CN111621506A - Mycoplasma bovis secretory protein Mbovp0145 and application thereof - Google Patents

Abstract

The invention discloses a mycoplasma bovis Mbov _0145 gene encoded protein, wherein the mycoplasma bovis Mbov _0145 gene has a nucleotide sequence shown as SEQ ID NO. 1, the invention also discloses an antibody thereof, and applications of the protein and the antibody in preparation of a mycoplasma bovis detection kit, and belongs to the technical field of prevention and treatment of animal infectious diseases. The protein can generate specific reaction with natural infection of mycoplasma bovis virulent strain M.bovis HB0801 and positive serum of artificially infected cattle, and can identify animals which are infected by wild viruses after vaccine immunization. The compound is expected to be used as a diagnostic reagent for mycoplasma bovis infection, a molecular target for vaccine and drug research and development, and plays an important role in mycoplasma bovis prevention and control.

Description

Mycoplasma bovis secretory protein Mbovp0145 and application thereof

Technical Field

The invention belongs to the technical field of prevention and treatment of animal infectious diseases, and particularly relates to mycoplasma bovis secreted protein MbovP0145, an antibody thereof, and application of the protein and the antibody in preparation of a mycoplasma bovis detection kit.

Background

The mycoplasma bovis is an important pathogen causing bovine respiratory disease syndrome, often outbreaks after transport stress cause bovine pneumonia, mastitis, secondary arthritis, abortion, infertility and other diseases, and is one of important common infectious diseases harming the world cattle industry at present. With the rapid development of domestic and international trade in cattle industry, bovine mycoplasmosis has been a global spread trend. The outbreak of mycoplasma bovis pneumonia of beef cattle is firstly reported in 2008 in China, the morbidity is more than 80%, and the fatality rate is more than 10% and can be as high as 40%. Since then, the beef cattle and dairy cows in a plurality of provinces, cities and regions in China continuously break out mycoplasma bovis pneumonia, which is in a widely prevalent state at present and seriously harms the development of beef cattle and dairy cow industry in China. Because mycoplasma has no cell wall, the congenital drug resistance to penicillin drugs and the increase of the drug resistance of other antibiotics bring serious influence on clinical treatment. And no vaccine is available for effective prevention of bovine mycoplasmosis. Therefore, early diagnosis and early treatment are currently the only reliable control methods.

The current gold standard for diagnosing bovine mycoplasmosis is pathogen isolation, a method that is time and labor consuming and requires the deployment of specialized laboratories and professionals, not suitable for clinical batch, rapid and early detection. In addition, the PCR detection method of the culture still has the problems of high false positive, easy pollution and the like. In combination, the ELISA method is still a diagnostic technique with high sensitivity, strong specificity and capability of detecting a large number of samples in a short time. The key to establishing an excellent ELISA antigen or antibody diagnostic method is to screen an effective mycoplasma bovis diagnostic target. Meanwhile, the target molecule with good immunogenicity is also a candidate target for developing novel vaccines.

The secretory protein is generally a toxin, an adhesin and an enzyme determining virulence of pathogenic bacteria, participates in processes such as bacterial adhesion, invasion, proliferation and inhibition of host defense mechanisms, is an important molecule for communication between bacteria and hosts, and is also an important structure for searching diagnosis, vaccines and drug targets in recent years. The invention discovers that mycoplasma bovis secretes MbovP0145 lipoprotein, which is encoded by Mbov _0145 gene. The recombinant protein rMboov P0145 expressed in Escherichia coli can specifically react with the serum of mycoplasma bovis virulent strain M.bovis HB0801 naturally infected and artificially infected cattle, but does not react with the serum of the cattle infected by the attenuated strain M.bovis HB0801-150. Therefore, the protein is an antigenic protein, is possibly related to virulence, is expected to become a potential target of a novel serological diagnostic reagent, a vaccine and a medicament for the mycoplasma bovis, and has important significance for the prevention and control of the mycoplasma bovis diseases.

Disclosure of Invention

The invention aims to provide an immunogenic secretory protein Mbov P0145 of mycoplasma bovis, which is encoded by an Mbov _0145 gene, is expected to be used as a potential target for diagnosis, vaccines and medicines, and has a good application prospect in the field of mycoplasma bovis prevention and control.

In order to achieve the purpose, the invention adopts the following technical scheme:

the applicant isolated a Mycoplasma bovis HB0801 strain from diseased lung tissue of sick cattle in 6 months of 2008, named as Mycoplasma bovis HB0801 and Mycoplasma bovis HB0801, wherein the strain is a Mycoplasma bovis virulent isolate.

