.

FIG. 4 shows the result of SDS-PAGE analysis of pET28a-MIC17a expression products,

in the figure: lane M: protein molecular mass standard; 1: non-induced His-MIC17a;2: his-MIC17a was induced.

FIG. 5 shows the SDS-PAGE purification of pET28a-MIC17a expression product,

in the figure: lane M: protein molecular mass standard; 1: purifying His-MIC17a.

Detailed Description

The present invention is described in further detail below in conjunction with specific embodiments for understanding by those skilled in the art.

EXAMPLE 1 preparation of the microwire body protein MIC17a

Extracting Totala RNA of Toxoplasma gondii, obtaining cDNA by using a reverse transcription kit of Takara company, amplifying a target fragment by a PCR method according to a primer related to the design of the target fragment, connecting a MIC17a-CDS fragment to a pET28a carrier by a homologous recombination method, and transferring the constructed pET28a-MIC17a plasmid to escherichia coli BL21 (DE 3) for expression after PCR identification and sequencing verification, wherein the method comprises the following specific steps:

obtaining of the MIC17 fragment of interest

(1) Extraction of Total RNA of Toxoplasma gondii

Centrifuging the collected insects, discarding the supernatant, adding 1mL of Trizol to carry out heavy suspension precipitation, repeatedly blowing and uniformly mixing, transferring the sample into a 1.5mL RNase-free centrifuge tube, vigorously shaking and vortexing for 3min to enable the insects to be fully cracked, and standing for 10min at room temperature; adding chloroform according to 200 mu L chloroform/mL Trizol, shaking for 15sec with force, and standing at room temperature for 2-3 min; centrifuging at 12000rpm at 4deg.C for 15min; carefully sucking the upper water phase, placing the upper water phase into a new 1.5mL RNase-free centrifuge tube, adding equal volume of isopropanol, fully mixing, and placing the mixture at room temperature for precipitation for 10min; centrifuging at 12000rpm for 10min at 4deg.C, discarding supernatant, and precipitating RNA at the bottom of the tube in the form of white precipitate; adding 1mL of 75% ethanol prepared by DEPC water, turning over a centrifuge tube, and washing precipitate; centrifuging at 7500rpm for 5min at 4deg.C, discarding supernatant, and air drying in an ultra clean bench; adding 30 mu L of RNase-free DEPC water to dissolve RNA precipitate; the quality of the extracted Total RNA was identified by 1.5% agarose gel electrophoresis and Total RNA concentration and purity were determined by UV spectrophotometry.

(2) Preparation of Toxoplasma gondii cDNA

1. Mu.g of Total RNA was taken and passed through a Takara reverse transcription kit to obtain cDNA, and the following reagents were added in order:

step 1: removing gDNA:

reacting in a PCR instrument at 42 ℃ for 2min, and cooling on ice at room temperature for 30min;

step 2: reverse transcription into cDNA:

the reaction was carried out in a PCR apparatus at 37℃for 60min at 85℃for 5sec and the product was stored at-20 ℃.

2. Construction of recombinant plasmid pET28a-MIC17a

(1) Primer pairs were designed using the clonmanager software based on the sequence of the commercial PET28a plasmid and the nucleotide sequence of gene MIC17a as shown in SEQ ID No. 2: MIC17a-F: AGCAAATGGGTCGCGGATCCGGGCTCCGGAGACAGCTAGTC, MIC17a-R: TCCTTTCGGGCTTTGTTTTAGCATGTGATATCGCCTGCTT;

using the cDNA obtained by reverse transcription as a template for amplifying a target gene coding sequence, and amplifying by PCR to obtain a target fragment containing an enzyme cutting site; the target fragment contains a gene MIC17a shown as SEQ ID No.2, encodes toxoplasma gondii microwire body protein MIC17a, and has an amino acid sequence shown as SEQ ID No. 1.

(2) Amplification of PET28a vector fragment

The upstream primer PET28a-F and the downstream primer PET28a-R of the PET28a vector were amplified using the clonmanager software design, based on the sequence of the commercial PET28a plasmid. The PCR amplification gave a 5369bp band, consistent with the expectations, using the PET28a plasmid as template, and the results were shown in FIG. 2, and the fragment was recovered using a gel recovery kit.

