AU2020102599A4

AU2020102599A4 - Indirect ELISA Detection Method and Application of DHAV-3 Antibody Based on VP2 or VP4 Recombinant Protein Antigen

Info

Publication number: AU2020102599A4
Application number: AU2020102599A
Authority: AU
Inventors: Anchun CHENG; Ling HE; Mingshu Wang; Liping Wu
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2020-10-05
Filing date: 2020-10-05
Publication date: 2020-11-26
Anticipated expiration: 2028-10-05

Abstract

The invention discloses an indirect ELISA detection method and application of the DHAV-3 antibody based on VP2 or VP4 recombinant protein antigen. The detection method relates to a kit which takes VP2 or VP4 recombinant protein as the envelope antigen. The detection method disclosed by the invention has the advantages of strong specificity, high sensitivity, good reproducibility, convenience and rapidness in detection and high coincidence rate with the cell neutralization test, which can provide a way for detection of DHAV-3, and lay a foundation for follow-up research and epidemiological investigation of the disease.

Description

Indirect ELISA Detection Method and Application of DHAV-3 Antibody Based on VP2 or VP4 Recombinant Protein Antigen

TECHNICAL FIELD

[01] The invention belongs to the technical field of biology. To be specific, it relates to an indirect ELISA detection method and application of the DHAV-3 antibody based on VP2 or VP4 recombinant protein antigen.

BACKGROUND

[02] Advertising

[03] Duck hepatitis the virus (DHAV) is the single positive strand RNA virus that is not enveloped with the total gene group length of 7.7 kb. It has only one Open reading frame (ORF) and encodes totally three structural proteins and nine non structural proteins, mainly three genotypes (DHAV-1, DHAV-2, DHAV-3). DHAV-2 is prevalent mainly in Taiwan and other regions, but it is not reported in the mainland of China, while DHAV-1 and DHAV-3 are common in China, and there exist mixed infection, which cause some difficulties in the diagnosis of the disease.

[04] The enzyme-linked immunosorbent assay (ELISA) detection method is the common experimental process in the laboratory diagnosis method and can be used for detecting clinical samples, and the ELISA detection method can be used for detecting antibodies and antigens; The ELISA detection method is simple to operate and convenient to use, and can be used for diagnosing DHAV. At present, the ELISA detection method which can be used for DHAV diagnosis comprises the whole virus enveloped ELISA method, the yolk antibody ELISA method, the PCR-ELISA method, the enzyme labeled antigen Dot-ELISA method and the like. However, these methods have the problems of difficult material acquisition, complicated operation, high equipment requirement, high price, inconvenient transportation, various procedures, limitation of use places, professional knowledge requirement and the like, so that the method is not favorable for carrying out the use in clinical production, such as virus particles with higher purity required by the full virus envelope method, the virus needs to be cultured, and the method is subjected to the series of operations such as centrifugation, purification and the like; and each step has higher requirement on temperature, needs to be completed as far as possible in the low-temperature environment, and care should be taken in the purification process, otherwise, the virus purity is difficult to ensure, and the detection effect is influenced. In addition, DHAV is the RNA virus, which is unstable, easy to degrade, and not suitable for transportation when stored at low temperature.

[05] VP2 and VP4 are well conserved in small RNA viruses, the difference between different serotype viruses is small, the surfaces of the two proteins both contain antigen epitopes, corresponding antibodies can be specifically combined, and the antigen determinant of IgM existing on the surface of the VP2 protein can lay the foundation for the subsequent early diagnosis research of DHAV-3. At present, no any report on the diagnosis of DHAV-3 using VP2 or VP4 has been found, and the diagnosis of DHAV-3 is mainly focused on immunohistochemistry, fluorescence quantitative RT-PCR and the like, and although the diagnosis accuracy of these methods is high, a plurality of disadvantages still exist. For example, immunohistochemical method requires that purified virus particles are used as antigens to obtain hyperimmune serum, and then the serum is used as the antibody to detect the DHAV-3 antigen, so that the acquisition and purification of the virus particles and the acquisition of the hyperimmune serum are time-consuming and labor-consuming in the process, and the support of special equipment is also needed, therefore, the capital demand is large, and the experimental period is long. In addition, when the slices are made, the treatment time of the sample in the early stage is longer, and the diagnosis of diseases can be delayed in the actual production process. Although fluorescence quantitative RT-PCR can accurately detect the DHAV-3 pathogen, the application place s limited since the method needs the specific PCR instrument to complete, and the instrument is expensive, and the basic unit in production practice generally does not have the instrument.