A secretory protein MbovP0145 with unknown function is found from a secretory protein group of mycoplasma bovis HB0801, the protein is coded by an Mbov _0145 gene, the nucleotide sequence is shown in a sequence table SEQ ID NO. 1, and the length is 1446 bp. In order to prove the functions of the Mbov _0145 gene and the protein thereof, the Mbov _0145 gene of mycoplasma bovis HB0801 genome is used as a template, codon modification is carried out according to codon preference of escherichia coli, tryptophan codon UGA in mycoplasma bovis is mutated into tryptophan codon UGG in the escherichia coli, the modified Mbov _0145 gene nucleotide is a sequence shown by 1-1446 base of a sequence table SEQ ID NO:2, the length of the modified Mbov _0145 gene nucleotide is 1446bp, and the modified Mbov _0145 gene nucleotide is sent to a commercial company for artificial synthesis. The amino acid sequence of the Mycoplasma bovis Mbov _0145 gene is shown in the sequence table SEQ ID NO. 3, and total 481 amino acid residues are coded.

The modified Mycoplasma bovis Mbov _0145 gene and a pET-30a plasmid are digested by restriction enzymes xhoI and BamHI and then are connected and recombined, so that the Mbov _0145 gene is cloned into the pET-30a to obtain a recombinant plasmid pET-30a-Mbov _0145, and Escherichia coli DH5 alpha is transformed to obtain a recombinant Escherichia coli strain, and the recombinant protein rMbov P0145 coded by the Mbov _0145 gene is expressed under IPTG induction.

Through detection, the purified rMbovP0145 protein has the secretion characteristic, can induce a mouse to generate an antibody, and can perform specific reaction with serum of a mycoplasma bovis virulent strain M.bovis HB0801 naturally infected and artificially infected cattle, so that the rMbovP0145 protein has good immunogenicity; the indirect ELISA antibody detection method established by the protein has the threshold value of 0.211 for distinguishing the positive and negative samples of the mycoplasma bovis, and the threshold value can identify the animals which are infected by wild viruses after the vaccine immunization. The protein is deduced based on the immunogenicity and the secretion characteristics of the protein and the differential reaction between strong and weak strains infected with bovine serum, is expected to be used as a candidate target of mycoplasma bovis diagnostic reagents, vaccines and medicaments, and plays an important role in the development of mycoplasma bovis prevention and control means.

The invention has the following advantages:

the antigenic protein MbovP0145 of the invention is a novel immunogenic protein screened from a mycoplasma bovis secretory protein group by the inventor, the functions of the gene Mbov _0145 and the protein thereof are unknown at present, and the characteristics, antigenicity and differential expression of the secreted protein in virulent strains are first identified by the inventor.

The mycoplasma bovis antibody detection kit established by using the antigen protein MbovP0145 also has the advantages of high sensitivity, high specificity and the like, and can detect the antibody in a short time after infection.

The more detailed technical scheme is described in the detailed description.

Drawings

FIG. 1: is a rMbov _0145 protein glue map of purified Mycoplasma bovis of the invention. Description of reference numerals: lane M: a molecular weight reference protein; 1 purified Mycoplasma bovis rMbovp P0145 recombinant protein.

FIG. 2: is the rMbovP0145 protein multi-antibody titer determination.

FIG. 3: the Mycoplasma bovis Mbovp0145 protein is secreted and identified in the mycoplasma bovis culture supernatant. Description of reference numerals: lane 1: mycoplasma bovis HB0801 strain secretory protein; lane 2: mycoplasma bovis HB0801 strain holothurin; lane 3: mycoplasma bovis HB0801-150 strain secretory protein; lane 4: mycoplasma bovis HB0801-150 strain holothurin.

FIG. 4: is the rMbovP0145 protein antigenicity test of the invention. Panel A is the reaction of rMbovP0145 with bovine serum positive for Mycoplasma bovis antibody; panel B is the reaction of rMbovP p0145 with mycoplasma bovis antibody negative bovine serum.

FIG. 5: kinetics curves of rMbovP0145-iELISA for post-immunization challenge serum samples.

Detailed Description

Example 1: cloning and expression of Mycoplasma bovis Mbov _0145 gene

1.1 cloning of Mycoplasma bovis Mbov _0145 Gene

Because of the codon preference of E.coli, the codon UGA encoding tryptophan in M.bovis is used as a terminator in E.coli, and thus, when the M.bovis gene is expressed using E.coli, it is necessary to mutate the codon UGA to a codon UGG capable of expressing tryptophan in E.coli.