The PCR reaction system is as follows:

the PCR conditions were as follows:

(3) Recovery of fragments of interest

Operating according to the description of an Omiga DNA agarose gel recovery kit, performing gel cutting recovery on a target fragment of a single strip, and placing the target fragment into a 1.5mL centrifuge tube; adding an equal volume of sol liquid, performing water bath at 60 ℃ for 10min, and uniformly mixing the centrifuge tubes reversely every 2min to fully melt the gel; cooling the melted gel liquid to room temperature, adding the cooled gel liquid into a DNA recovery column, and standing at room temperature for 1min; centrifuging at 10000 Xg at room temperature for 1min, and discarding the effluent in the collecting pipe; adding 300 mu L of binding buffer into a recovery column, centrifuging for 1min at 13000 Xg at room temperature, and discarding the effluent in a collecting pipe; 700 mu L SPW wash buffer was added to the recovery column, allowed to stand at room temperature for 1min, centrifuged at 13000 Xg at room temperature for 1min, and the effluent from the collection tube was discarded. Centrifuging 13000 Xg of the empty recovery column for 2min, discarding the residual effluent in the collecting pipe, placing the recovery column in a new 1.5mL centrifuge tube, and drying at room temperature to volatilize the residual ethanol; adding 10-30 mu L of sterilized water preheated at 65 ℃ to an intermediate membrane of a recovery column, standing for 2min at room temperature, centrifuging for 2min at 13000g at room temperature, and collecting effluent liquid to obtain MIC17a-CDS fragments and PET28a carrier fragments respectively; preserving at-20 ℃.

(4) Construction of pET28a-MIC17a plasmid

The MIC17a-CDS fragment and PET28a vector fragment were ligated by homologous recombination, the ligation product was transferred into competent cells dh5α of escherichia coli by heat shock, the transformation product was plated on LB plates with kana resistance, grown upside down overnight, single colonies were picked up, and PCR identified, and the results were consistent with expectations, as shown in fig. 3. Extracting plasmids after the amplification culture, and carrying out sequencing verification. Comparing the sequencing result with CDS of MIC17a gene in database, wherein the sequencing result and CDS can be completely matched, and no frame shift or mutation base appears, and the result proves that the recombinant expression plasmid PET28a-MIC17a is successfully constructed;

a. construction of plasmid by homologous recombination

The procedure was as described for the Northenan multi-fragment cloning kit, according to the system configuration in the description:

mixing the above liquids, reacting at 37deg.C in PCR instrument for 30min, ice-bathing for 5min, and converting.

Optimal amount per fragment= [0.02×base pair number of fragments ] ng (0.03 pmol).

b. Ligation product conversion

Taking chemically competent cells of escherichia coli stored at-80 ℃, and melting on ice; adding the ligation product (or plasmid), mixing, and standing on ice for 30min; heat shock is carried out for 95sec in a water bath at 42 ℃, and the water is taken out rapidly and is subjected to ice bath for 2min;

400 mu L of LB liquid medium without antibiotics is added, and resuscitated culture is carried out for 60min at 180rpm at 37 ℃; 300 mu L of the culture medium is coated on a corresponding LB plate, and the culture medium is inverted and cultured for 10 to 12 hours at 37 ℃.