SUMMARY

[06] In view of the above, the invention provides the indirect ELISA detection method and application of DHAV-3 antibody based on VP2 or VP4 recombinant protein antigen aiming at the problems of long sample processing period to be detected, limitation of diagnosis place, complex operation, complex experimental procedures, unstable raw materials and easy degradation.

[07] In order to solve the above technical problems, the invention discloses an indirect ELISA detection kit of the DHAV-3 antibody based on VP2 or VP4 recombinant protein antigen, which takes VP2 or VP4 recombinant protein as the envelope antigen.

[08] Further, the amino acid sequence of the VP2 recombinant protein is shown as SEQ ID NO. 2, and the amino acid sequence of the VP4 recombinant protein is shown as SEQ ID NO.4.

[09] Further, the VP2 recombinant protein exists in the form of the inclusion body and the VP4 recombinant protein exists in the form of the supernatant.

[010] Further, the kit comprises the enzyme labeled second antibody, which is HRP-labeled anti-duck IgG.

[011] The invention also discloses an indirect ELISA detection method of the DHAV-3 antibody based on the VP2 or VP4 recombinant protein antigen, which comprises the following steps:

[012] (1) Envelope ELISA plate: Diluting the purified VP2 or VP4 recombinant protein with the envelope solution, adding it into the ELISA plate, 100 L/hole, incubating at 37°C for 1 hour, and then overnight at 4°C;

[013] (2) Washing the ELISA plate: Taking out the enveloped ELISA plate, discarding antigen liquid, washing the plate with PBST for 5 times, 5min/time, and patting dry the liquid in the hole on filter paper after the last washing ;

[014] (3) Blocking: Adding the blocking solution into the ELISA plate, 250L/hole, 37°C, and blocking for 1 hour;

[015] (4) Washing the ELISA plate: The washing method is as in step (2);

[016] (5) Diluting the DHAV-3 serum, adding the diluted DHAV-3 duck serum primary antibody to be detected, 100 L/hole, 37°C, and conducting incubation;

[017] (6) Washing the ELISA plate: The washing method is as in step (2);

[018] (7) Adding the enzyme labeled second antibody:

[019] Diluting HRP labeled anti-duck IgG in the ratio of 1:2000, adding diluted HRP labeled anti-duck IgG, 100 L/hole, 37°C, and conducting incubation;

[020] (8) Washing the ELISA plate: The washing method is as in step (2);

[021] (9) And color development and stopping color development: Adding TMB color development solution, 100 L/hole, performing color development for 10 min, adding 2 mol/L H2SO4 with equal volume to stop the reaction.

[022] Further, the envelope solution in step (1) is 0.05 mol/L pH 9.6 carbonate buffer solution; The envelope condition of the VP2 recombinant protein is of 1:1600 protein dilution (2.23[tg/mL), and the optimal envelope condition of the VP4 recombinant protein is of 1:2000 protein dilution (2.6[tg/mL).

[023] Further, the indirect ELISA detection method described in claim 6 is characterized in that the blocking solution of the VP2 recombinant protein in step (3) is 1% of skim milk powder, and the blocking solution of the VP4 recombinant protein in step (3) is 5% of skim milk powder.

[024] Further, the incubation time of the serum to be detected of the VP2 recombinant protein in step (5) is 1 hour, the DHAV-3 serum is diluted described in the ratio of 1:160; And the incubation time of the serum to be detected of the VP4 recombinant protein is 0.5 hour, and the DHAV-3 serum is diluted in the ratio of 1:20.

[025] Further, the enzyme labeled second antibody incubation time of the VP2 recombinant protein in step (7) is 0.5 h, and the enzyme labeled second antibody incubation time of the VP4 recombinant protein is 1 h.

[026] The invention also discloses an application of the kit in detecting the DHAV-3 antibody level based on the VP2 or VP4 recombinant protein antigen.

[027] Compared with the prior art, the invention can obtain the following technical effects:

[028] 1) The VP2 and VP4 of the invention can express the recombinant protein with the size of about 25kDa and 28kDa in escherichia coli, which mainly exist in the form of the inclusion body and the supernatant separately; and Western blot analysis shows that the protein can be recognized by anti-rabbit DHAV-3 serum, indicating that the protein has good reactogenicity.