The applicant isolated a Mycoplasma bovis local isolate from diseased lung tissue of a diseased cow at month 6 of 2008, and named Mycoplasma bovis HB0801(Mycoplasma bovis HB0801), which was disclosed in the patent document of CN 102220263A.

According to the codon preference of Escherichia coli, Mbov _0145 gene in Mycoplasma bovis HB0801 (genome GenBank accession number is CP002058) is subjected to codon modification, synonymous mutation of 11 codons is generated at 558, 606, 756, 831, 906, 1059, 1098, 1134, 1209, 1284 and 1359 positions of the sequence, tryptophan codon UGA in Mycoplasma bovis is mutated into tryptophan codon UGG in Escherichia coli, and finally, the whole gene sequence SEQ ID NO:2 is obtained through artificial synthesis.

Recovering amplification product of Mbov _0145 gene, digesting with BamH I and Xho I, simultaneously digesting pET-30a plasmid (purchased from Merck China, Ltd.) with BamH I and Xho I, ligating the digested Mbov _0145 gene and pET-30a plasmid with DNA ligase (T4 DNOligase) to obtain recombinant plasmid pET-30-Mbov _0145, transforming Escherichia coli DH5 α with the recombinant plasmid pET-30-Mbov _0145, culturing in 37 ℃ shaking table at 180r/min for 12 hours, extracting plasmid, correctly sequencing, transforming Escherichia coli BL21, culturing the Escherichia coli in LB liquid medium until OD is 0.6, taking 1mL of the solution as pre-induction control, simultaneously adding isopropyl thiogalactoside (KCG) to 0.8mM, inducing expression at 37 ℃ for 3 hours, taking 1mL of PBS to remove 1min, removing the final PBS sample, centrifuging to remove Na 2g phosphate buffer (1.8 g/1 g) and removing final NaCl, and adding phosphate buffer (Na 2 g/2 g)₂HPO₄1.44g，KH₂PO₄After resuspension of 0.24g, 1000mL of distilled water at pH 7.6), the supernatant was centrifuged at 12000r/min for 1min and then 30uL of PBS and 30uL of loading buffer (1M Tris-HCl (pH 6.8)1mL, 200mM DDT 0.31g, 4% sds0.4g, 0.2% bromophenol blue 0.02g, 20% glycerol 2mL, 7mL ultrapure water) were added for resuspension. Boiling in boiling water at 100 deg.C for 10 min. SDS-PAGE gel electrophoresis was used to determine whether expression was observed. After SDS-PAGE gel electrophoresis, most of the recombinant protein rMbovp P0145 with the His tag is determined to be expressed in the supernatant, and the molecular weight is about 55 kDa.

1.2 purification of Mycoplasma bovis Mbovp0145 protein

After the recombinant Escherichia coli BL21 is induced and expressed according to the method, taking 8000r/min of bacterial liquid, centrifuging for 10min, discarding the supernatant, washing once with 500mL PBS, centrifuging for 10min at 8000r/min, and washing once with 500mL PBS again. After discarding the supernatant, 30mL of PBS was added for resuspension, protease inhibitor (from Roche) was added, and the mixture was disrupted using a hydraulic disrupter. After disruption, the cells were centrifuged at 12000r/min for 30min, and 30. mu.L of the supernatant was added to 30. mu.L of the buffer solution and boiled in boiling water for 10min to prepare a supernatant group. A small amount of the precipitate was added to 30. mu.L of PBS and 30. mu.L of the loading buffer and boiled for 10min to prepare a precipitate group.

The rMbovP0145 protein was specifically purified as follows:

(1) 1mL of Ni-NTA metal-chelating His protein purification media packing (from GE) was added to the affinity chromatography column;

(2) add 12mL ddH to affinity column₂Washing with water;

(3) 12mL of binding buffer (20mM Na) was added₃PO₄0.5M NaCl, 20mM imidazole, pH 7.4) equilibration column;

(4) adding protein expression supernatant filtered by a filter with the aperture of 0.45 mu m, and collecting the first few drops of filtered liquid, wherein the number is 1;

(5) adding 50mL binding buffer solution to balance the column, and collecting the first drops of liquid, wherein the serial number is 2;

(6) 50mL of washing buffer (20mM Na) was added₃PO₄0.5M NaCl, 60mM imidazole, pH 7.4) to wash away the contaminating proteins, and collect the first few drops, numbered 3;

(7) add 12mL of elute buffer (20mM Na)₃PO₄0.5M NaCl,1M imidazole, pH 7.4) eluting the target protein, collecting the first few drops, numbered 4;

(8) adding 50 μ L of loading buffer solution into each tube numbered 1-4, and boiling for 10 min;

(9) a10% SDS-PAGE polyacrylamide gel was prepared, the treated samples were added to wells (20. mu.L/well), electrophoresed (80V DC for gel concentration and 120V DC for gel separation), and after electrophoresis was completed, the gel was removed and stained with Coomassie Brilliant blue overnight. Then decolorizing, and determining the purified target protein.