3. Expression and purification of the microwire body protein MIC17a

The prokaryotic expression plasmid PET28a-MIC17a successfully constructed is transformed into an escherichia coli expression competent strain BL21 (DE 3), the transformed bacterial liquid is coated on an LB plate with kana resistance, the bacterial liquid is cultured overnight at 37 ℃, single bacterial colonies are picked up, the bacterial colony is amplified and cultured, the induction expression is carried out under the conditions that the culture temperature is 37 ℃ and the shaking speed is 180rpm and the induction time is 4 hours by using IPTG with the final concentration of 1.0mM, and an uninduced control group is arranged. The induced and uninduced bacterial solutions after the end of induced expression were collected, the supernatant was discarded, and after sample treatment (precipitation was resuspended in 40. Mu.L of PBS, 50. Mu.L of loading buffer and 10. Mu.L of DTT were added, and boiled in water for 10 min), SDS-PAGE analysis was performed, and the results are shown in FIG. 4. As a result, it was found that the inducible group had a thicker protein band at 35.3kDa compared to the uninduced group, indicating that recombinant plasmid PET28a-MIC17a was successfully expressed in competent strain BL21 (DE 3). The PET28a-MIC17 a-expressing bacteria were cultured and induced under the same conditions as described above, and then subjected to pressure disruption (1000 bar disruption 3 times at 4 ℃) and centrifugation at 12000rpm for 10min to separate the supernatant and inclusion bodies, and the supernatant and inclusion body samples were treated, and then subjected to SDS-PAGE analysis, and the results are shown in FIG. 4. The analysis showed that the vast majority of PET28a-MIC17a was expressed in inclusion bodies.

Expanding culture of PET28a-MIC17a expression strain, adding Inducer (IPTG) with final concentration of 1.0mM, inducing at 37deg.C for 4 hr, centrifuging to collect thallus, crushing thallus with pressure crusher, centrifuging at 4deg.C to obtain inclusion body, washing precipitate with PBS for 2-3 times, adding 19.7ml BufferA,19.7 μl DTT and 0.3ml 20% SKL stock solution, shaking vigorously to dissolve slowly, standing at room temperature for 30in-1 hr (or overnight at 4deg.C). The supernatant was centrifuged at 12000r at 4 ℃. 210. Mu.L of 20% PEG4000 was added to a final concentration of 0.2% and 420. Mu.L of 50mm oxidized glutathione was added to a final concentration of 1mm. mu.L of 100mm reduced glutathione was added to a final concentration of 2mm and allowed to stand for 30min-2h (or overnight at 4 ℃). PBS 3L was dialyzed for 72h and magnetically stirred at 4 ℃. After dialysis (once every 6h for 24h, once every 12h for 24 h), the supernatant was filtered with a 0.45um filter, then bound to his-tagged affinity column for 1h, proteins were eluted with different concentrations of imidazole from low to high, and the eluted proteins were analyzed by SDS-PAGE, as shown in FIG. 5. And then dialyzing and concentrating the protein with better purity, and determining the protein concentration by using the Biyun Tian BCA protein concentration determination kit to obtain the protein MIC17a.

Example 2 establishment of detection conditions for an indirect enzyme-linked immunosorbent assay kit for detecting toxoplasma catenulatus specific IgG antibodies:

1. determination of antigen coating concentration and serum dilution:

MIC17a protein was diluted in a gradient of 8. Mu.g/mL, 4. Mu.g/mL, 2. Mu.g/mL, 1. Mu.g/mL, 0.5. Mu.g/mL, 0.25. Mu.g/mL, respectively, to coat the ELISA plates, each concentration coated with a column of 6 wells. The negative and positive control sera were diluted with incubation solutions at 1:25, 1:50, 1:100, 1:200, 1:400, 1:800, respectively, with each dilution added to a row of 6 wells. The ELISA was performed according to the conventional procedure, and the OD was measured by using an ELISA reader ₆₃₀ The value, compare the magnitude of P/N value that every antigen corresponds to, choose the antigen coating concentration and serum dilution multiple that the P/N value of the optimal antigen is the biggest among them as the optimal condition;

the results showed an optimal antigen coating concentration of 1. Mu.g/mL and an optimal serum dilution of 1:50.

2. Optimization of optimal blocking concentration and optimal blocking time:

and optimizing the blocking concentration and the blocking time according to the optimal conditions of the optimized antigen coating concentration and the optimal serum dilution. Fixing other test conditions, sealing with 0.05%, 0.1%, 0.5%, 1%, 2% BSA (bovine serum albumin) for 20min, 30min, 45min, 60min, 75min, performing ELISA conventional steps, reading with enzyme-labeled instrument, and drawing into broken lineGraph, comparative OD ₆₃₀ The size of the P/N (positive serum/negative serum) value is selected, and the blocking concentration and the blocking time corresponding to the maximum P/N value are selected as the optimal conditions.