[029] 2) The indirect ELISA detection method for detecting the DHAV-3 antibody, which is established by taking VP2 and VP4 recombinant proteins as antigens, has the advantages of strong specificity, high sensitivity, good reproducibility, convenience and rapidness in detection and high coincidence rate with the cell neutralization test, providing a way for detecting the DHAV-3, and laying a foundation for subsequent research and epidemiological investigation of the disease.

[030] Certainly, any product embodying the invention does not necessarily need to achieve all of the technical effects described above at the same time.

BRIEF DESCRIPTION OF THE FIGURES

[031] The attached drawings are included to provide the further understanding of the invention and to constitute a part of this description. The schematic embodiments of the invention and, together with the description, serve to explain the invention and are not to be construed as unduly limiting of the invention. As shown in the drawings:

[032] Figure 1 shows the result of optimizing PCR Tm values of VP2 and VP4 genes of the DHAV-3QL strain; where M is DL2,000 Marker, swimlanes 1-8 are PCR products with different Tm values of the VP4 gene, the annealing temperatures are 50.8, 51.4, 52.7, 53.5, 54.7, 55.2, 56.3, 57.5 separately, 9-16 are PCR products with different Tm values of the VP2 gene, and annealing temperatures are 52.0, 53.2, 54.3, 55.3, 56.2, 56.9, 57.5 and 57.8 separately;

[033] Figure 2 shows the PCR identification of the pET30-VP2 bacterial solution of the invention, wherein swimlane M is DL2, 000 Marker; swimlanes 1-18 are colonies;

[034] Figure 3 is the PCR identification of the pET32-VP4 bacterial solution of the present invention; wherein swimlane M is DL2, 000 Marker; swimlanes 1-24 are bacteria colonies;

[035] Figure 4 shows the enzyme digestion identification of pET30-VP2 described in the invention; wherein M is DL2, 000 Marker and swimlane 1 is EcoRI and XhoI double digestion products of pET30-VP2;

[036] Figure 5 shows the enzyme digestion identification of pET32-VP4 described in the invention; M is DL2, 000 Marker, swimlane 1 is EcoRI and XhoI double digestion products of pET32-VP4;

[037] Figure 6 shows the expression situation of pET30-VP2 and pET32-VP4 in BL21; where M is protein Marker (low molecular weight), and A is VP2: swimlanes1 4 are respectively pET30 inclusion bodies, pET30-VP2 inclusion bodies, pET30-VP2 whole bacteria and pET30 whole bacteria; B is VP4: swimlanes 1-6 are respectively pET32 supernatant, pET32-VP4 ultrasonic broken whole supernatant, pET32 whole bacteria, pET32-VP4 ultrasonic broken whole bacteria, pET32 inclusion bodies, and pET32-VP4 ultrasonic broken inclusion bodies;

[038] Figure 7 shows the optimization of expression conditions of pET32-VP4 described in the invention; where M is the protein Marker (low molecular weight); A is the temperature optimization of pET32-VP4: 1-4 are the induction product of 37°C, °C, 25°C, and 16°C, respectively, and 5 is the pET32 idle; B is the IPTG concentration optimization of pET32-VP4: 1-6 are the induction products of 0, 0.2, 0.4, 0.6, 0.8, and 1.0 mmol/L IPTG, respectively, and 7 is the pET32 idle;

[039] Figure 8 shows the purification of the VP2 and VP4 recombinant proteins of the present invention; where M is the protein Marker, A is the purification of the VP2 recombinant protein: 1 is the purified VP2 recombinant protein, 2 is the unpurified VP2 recombinant protein, B is the purification of the VP4 recombinant protein, 1 is the purified VP4 recombinant protein, 2 is the unpurified VP4 recombinant protein, and 3 is the idle protein;

[040] Figure 9 shows the immunoblotting analysis of VP2 and VP4 recombinant proteins of the present invention; where M is the pre-stained Marker, and A is the VP2 recombinant Western blotting: 1 is the purified VP2 recombinant protein, and 2 is the unpurified VP2 recombinant protein; B is the VP4 recombinant Western blotting: 1 is the idle, and 2 is the purified VP4 recombinant protein;

[041] Figure 10 shows the cross-reaction analysis of the VP2 recombinant protein of the present invention;

[042] Figure 11 shows the cross-reaction analysis of the VP4 recombinant protein of the present invention.