SDS-PAGE showed that the purified protein was about 55kDa in size, as shown in FIG. 1. The amino acid sequence of the protein is shown in a sequence table SEQ ID NO. 3, and total 481 amino acid residues are coded.

Example 2: identification of secretion characteristics of Mycoplasma bovis protein Mbovp0145

2.1 preparation and potency detection of Mycoplasma bovis recombinant protein rMbovP0145 mouse polyclonal antibody

BALB/C mice were immunized with rMbovp0145 protein prepared as described above, and the immunization procedure was as follows:

(1) for the initial immunization, the antigen dose of mycoplasma bovis rMbovp P0145 was 100 μ g/mouse, and 0.2 mL/mouse was injected subcutaneously into the back of the neck with Freund's complete adjuvant at multiple points.

(2) Two weeks later, the second immunization, mycoplasma bovis rMbovp P0145 antigen dose 100 μ g/mouse, with Freund's incomplete adjuvant, subcutaneous multiple injection in the back of the neck, 0.2 mL/mouse.

(3) Four weeks later, a third immunization, 100. mu.g/mouse of Mycoplasma bovis rMbovP0145 antigen, 0.2 mL/mouse by subcutaneous multiple injection into the back of the neck with Freund's incomplete adjuvant.

(4) After 7 days, tail tips are cut to collect blood, serum is separated, and the titer of the blood serum is measured by indirect ELISA, namely, the blood serum of mycoplasma bovis rMboov P0145 protein is coated on a plate, a mouse serum dilution is added to incubate at 37 ℃, after the plate is washed, a goat anti-mouse secondary antibody (purchased from Southern Biotech company) marked by HRP is added to incubate at 37 ℃, after the plate is washed, TMB substrate is added to develop color, and the serum with high titer is selected to be used as a polyclonal antibody.

The results showed that the antibody titer of rMbovp0145 was about 2¹⁴× 100, as shown in fig. 2.

2.2 preparation of Mycoplasma bovis secretory protein and Mbovp0145 secretory characteristics identification

Culturing Mycoplasma bovis HB0801 strain and Mycoplasma bovis (vaccine strain) Mbovhb0801-150.2 (disclosed in the patent literature of CN 102220263A) in PPLO medium (PPLO 10.5g, yeast powder 2.5g, sodium pyruvate 0.5g, ultrapure water to 440mL, sterilizing at 121 ℃ for 20min, adding horse serum 50mL, sterilizing 10 × MEM 5mL, sterile 8 ten thousand units/mL penicillin solution 5mL, sterile 1% phenol red solution 500 μ L) for 18h, centrifuging at 15400g and 4 ℃ for 20min, collecting bacterial pellet, washing the pellet 3 times with 50mL precooled PBS, adding sterile PBS 100mL, incubating at 37 ℃ for 2h, centrifuging at 15400g and 4 ℃ for 20min, and collecting supernatant as Mycoplasma bovis secretory protein. Two groups of secreted protein samples were added to 50mL ultrafiltration tubes (molecular cut-off of 5kDa) and centrifuged at 15400g at 4 ℃ until the volume was concentrated to 80. mu.L. To the concentrated sample was added 5 XSDS loading buffer and a boiling water bath was used for 10 min. Centrifuging at 12000g for 30min, and taking the supernatant for later use.

Culturing Mycoplasma bovis HB0801 strain and Mycoplasma bovis (vaccine strain) MbovHB0801-150.2 for 36h according to the above pathogenic culture conditions, centrifuging at 10000g and 4 deg.C to obtain whole bacterial precipitate, and crushing under hydraulic pressure (pressure 1000pa, crushing time 20min) to obtain whole bacterial protein of each strain.

Preparing SDS-PAGE polyacrylamide gel, adding the treated sample into a hole (20 mu L/hole), performing electrophoresis (the conditions of concentrated gel electrophoresis are 80 volts direct current voltage, and the conditions of separation gel electrophoresis are 120 volts direct current voltage), performing wet transfer on a nitrocellulose membrane (60V,120min) after the electrophoresis is finished, sealing 5% skimmed milk at 4 ℃ overnight, washing the membrane for three times by TBST, incubating for 3hm at room temperature by using the prepared polyclonal antibody (diluted by 1: 500) as a primary antibody, washing the membrane for three times by TBST, and mixing with 1: HRP-goat anti-mouse IgG diluted 3000 times was incubated for 1 hour, the membrane was washed three times with TBST, and the results were observed by color development on a chemiluminescence apparatus using the Super Signal West Pico Trial Kit (purchased from Thermo scientific).