The results showed an optimal blocking concentration of 0.1% BSA and an optimal blocking time of 45min.

3. Optimization of serum optimal action time:

according to the determined conditions, fixing other test conditions, adding serum, and then respectively acting for 20min, 30min, 45min, 60min and 75min, operating according to ELISA conventional steps, and selecting serum acting time according to the P/N value.

The results showed an optimal serum action time of 60min.

4. Optimization of secondary antibody optimal action concentration and time:

fixing other test conditions according to the determined conditions, and respectively fixing the enzyme-labeled secondary antibodies according to the following ratio of 1:500, 1:1000, 1:2000 and 1: 3000. dilution in the ratio of 1:4000, 1:5000 and 1:6000, and the secondary antibody action concentration is selected according to the P/N value according to the conventional ELISA procedure. And similarly, fixing other test conditions, adding enzyme-labeled secondary antibodies, then respectively acting for 20min, 30min, 45min, 60min and 75min, operating according to ELISA conventional steps, and selecting the acting time of the secondary antibodies according to the P/N value.

The results show that the optimal secondary antibody action concentration is 1:3000, and the optimal secondary antibody action time is 60min.

5. Optimizing the optimal action time of the substrate, fixing other test conditions, respectively enabling the substrate to act for 5min, 10min, 15min and 20min, operating according to ELISA conventional steps, and selecting the action time of the substrate according to the P/N value.

The results showed an optimal substrate action time of 45min.

Example 3 an indirect enzyme-linked immunosorbent assay kit for detecting toxoplasma catenulatus specific IgG antibodies and a detection method thereof were obtained based on the above conditions:

1. the indirect enzyme-linked immunosorbent assay kit comprises: an ELISA plate coated with toxoplasma microwire protein MIC17a prepared in example 1 above, concentrated washing solution (20×), positive control (Toxoplasma catnip positive serum), negative control (Toxoplasma catnip negative serum), dilution, concentrated ELISA antibody (HRP sheep anti-cat IgG) (10×), color development solution and stop solution; wherein, the liquid crystal display device comprises a liquid crystal display device,

washing solution (PBST): adding 0.5mL of Tween-20 into 1000mL of PBS buffer solution, uniformly mixing, and preserving at 4 ℃;

sealing liquid: 0.1g Bovine Serum Albumin (BSA) was dissolved in 100mL of the washing solution;

dilution liquid: 0.1g Bovine Serum Albumin (BSA) was dissolved in 100mL of the washing solution;

substrate buffer (ph=5.0 citrate buffer): 24.3mL of 0.1mol/L citric acid, 25.7mL of 0.2mol/L sodium dihydrogen phosphate (NaH 2PO 4), and ddH2O was used to fix the volume to 50mL.

Color development liquid: the TMB mother liquor and the substrate buffer solution are mixed according to the proportion of 1:19, and 0.2 mu L of 30 percent hydrogen peroxide (H) is added into each milliliter of substrate chromogenic solution ₂ O ₂ ) It must be prepared at present, and the preparation process should be protected from light.

Stop solution (0.25% HF solution): 625. Mu.L of 40% hydrofluoric acid in 100mL ddH ₂ O.

The above kit uses PBS buffer solution, coating solution, substrate buffer solution and TMB mother solution as conventional solvents, and the conditions used in this example are as follows:

PBS buffer (pH 7.4): 8.0g NaCl,0.201g KCl,3.63gNa ₂ HPO ₄ ·12H ₂ O，0.24g KH ₂ PO ₄ Dissolve in 1000ml of ddH2O;

substrate buffer (pH 5.0): 36.89g Na ₂ HPO ₄ ·12H ₂ O and 10.19g of citric acid in 500mL ddH ₂ O；

0.2% TMB mother liquor: 0.2g TMB (3, 5-tetramethylbenzidine) was dissolved in 100mL absolute ethanol, and the dissolution process required rapid stirring with a glass rod.