DESCRIPTION OF THE INVENTION

[043] Hereinafter, embodiments of the present invention will be described in detail with reference to the following embodiments, whereby it will be fully understood and implemented on how the present invention can be implemented by applying technical means to solve technical problems and achieve technical effects.

[044] EMBODIMENT 1 Preparation of Recombinant Proteins VP2 and VP4

[045] 1. Construction of recombinant plasmids PET30-VP2 and PET32-VP4

[046] 1.1. Amplification of VP2 and VP4 Gene Fragments

[047] RNA was extracted from DHAV-3 infected duck embryo allantoic liquid as the template, and VP2-P1, VP2-P2, VP4-P1 and VP4-P2 were used as specific pVP (shown in Table 1). Under the amplification system as shown in Table 2, pre denaturation was carried out at 94°C for 5 minutes respectively, cycle parameters of amplification were as follows: 30 seconds at 94°C, 30 seconds at 50-60°C and 50 seconds at 72°C; 30 cycles were carried out, and then the total extension was carried out at 72°C for 10 minutes to obtain target fragments amplified at different annealing temperatures; The amplified gene fragment was carried out with 2% agarose gel electrophoresis, resulting in that VP2 and VP4 could obtain the optimized fragments at 54.7°C and 55.3°C, and the gene fragments were 558bp and 255bp respectively, as shown in Figure 1.

[048] Table 1 VP2 and VP4 Amplification Primers

Primer Name Sequences Enzyme digestion site

VP4-P1 5'-3':CCGGAATTCCTTCATGCAATGGATACTCTAAC EcoRI

VP4-P2 5'-3':CCGCTCGAGttaCTGGGCCCCAACCTCATAG Xhol

VP2-P1 5'-3':CCGGAATTCGGTGACAACATCTCACGTTTAG EcoR/

VP2-P2 5'-3':CCGCTCGAGttaCTGGTCATTAAAAGGCCGAGG Xhol

[049] Note: The restriction enzyme digestion sites are underlined, the italics are protective bases, the lowercase letters are stop codons, and the bold font is anti-shift base.

[050] Table 2 PCR Amplification System

Reagent Name Volume

2ATaq Master Mix 5p L

Forward /Reverse primer primer(l0pM) 0.5p L /0.5pt L

Template cDNA 1p L

ddH 20 up to 10 p L

[051] 1.2. Construction of Prokaryotic Expression Plasmids for VP2 and VP4 Genes

[052] (1) Identification of pET30-VP2 and pET32-VP4 PCR

[053] The VP2 and VP4 gene fragments were amplified in PCR amplification conditions, which were recovered and purified by the DNA gel recovery kit, subjected to EcoRI and XhoI double enzyme digestion in the proper proportion, recovered and purified, and connected to pET30a-(+) and pET32a-(+) plasmids which were subjected to the same EcoRI and XhoI double enzyme digestion, connection overnight at 16°C, were transferred into DH5 alpha. competent cells. And a single colony was selected for bacterial liquid PCR amplification on the next day, and positive clone bacteria was successfully screened, as shown in Figures 2 and 3.

[054] (2) Identification of enzyme digestion of pET30-VP2 and pET32-VP4

[055] After amplification culture and plasmid extraction of the positive clone bacteria, the fragments were digested by restriction incision enzymes EcoRI and XhoI followed by electrophoresis in 2% agarose gel and the clear target bands were found at around 543 bp (Figure 4) and 234 bp (Figure 5), respectively, indicating that VP2 and VP4 were successfully ligated to pET30a-(+) and pET32a-(+) vectors, respectively, and the recombinant plasmids were successfully constructed. Sequencing showed that VP2 and VP4 were correctly ligated to expression vectors pET30a-(+) and pET32a-(+), named pET30-VP2 and pET32-VP4.

[056] 2. Expression, Purification and Identification of Recombinant Proteins VP2 and VP4