The results show that Mbovp0145 with the size of about 55kDa can be detected in the secretory protein of strain HB0801 of the culture, but no obvious band is detected in the secretory protein of strain HB0801-150, and the two show obvious difference; meanwhile, the expression of the Mbovp0145 in mycoplasma bovis HB0801 strain holomyces protein is higher than that of HB0801-150 strain holomyces protein, and further shows that the protein is expressed by strong and weak strains differently (figure 3).

Example 3: identification of Mbomycoplasma bovis protein Mbovp0145 antigenicity

Adopts a western blot method to carry out rMbovp0145 protein antigenicity identification, and mainly comprises the following steps: carrying out SDS-PAGE electrophoresis on the purified recombinant protein rMbovP0145, transferring the protein on the gel to a PVDF membrane, washing and sealing the gel, respectively incubating the gel with bovine mycoplasma bovine positive serum and bovine negative serum as primary antibodies, and carrying out western blot verification by using goat anti-bovine IgG marked by HRP as a secondary antibody.

The results show that MbovP p0145 reacted with mycoplasma bovis positive serum, with a band at the corresponding protein size of 55kDa (fig. 4A), consistent with the expected molecular weight of MbovP p0145, and no significant reaction with mycoplasma bovis negative serum (fig. 4B).

Example 4: application of mycoplasma bovis protein Mbovp0145 protein in diagnosis of mycoplasma bovis wild strain infection

4.1 establishment of Mbovp0145 antibody detection Indirect ELISA

(1) Collecting animal serum samples: the mycoplasma bovis wild strain naturally infected bovine serum and the artificially infected HB0801 strain bovine serum are taken as positive sera, and the total amount is 100 parts; the blank group from the clinical immunity experiment is negative serum, and the total amount is 78 parts.

(2) Antigen coating: with coating liquid (Na)₂CO₃1.59g,NaHCO₃2.93g, plus ddH₂O to 1000mL) of the rMbovP0145 protein after dilution and 100. mu.L of the coating solution after dilution of the rMbovP0145 protein per well was added to 96-well microplate at 100ng per well and coated overnight at 4 ℃. The coating solution was discarded and washed 3 times with 300. mu.L PBST per well for 2 minutes each.

(3) And (3) sealing: add 100. mu.L of 5% skim milk (5g skim milk plus PBST to 100mL) per well, seal in a 37 ℃ incubator for 1h, spin dry the blocking solution, add 300. mu.L PBST and wash 3 times for 2 min each.

(4) Sample adding: the test serum and the control serum were diluted with PBST at a ratio of 1:100(V/V), and 100. mu.L of the diluted sample was added to each well, followed by incubation at 37 ℃ for 1 hour. The solution in the air was spun off and washed 3 times for 2 minutes each time with 300. mu.L PBST.

(5) Adding an enzyme-labeled secondary antibody: the enzyme-labeled secondary antibody (purchased from southern biotech) was diluted with PBST at a ratio of 1:5000(V/V), 100. mu.L of the diluted HRP-labeled goat-anti-bovine IgG (H + L) enzyme-labeled secondary antibody was added to each well of a 96-well plate, incubated at 37 ℃ for 1H, the solution in the wells was drained, and 300. mu.L of PBST was added and washed 3 times for 2 minutes each.

(6) Adding a substrate for color development: 100 mu LTMB substrate developing solution (purchased from Seracare biological company, USA) is added into each hole of a 96-hole enzyme label plate, and the plate is developed for 10 minutes in a dark place; add 50. mu.L of 0.2M concentrated sulfuric acid per well to stop the reaction (21.7 mL of concentrated H₂SO₄178.3mL ddH was added₂O) and OD is measured at a wavelength of 450nm by a microplate reader₄₅₀The value is obtained.

(7) And (6) judging the result. Calculate S/P value ═ (sample OD-negative OD)/(positive OD-negative OD), using online tool http:// epitools. The page ═ ROC _ curves software determined a threshold of 0.211, at which point diagnostic sensitivity was 97% (95% CI: 91.5-99.0%), diagnostic specificity was 98.7% (95% CI: 93.1-99.8%), and the area under the ROC curve AUC was 0.99 (95% CI: 97.5-100%). The detection sensitivity and specificity of the method are higher than those of most of the existing similar kits.