2. Determination of the Critical value of the above-described Indirect ELISA kit

22 cat serum samples which are detected by MAT and are negative to the IgG antibody of toxoplasma cat are detected, meanwhile, standard positive control and negative control are set, and OD is repeatedly detected for a plurality of times ₆₃₀ The value, and finally the critical value judgment standard of the method are determined as follows:

the Cut-off value calculating method comprises the following steps: mean (X) +3 Standard Deviation (SD)

Negative-positive boundary judgment criterion:

S/N is more than or equal to 2.5, and the positive result is judged; otherwise, the negative result is negative.

The results are shown in Table 1.

TABLE 1 determination of critical points

The detailed operation steps are as follows:

the MIC17a protein was diluted with carbonate coating buffer (pH 9.6) to a final concentration of 1. Mu.g/mL, and the ELISA plate was coated overnight at 4 ℃. Each well was washed 3 times with 200ul PBS-T (0.01 mol/L PBS,0.05% Tween-20, pH 7.4) wash buffer, blocked with 0.1% BSA (bovine serum albumin) formulated at 37℃for 45min. Cat serum was diluted 1:50 with 0.1% BSA and 100uL per well was added, 3 replicates per sample, and incubated for 1h at 37 ℃. Then washed 3 times with PBS-T (0.01 mol/L PBS,0.05% Tween-20, pH 7.4) and HRP-labeled rabbit anti-sheep IgG diluted 1:3000 was added at 100 ul/well and incubated for 1h at 37 ℃. 100uL of color development solution (substrate buffer: TMB mother liquor=1:19, 0.2uL/mL 30% hydrogen peroxide) was added to each well and developed at 37℃in the absence of light for 10min. Finally, 50uL of 0.25% hydrofluoric acid is added to each hole to stop the reaction, and the reaction is read at the wavelength of 630 nm; if sample S (sample OD _{630 value} ) N (negative serum OD) _{630 value} ) Judging positive if the value is more than or equal to 2.55; otherwise, the result is negative.

3. The detection method of the indirect ELISA kit comprises the following steps:

(1) Adding 98 mu L of diluent into a plurality of holes on an ELISA plate, and then adding 2 mu L of sample to be tested, positive control and negative control into corresponding holes respectively; incubation at 37℃for 1h

(2) The liquid in the wells was discarded, and the plate was washed 3 times with 300. Mu.L of washing liquid (1X) for 3min each time; and the plate washing interval should avoid micropore drying;

(3) Diluting the concentrated enzyme-labeled antibody (10×) 10 times to enzyme-labeled antibody (1×) using the diluent;

(4) 100 μl of enzyme-labeled antibody (1×) was added to each well; incubating for 1h at 37 ℃;

(5) The well liquid was discarded, and the plate was washed 3 times with 300. Mu.L of wash solution (1X) for 3min each.

And the plate washing interval should avoid micropore drying;

(6) Adding 100 mu L of color development liquid into each hole, and incubating for 15min at 37 ℃; add 50. Mu.L of stop solution per well to stop the reaction;

(7) Reading and recording absorbance at a wavelength of 630 nm; if the sample S to be measured (sample OD _{630 value} ) Negative control N (negative serum OD) _{630 value} ) Judging positive if the value is more than or equal to 2.55; otherwise, the result is negative.

Example 4 sensitivity and specificity assays of an indirect ELISA kit for detecting Toxoplasma catnip-specific IgG antibodies

4 positive sera were each 1 according to the method of example 3: 25. 1:50, 1: 100. dilutions 1:200, 1:400, 1:800, 1:1600 were used for detection, and positive, negative, and blank controls were set. The results are shown in Table 2. The results show that the sensitivity of the MIC17a-iELISA diagnosis method built by the invention is greater than 1:200. the cat coccidiosis positive serum and cat plague positive serum are detected by the established method. The results are shown in Table 3. The result shows that the method has good specificity and does not cross react with cat plague and cat coccidium.