[057] 2.1. Expression of Recombinant Proteins VP2 and VP4

[058] (1) Confirmation of Expression Forms of Recombinant Proteins VP2 and VP4

[059] The plasmid DNA that was correctly sequenced above was transformed into competent cells of the host bacterium BL21(DE3), and after culturing, the expression was induced at 0.4 mmol/L IPTG for 6-8 h at 37°C, and the centrifuged collected thallus were subjected to 20 mmol/L Tris-HC resuspension ultrasound crushing, SDS-PAGE analysis showed that pET30-VP2 mainly expressed in a large amount in the form of the inclusion body in the host bacterium BL21(DE3), with the size of about 25 kDa, as shown in Figure 6A; While PET32-VP4 expressed in a large amount after 6-8 h of induction expression in host bacterium BL21(DE3) with 0.4mmol/L IPTG, 37°C, mainly in the supernatant, with the size of about 28 kDa, as shown in Figure 6B, namely pET30-VP2 mainly expressed VP2 recombinant protein in a great amount in the non soluble form in the host bacterium BL21, of which the amino acid sequence is shown as SEQ ID No.2. The nucleotide sequence encoding the amino acid sequence is shown as SEQ ID No.1, while pET32-VP4 mainly expressed VP4 recombinant protein in a great amount in the soluble form in the supernatant, of which the amino acid sequence is shown as SEQ ID No.4. The nucleotide sequence encoding the amino acid sequence is shown as SEQ ID No.3.

[060] (2) Optimization of Expression Conditions of Recombinant Protein VP4

[061] The recombinant protein VP4 was optimized at different temperatures (37°C, °C, 25°C, and 16°C) and different IPTG concentrations (0, 0.2, 0.4, 0.6, 0.8, and 1.0 mmol/L) indicating the optimal induction conditions for pET32-VP4 expression in the host expression strain BL21: the induction temperature was 30°C, the IPTG concentration was 0.4 mmol/L, and the expression was induced for 8 hours, as shown in Figure 7. It could be seen from the figure that the change of temperature and the concentration of IPTG in the range of 0.4-1.0 mmol/L had little effect on the expression of VP4 recombinant protein, and the expression of VP4 recombinant protein was large, so IPTG at 37 °C and 0.4 mmol/L was selected as the best induction condition for the expression of VP4 recombinant protein.

[062] 2.2. Purification and Identification of Recombinant Proteins VP2 and VP4

[063] According to the difference of expression forms of pET30-VP2 and pET32-VP4 in host strain BL21 (DE3), gel digestion and nickel column affinity chromatography were selected for purification respectively, and recombinant proteins VP2 and VP4 with higher purity and higher concentration were obtained, as shown in Figure 8A/B. The recombinant VP2 and VP4 proteins were identified by Westeron blot to be recognized by DHAV-3 serum and had good reactivity, as shown in Figures 9A and B.

[064] EMBODIMENT 2 Establishment of Indirect ELISA Detection Method of DHAV-3 Antibody Based on VP2 and VP4 Recombinant Protein Antigens

[065] 1. Condition Optimization of Indirect ELISA Detection Based on Recombinant Proteins VP2 and VP4

[066] (1) Optimization of antigen envelope concentration and serum dilution degree

[067] The concentrations of VP2 and VP4 recombinant proteins after purification were determined by BCA method, which were 3.57 mg/mL and 5.19 mg/mL, respectively, and it was diluted into different concentrations for envelope overnight. The results are shown in Table 3 and Table 4. The largest value of P/N was selected as antigen envelope and serum dilution condition, and the best envelope condition of recombinant protein VP2 was 1:1600 dilution of protein (2.23 [g/mL), serum 1:160 dilution; The best envelope condition of recombinant protein VP4 was 1:2000 of protein dilution (2.6 g/mL) and serum 1:20 dilution.

[068] Table 3 Determination of Optimal Antigen Envelope Concentration and Serum Dilution Degree Based on Recombinant Protein VP2

Antigen concentration Serum dilution Detection value 1:1600 1:3200 1:6400 1:12800 1:25600 1:51200

P 1.48 1.22 1.02 0.91 0.98 0.80

1:20 N 0.10 0.23 0.20 0.19 0.18 0.15

P/N 14.36 5.27 5.06 4.85 5.49 5.51

P 1.50 1.19 0.94 0.79 0.89 0.79

1:40 N 0.11 0.17 0.13 0.11 0.11 0.11

P/N 14.24 7.14 7.04 7.12 7.86 7.10

P 1.25 1.10 0.84 0.73 0.75 0.70

1:80 N 0.08 0.12 0.14 0.11 0.12 0.10

P/N 15.29 9.60 6.11 6.58 6.27 6.90

P 1.13 0.94 0.77 0.64 0.65 0.54

1:160 N 0.07 0.12 0.11 0.08 0.11 0.07

P/N 15.42 8.19 7.04 7.69 5.76 8.25

P 1.09 0.87 0.59 0.47 0.59 0.46

1:320 N 0.10 0.06 0.09 0.06 0.09 0.07

P/N 11.20 14.53 6.75 7.33 6.50 6.98

P 0.88 0.69 0.59 0.39 0.35 0.36

1:640 N 0.10 0.09 0.08 0.07 0.06 0.06

P/N 8.79 8.06 6.96 5.84 5.78 5.63

[069] Note: Bold font is identified as the P, N and P/N values corresponding to the optimal antigen and serum dilution degree.