4.2rMbovP 0145-Indirect ELISA method for determining the serum kinetics curves

The test animals are 9 screened mycoplasma bovis antibody negative milk calves, and serum samples of 7, 14, 21, 28 and 35d after immunization by mycoplasma bovis attenuated vaccine HB150 and 7, 14, 21, 28 and 35d after challenge by HB0801 wild strain after immunization for 35d are collected respectively, the detection is carried out by the method of the above example 4.1, and the result is judged according to the detection value. The results are shown in FIG. 5, where the antigen was negative to serum determination after vaccine immunization and positive was detected 7 days after challenge. The indirect ELISA antibody detection method established by the protein is shown, and animals infected by wild viruses after the vaccine immunization can also be identified. The MbovP0145 protein is differentially expressed in strong and weak virulence strains, and is expected to be used as a target molecule for distinguishing vaccine immunity from natural infection. In addition, most of the existing mycoplasma bovis antibody kits can detect the positive antibody after being infected for more than 14 days, while the invention can detect the antibody after being infected for 7 days, which indicates that the kit also has high sensitivity.

4.3rMbovP0145-iELISA specific assay

The rMbovP0145-iELISA method is used for detecting positive serum samples of common bovine pathogens which are easy to cause diagnosis interference clinically, wherein the positive serum samples comprise salmonella positive serum, escherichia coli positive serum, brucella positive serum, pasteurella multocida positive serum, paratuberculosis positive serum, bovine infectious rhinotracheitis positive serum, foot-and-mouth disease positive serum and rotavirus positive serum, and the results show that the other samples are negative except the bovine mycoplasma positive serum, the rMbovP0145 and the positive serum of other pathogens are determined to have no cross reactivity, and the rMbovP0145-iELISA method has good specificity. The results are shown in Table 1.

TABLE 1 rMbovp0145-iELISA Cross-reactions

In conclusion, the protein MbovP0145 encoded by the Mbov _0145 gene is a secreted protein of mycoplasma bovis, can specifically react with naturally infected serum of mycoplasma bovis and positive serum of artificially killed cattle, and can identify animals infected by wild viruses after vaccine immunization. Can be used as a diagnosis target and has application value in the development of clinical reagents; meanwhile, based on the gene, the Mbov _0145 gene and the Mbov P0145 protein coded by the gene have important potential application prospect in resisting mycoplasma bovis infection vaccines and medicine pathogenesis and prevention and control.

Related terms

Mycoplasma bovis, english name: mycoplasma bovis, abbreviation: m.bovis;

mycoplasma bovis hubei isolate HB0801, english name: mycoplasma bovis HB0801, abbreviations: m.bovis hb0801;

hypotoxicity strain 150.2 of mycoplasma bovis Hubei isolate HB0801, English name: mycoplasma bovisHB0801-150, abbreviations: m.bovis HB 0801-150;

the mycoplasma bovis 0145 protein was expressed as: MbovP 0145;

the mycoplasma bovis 0145 escherichia coli recombinant protein was expressed as: rMbovp 0145;

the gene encoding mycoplasma bovis 0145 protein was expressed as Mbov _ 0145.

<110> university of agriculture in Huazhong

<120> Mycoplasma bovis secretory protein Mbovp P0145 and uses thereof

<160>3

<170>PatentIn version 3.5

<210>1

<211>1446

<212>DNA

<213> Mycoplasma bovis (Mycoplasma bovis)