TABLE 2 sensitivity test results

Dilution factor	1:25	1:50	1:100	1:200	1:400	1:800	1:1600
								Serum 1	0.957	0.704	0.531	0.401	0.284	0.141	0.089
Serum 2	0.805	0.679	0.433	0.268	0.185	0.125	0.078
								Serum 3	0.775	0.594	0.465	0.244	0.172	0.12	0.086
Serum 4	0.715	0.56	0.443	0.314	0.169	0.102	0.081

TABLE 3 specificity test results

Category(s)	Cat plague	Cat coccidiosis
			OD 630 Value of	0.168	0.16
With or without cross-reaction	Without any means for	Without any means for

Example 5 detection of clinical samples

106 cat blood samples collected in clinic in a certain pet hospital are detected by using the indirect ELISA kit, and the toxoplasma antibody positive rate in the samples is found to be 25.47 percent (27/106), which indicates that the kit can effectively detect toxoplasma antibodies in the diseased cat serum.

Other parts not described in detail are prior art. Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow.

Sequence listing

<110> university of agriculture in China

<120> toxoplasma microwire protein MIC17a and application thereof

<140> 2022100884914

<141> 2022-01-25

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 318

<212> PRT

<213> Toxoplasma gondii (Toxoplasma gondii)

<400> 1

Gly Leu Arg Arg Gln Leu Val Asn Ala His Ser Phe Ala Glu Val Glu

1 5 10 15

Thr Thr Gly Tyr Ser Cys Phe Glu Lys Gly Lys Glu Tyr Val Gly Phe

20 25 30

Ser Leu Thr Glu Phe Pro Lys Val Ser Asp Val Ala Leu Cys Gln Gln

35 40 45

Arg Cys Asn Gln His Pro Gln Cys Gly Phe Phe Thr Phe Tyr Ser Asn

50 55 60

Glu Asn Arg Cys Val Leu Gln Ser Arg Lys Pro Ser Gln Glu Lys Asn

65 70 75 80

Asn Ala Asn Ala Val Ser Gly Pro Lys Arg Cys Pro Leu Cys Leu Val

85 90 95

Asp Asn Tyr Asp Phe Arg Gly Glu Thr Asn Met His Gln Lys Gly Ala

100 105 110

Pro Gly Leu Asn Thr Leu Leu Ala Cys Gln Gln Gly Cys Ala Ala Glu

115 120 125

Pro Lys Cys Lys Ala Phe Leu Phe Glu Lys Gly Pro Arg Thr Cys His

130 135 140

Phe Lys Thr Ser Asp Asn Tyr Leu Lys Ser Phe His Pro Asp Thr Ser

145 150 155 160

Tyr Ile Ala Gly Pro Lys Thr Cys Thr Asp Glu His Trp Cys Ile Met

165 170 175

Lys Asp Ile Gly Tyr Lys Gly Lys Asp Ser Lys Ser Thr Lys Ala Asn

180 185 190

Ser Ala Ala Glu Cys Gln Gln Met Cys Leu Asn Asp Glu Arg Cys Asp

195 200 205

Phe Phe Thr Trp Gln Gln Ala Gly Lys His Cys Trp Phe Lys Ala Gly

210 215 220

Ala Ser Thr Ala Ser Thr Lys Tyr Asn Arg Ala Gly Asp Tyr Ser Ala

225 230 235 240

Pro Lys His Cys Gly Leu Pro Thr Thr Cys Val Lys Glu Arg Thr Lys

245 250 255

Tyr Ala Gly Glu Thr Val Ala Thr Phe Pro Lys Ser Glu Val Gly Thr

260 265 270

Phe Glu Ser Cys Gln Met Lys Cys Trp Lys Thr Ser Lys Cys Val Phe

275 280 285

Met His Phe Asn Asn Asp Gly Cys Thr Leu Ser Gly Val Asn Ala Thr

290 295 300

Ala Gln Thr Asp Ala Asn Ser Lys Ala Gly Asp Ile Thr Cys

305 310 315

<210> 2

<211> 954

<212> DNA

<213> Toxoplasma gondii (Toxoplasma gondii)