[070] Table 4 Determination of optimal antigen envelope concentration and serum dilution degree based on recombinant proteinVP4

Antigen Serum Detection concentration dilution value 1:32 1:64 1:125 1:500 1:10001:20001:50001:10000

P 0.961.05 1.16 1.07 1.08 0.96 0.68 0.50

1:20 N 0.65 0.62 0.47 0.39 0.34 0.27 0.22 0.23

P/N 1.481.70 2.45 2.78 3.23 3.52 3.10 2.13

P 0.37 0.43 0.52 0.43 0.42 0.37 0.29 0.22

1:40 N 0.41 0.40 0.27 0.25 0.22 0.21 0.14 0.16

P/N 0.891.07 1.89 1.74 1.95 1.76 1.96 1.36

P 0.24 0.27 0.33 0.26 0.25 0.23 0.18 0.15

1:80 N 0.32 0.31 0.2 0.17 0.15 0.16 0.10 0.13

P/N 0.76 0.89 1.63 1.54 1.71 1.48 1.94 1.17

P 0.16 0.17 0.21 0.16 0.17 0.15 0.12 0.11

1:160 N 0.27 0.23 0.14 0.13 0.11 0.11 0.08 0.12

P/N 0.59 0.73 1.48 1.30 1.45 1.29 1.51 0.96

P 0.13 0.13 0.13 0.12 0.11 0.12 0.10 0.09

1:320 N 0.24 0.21 0.12 0.11 0.10 0.10 0.07 0.10

P/N 0.52 0.59 1.12 1.01 1.11 1.21 1.34 0.90

P 0.11 0.11 0.16 0.10 0.10 0.12 0.09 0.10

1:640 N 0.28 0.25 0.16 0.15 0.14 0.16 0.13 0.17

P/N 0.38 0.43 1.03 0.66 0.75 0.76 0.69 0.59

[071] Note: Bold font is identified as the P, N and P/N values corresponding to the optimal antigen and serum dilution degree.

[072] (2) Optimization of the optimum dilution of enzyme labeled second antibody

[073] Envelope and incubating was conducted with the above optimized antigen and serum dilution degree, incubating enzyme labeled second antibodies with different concentrations, setting three repetitions for each concentration, and taking the average value to obtain the optimal enzyme labeled second antibody dilution, namely the maximum P/N value, and the optimal dilution degree of the enzyme labeled second antibody is 1:2000 in the indirect ELISA detection method using VP2 recombinant protein as the envelope antigen; and the optimal dilution degree of the enzyme labeled second antibody is 1:1600 in the indirect ELISA detection method using VP4 recombinant protein as the envelope antigen, as shown in Table 5 and Table 6.

[074] Table 5 Optimization of enzyme labeled second antibody based on recombinant protein

Inspection Dilution of rabbit anti-duck IgG labeled with HRP

Numericalvalue 1:800 1:1000 1:1600 1:2000 1:3200 1:6400

P 1.09 1.13 0.97 0.93 0.65 0.42

N 0.13 0.12 0.12 0.09 0.08 0.07

P/N 8.18 9.62 8.30 9.90 8.61 6.10

[075] Note: Bold font is identified as the P, N and P/N values of the optimal dilution degree of the enzyme labeled second antibody

[076] Table 6 Optimization of enzyme labeled second antibody based on recombinant protein

Inspection Dilution of rabbit anti-duck IgG labeled with HRP

Numericalvalue 1:400 1:800 1:1000 1:1600 1:2000 1:3200

P 1.45 1.29 1.05 0.97 0.92 0.72

N 0.69 0.53 0.40 0.30 0.38 0.30

P/N 2.11 2.45 2.60 3.21 2.45 2.43

[077] Note: Bold font is identified as the P, N and P/N values of the optimal dilution degree of the enzyme labeled second antibody

[078] 2. Establishment of Indirect ELISA Detection of DHAV-3 Antibody Based on VP2 and VP4 Recombinant Proteins

[079] (1) Determination of critical value of indirect ELISA detection method based on VP2 and VP4 proteins

[080] According to the above optimization results, 48 DHAV-3 negative sera were detected by VP2 and VP4 respectively, each serum was repeated three times, the mean value was taken, the positive threshold PC=mean value+3SD, the negative threshold NC=mean value+2SD, and SD was standard deviation. According to the results in Table 7 and Table 8, the positive threshold value of VP2 protein was 0.25, the negative threshold value was 0.20, the positive threshold value ofVP4 protein was 0.29, the negative threshold value was 0.25, and the value within the positive and negative range should be tested again.