<400>1

ttgctttttg ctagttcact tcctttaatt gctgcttcat gtaaaaataa tgaaactaag 60

gagcctaaaa aggaacctga aatggatgct ccaatcgctc cacctaccga tcctgaaaaa 120

gataatccag gtaagacaga gcctatgcac agtgataaac ctaaagtttt caaaactgat 180

atttctggtt taaagcttaa atttagtcca acaaataata caaacaaaaa tgatgtctta 240

gaactattaa aaaaacaacc taaattagag aatttgactg aaggcgattt tgacttcaaa 300

ctagagagaa aatcactttt gaatagagaa gggctgatag ttatcgccgc aaatcctgaa 360

tctcaattag tttcaggaat gcttaatatt actataaaca agctcgataa gttaattcca 420

agagaacata aatacaacaa tgataaaaca aaagttcttg aaattggata tgatgaaaaa 480

ggaagaatca aaaaatttgt cgagaatgta aaagaagttc cagcaaatct tcctgaggaa 540

attattagtc ttgactgagc atttgctaga aatttaaatg aaaaaattgt caatttagaa 600

aagtgagaca cctcaaatat tgagagcatg agtaaaactt ttttgcaagc caaaaaattt 660

aatactgata tttctagttg gaaaacaaac agagtcaaag atatgtcaaa tatgtttacg 720

tcagctgaag catttagtca aaatttagat aagtgagaca catctaatgt tacaactatg 780

tatagaatgt ttgaagaagc taaaacgttc aatggtaaca tttcaagctg aaaaacagaa 840

aatgtcacaa atatggaaca tatgtttgaa aaagctgctg ctttcaatca agacttatca 900

tcatgaaatg ttgagaatgt ttcgaaaatg aaaaatatgt ttagtggtgc caaggaattt 960

aataaaccat tatttaagtt aattaatcct aaagtaagtg atatgtcgta tatgtttttt 1020

ggcgctgaaa aatttaatga ttcgtctgtt tcacagtgaa atacgacaag cgttactaag 1080

atgaatgcaa tgttctgaga cgctaaagca tttaatcaag acttaagcaa ctgaaaaact 1140

gacaatgtaa cattaatgca taatatgttt tatggggcaa tcattttcaa cagtgatata 1200

agcagatgaa aaacatctaa agttacaaat atgagccaaa tgttctgggg tgctaaagca 1260

tttaatcaaa atatatcgga ctgagatgta aaaaacgtaa ccgatgtttc aagtatgttt 1320

gcatatgctt cctctttcaa gcaggattta gataaatgaa catttaacaa aattgtcaac 1380

agtagccatt tccgaaatgg tgctcctatt ttcaaactac ctaattttag gcaagtatct 1440

aaataa 1446

<210>2

<211>1446

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

atgctgtttg cctcaagcct gccgttaatt gccgcctcat gtaaaaacaa cgaaaccaaa 60

gaaccgaaaa aggaaccgga aatggacgcc ccgattgccc cgccgaccga ccctgaaaaa 120

gataatcctg gtaaaaccga accgatgcat agtgataaac caaaagtctt caaaaccgat 180

atctcaggac tgaaactgaa atttagtcct accaataata ccaataagaa cgatgtgctg 240

gaactgctga aaaagcagcc aaaattagaa aacctgaccg aaggtgattt tgattttaaa 300

ctggaaagaa agagcctgctgaatcgcgaa ggcctgattg ttatcgcagc aaatcctgaa 360

agccaactgg ttagcggtat gctgaatatc accattaata agctggataa actgatccct 420

agagaacata aatataacaa cgataagacg aaggttctgg aaataggtta tgatgaaaaa 480

ggtcgtatta agaaattcgt tgagaacgtt aaagaggtgc ccgcaaacct gcctgaagaa 540

ataattagcc tggactgggc attcgcccgt aatctgaatg aaaaaattgt taatctggaa 600

aaatgggata ccagcaatat tgaaagcatg agcaaaacct ttctgcaggc aaaaaaattt 660

aataccgata ttagcagctg gaaaaccaat cgtgttaaag atatgagcaa tatgtttacc 720

agcgcagaag catttagcca gaatctggat aaatgggata ccagcaatgt taccaccatg 780

tatcgtatgt ttgaagaagc aaaaaccttt aatggtaata ttagcagctg gaaaaccgaa 840

aatgttacca atatggaaca tatgtttgaa aaagcagcag catttaatca ggatctgagc 900

agctggaatg ttgaaaatgt tagcaaaatg aaaaatatgt ttagcggtgc aaaagaattt 960

aataaaccgc tgtttaaact gattaatccg aaagttagcg atatgagcta tatgtttttt 1020

ggtgcagaaa aatttaatga tagcagcgtt agccagtgga ataccaccag cgttaccaaa 1080

atgaatgcaa tgttttggga tgcaaaagca tttaatcagg atctgagcaa ttggaaaacc 1140

gataatgtta ccctgatgca taatatgttt tatggtgcaa ttatttttaa tagcgatatt 1200

agccgttgga aaaccagcaa agttaccaat atgagccaga tgttttgggg tgcaaaagca 1260

tttaatcaga atattagcga ttgggatgtt aaaaatgtta ccgatgttag cagcatgttt 1320

gcatatgcaa gcagctttaa acaggatctg gataaatgga cctttaataa aattgttaat 1380

agcagccatt ttcgtaatgg tgcaccgatt tttaaactgc cgaattttcg tcaggttagc 1440

aaataa 1446

<210>3

<211>481

<212>PRT

<213> Mycoplasma bovis (Mycoplasma bovis)