<400> 2

gggctccgga gacagctagt caacgcccac tctttcgctg aggtggagac gacaggatat 60

agctgctttg aaaaaggcaa ggagtacgtt ggtttcagcc tgactgagtt ccccaaagtg 120

agcgatgttg ctttgtgcca gcagaggtgc aatcaacacc cgcagtgtgg cttcttcaca 180

ttctattcca atgagaaccg atgcgtgctc cagtcccgca agccttctca ggagaagaac 240

aatgccaatg ccgtttctgg cccgaaacgg tgcccgcttt gcctcgttga taactatgat 300

ttcagaggcg agacaaacat gcatcaaaaa ggtgctcccg gtctcaatac actcctggcg 360

tgtcaacagg gatgtgcagc ggagcccaaa tgcaaggcct tcctcttcga gaagggtccc 420

cgcacgtgcc acttcaagac aagtgataac tatttgaaat cgttccatcc ggatacttca 480

tacatcgcag gtccgaaaac gtgtacggat gaacactggt gcatcatgaa ggatattggc 540

tacaagggca aagactcgaa gtcaacaaaa gcaaactcag cggcagagtg ccagcagatg 600

tgcctcaacg atgagaggtg tgactttttc acgtggcaac aggcgggcaa gcattgttgg 660

tttaaggctg gggcgtccac tgcctcaaca aaatacaatc gggctggcga ctattctgcc 720

ccaaaacact gcggcctgcc gaccacatgt gtcaaggagc ggaccaagta cgcgggcgaa 780

accgttgcga cgttccccaa gagcgaggtg gggaccttcg agtcctgcca aatgaagtgc 840

tggaagacca gcaagtgtgt gtttatgcac ttcaacaatg atggctgcac gctctctggg 900

gtcaatgcaa ccgctcaaac tgatgcgaac tccaaagcag gcgatatcac atgc 954

<210> 3

<211> 41

<212> DNA

<213> synthetic sequences (Artificial Sequence)

<400> 3

agcaaatggg tcgcggatcc gggctccgga gacagctagt c 41

<210> 4

<211> 40

<212> DNA

<213> synthetic sequences (Artificial Sequence)

<400> 4

tcctttcggg ctttgtttta gcatgtgata tcgcctgctt 40

Claims (5)

1. The amino acid sequence of toxoplasma microwire body protein MIC17a is shown as SEQ ID No. 1.

2. A gene MIC17a encoding the toxoplasma gondii microwire body protein MIC17a of claim 1, the nucleotide sequence of which is shown in SEQ ID No. 2.

3. Use of toxoplasma gondii microwire body protein MIC17a according to claim 1 for the preparation of an indirect enzyme-linked immunosorbent assay kit for detecting toxoplasma catenulatum specific IgG antibodies.

4. An indirect enzyme-linked immunosorbent assay kit for detecting toxoplasma felis specific IgG antibodies, which is characterized in that: the kit comprises an ELISA plate coated with the toxoplasma microwire protein MIC17a of claim 1, a concentrated washing solution, a positive control, a negative control, a diluent, a concentrated ELISA antibody, a chromogenic solution and a stop solution.

5. The indirect enzyme linked immunosorbent assay kit according to claim 4, wherein: in the kit, the following components are prepared from the following formula:

the positive control is the positive serum of toxoplasma cat,

the negative control is toxoplasma cat negative serum,

the concentrated enzyme-labeled antibody is HRP sheep anti-cat IgG;

concentrating the washing liquid: adding 0.5mL of Tween-20 into 1000mL of PBS buffer solution, uniformly mixing, and preserving at 4 ℃;

sealing liquid: 0.1g of bovine serum albumin is dissolved in 100mL of washing solution;

dilution liquid: 0.1g of bovine serum albumin is dissolved in 100mL of washing solution;

substrate buffer: 24.3mL of 0.1mol/L citric acid, 25.7mL of 0.2mol/L sodium dihydrogen phosphate, and ddH ₂ O constant volume to 50mL;

color development liquid: mixing TMB mother liquor and substrate buffer solution according to the proportion of 1:19, and adding 0.2 mu L of 30% hydrogen peroxide into each milliliter of substrate color development solution;

stop solution: 625. Mu.L of 40% hydrofluoric acid in 100mL ddH ₂ O.

Images