<400>3

Leu Leu Phe Ala Ser Ser Leu Pro Leu Ile Ala Ala Ser Cys Lys Asn

1 5 10 15

Asn Glu Thr Lys Glu Pro Lys Lys Glu Pro Glu Met Asp Ala Pro Ile

20 25 30

Ala Pro Pro Thr Asp Pro Glu Lys Asp Asn Pro Gly Lys Thr Glu Pro

35 40 45

Met His Ser Asp Lys Pro Lys Val Phe Lys Thr Asp Ile Ser Gly Leu

50 55 60

Lys Leu Lys Phe Ser Pro Thr Asn Asn Thr Asn Lys Asn Asp Val Leu

65 70 75 80

Glu Leu Leu Lys Lys Gln Pro Lys Leu Glu Asn Leu Thr Glu Gly Asp

85 90 95

Phe Asp Phe Lys Leu Glu Arg Lys Ser Leu Leu Asn Arg Glu Gly Leu

100 105 110

Ile Val Ile Ala Ala Asn Pro Glu Ser Gln Leu Val Ser Gly Met Leu

115 120 125

Asn Ile Thr Ile Asn Lys Leu Asp Lys Leu Ile Pro Arg Glu His Lys

130 135 140

Tyr Asn Asn Asp Lys Thr Lys Val Leu Glu Ile Gly Tyr Asp Glu Lys

145 150 155 160

Gly Arg Ile Lys Lys Phe Val Glu Asn Val Lys Glu Val Pro Ala Asn

165 170 175

Leu Pro Glu Glu Ile Ile Ser Leu Asp Trp Ala Phe Ala Arg Asn Leu

180 185 190

Asn Glu Lys Ile Val Asn Leu Glu Lys Trp Asp Thr Ser Asn Ile Glu

195 200 205

Ser Met Ser Lys Thr Phe Leu Gln Ala Lys Lys Phe Asn Thr Asp Ile

210 215 220

Ser Ser Trp Lys Thr Asn Arg Val Lys Asp Met Ser Asn Met Phe Thr

225 230 235 240

Ser Ala Glu Ala Phe Ser Gln Asn Leu Asp Lys Trp Asp Thr Ser Asn

245 250 255

Val Thr Thr Met Tyr Arg Met Phe Glu Glu Ala Lys Thr Phe Asn Gly

260 265 270

Asn Ile Ser Ser Trp Lys Thr Glu Asn Val Thr Asn Met Glu His Met

275 280 285

Phe Glu Lys Ala Ala Ala Phe Asn Gln Asp Leu Ser Ser Trp Asn Val

290 295 300

Glu Asn Val Ser Lys Met Lys Asn Met Phe Ser Gly Ala Lys Glu Phe

305 310 315 320

Asn Lys Pro Leu Phe Lys Leu Ile Asn Pro Lys Val Ser Asp Met Ser

325 330 335

Tyr Met Phe Phe Gly Ala Glu Lys Phe Asn Asp Ser Ser Val Ser Gln

340 345 350

Trp Asn Thr Thr Ser Val Thr Lys Met Asn Ala Met Phe Trp Asp Ala

355 360 365

Lys Ala Phe Asn Gln Asp Leu Ser Asn Trp Lys Thr Asp Asn Val Thr

370 375 380

Leu Met His Asn Met Phe Tyr Gly Ala Ile Ile Phe Asn Ser Asp Ile

385 390 395 400

Ser Arg Trp Lys Thr Ser Lys Val Thr Asn Met Ser Gln Met Phe Trp

405 410 415

Gly Ala Lys Ala Phe Asn Gln Asn Ile Ser Asp Trp Asp Val Lys Asn

420 425 430

Val Thr Asp Val Ser Ser Met Phe Ala Tyr Ala Ser Ser Phe Lys Gln

435 440 445

Asp Leu Asp Lys Trp Thr Phe Asn Lys Ile Val Asn Ser Ser His Phe

450 455 460

Arg Asn Gly Ala Pro Ile Phe Lys Leu Pro Asn Phe Arg Gln Val Ser

465 470 475 480

Lys

Claims (6)

1. The Mycoplasma bovis Mbov _0145 gene encodes a protein, and the Mycoplasma bovis Mbov _0145 gene has a nucleotide sequence shown as SEQ ID NO: 1.

2. The protein of claim 1, wherein: the protein is a recombinant protein with an amino acid sequence shown as SEQ ID NO. 3.

3. An antibody against the protein of claim 1 or 2.

4. Use of the protein of claim 1 or 2 and the antibody of claim 3 in the preparation of a mycoplasma bovis detection kit.

5. An indirect ELISA detection kit for mycoplasma bovis antibodies, which is characterized in that: comprising the protein of claim 1 or 2.

6. The kit of claim 5, wherein: the kit can identify animals which are infected by wild viruses after the vaccine immunization.

Images