[081] Table 7 48 DHAV-3 negative serum OD values based on VP2 protein

0.12 0.80 0.12 0.09 0.13 0.08 0.08 0.09 0.41 0.09 0.09 0.08

0.08 0.12 0.08 0.08 0.08 0.09 0.08 0.12 0.08 0.09 0.11 0.10

0.13 0.07 0.12 0.08 0.13 0.07 0.08 0.08 0.08 0.08 0.09 0.10

0.09 0.09 0.08 0.08 0.09 0.09 0.12 0.12 0.10 0.10 0.10 0.10

[082] Table 8 48 DHAV-3 negative serum OD values based on VP4 protein

0.19 0.20 0.18 0.09 0.23 0.29 0.18 0.14 0.16 0.16 0.16 0.18 0.20 0.14 0.18 0.11 0.22 0.15 0.11 0.23 0.09 0.09 0.17 0.14 0.19 0.14 0.16 0.16 0.17 0.13 0.14 0.06 0.16 0.16 0.11 0.13 0.22 0.20 0.16 0.13 0.12 0.13 0.26 0.17 0.16 0.16 0.17 0.15

[083] (2) Steps of indirect ELISA detection method based on VP2 and VP4 proteins:

[084] (D Envelope ELISA plate: Diluting the purified VP2 or VP4 recombinant

protein with envelope solution (0.05 mol/L pH 9.6 carbonate buffer solution), adding it into the ELISA plate, 100 L/hole, incubating at 37°C for 1 hour, and then overnight at 4°C;

[085] Wherein the envelope condition of the VP2 recombinant protein is of 1:1600 protein dilution (2.23[tg/mL), and the optimal envelope condition of the recombinant protein VP4 is of 1:2000 protein dilution (2.6[tg/mL);

[086] @ Washing the ELISA plate: Taking out the enveloped ELISA plate,

discarding antigen liquid, washing the plate with PBST for 5 times, 5min/time, and patting dry the liquid in the hole on filter paper after the last washing (the following plate washing steps are the same);

[087] @ Blocking: Adding the blocking solution into the ELISA plate,

250L/hole, 37°C, and blocking for 1 hour;

[088] Wherein the blocking liquid of the VP2 recombinant protein is 1% of skimmed milk powder, and the blocking liquid of the VP4 recombinant protein is 5% of skimmed milk powder;

[089] @ Washing the ELISA plate: The washing method is as in step@;

[090] ©Diluting the DHAV-3 positive serum with 0.05mol/L pH 9.6 carbonate

buffer solution, adding the diluted DHAV-3 positive serum primary antibody to be detected, 100 L/hole, 37°C, and conducting incubation; wherein the incubation time of the serum to be detected of the VP2 recombinant protein is 1 hour, the DHAV-3 serum is diluted in the ratio of 1:160; And the incubation time of the serum to be detected of the VP4 recombinant protein is 0.5 hour, and the DHAV-3 serum is diluted in the ratio of 1:20

[091] ©Washing the ELISA plate: The washing method is as in step@;

[092] ( Adding the enzyme labeled second antibody:

[093] Diluting the HRP-labeled rabbit anti-duck IgG in the ratio of 1:2000, adding the diluted HRP-labeled rabbit anti-duck IgG, 100 L/hole, 37°C, and conducting incubation; wherein the enzyme labeled second antibody incubation time of the VP2 recombinant protein is 0.5 h, and the enzyme labeled second antibody incubation time of the VP4 recombinant protein is 1I h;

[094] @ Washing the ELISA plate: The washing method is as in step @;

[095] @ And color development and stop color development: adding TMB color development solution, 100pL/hole, performing color development for 10 min, adding 2 mol/L H2SO4 with equal volume to stop the reaction, and determining OD value at 450nm with the microplate reader.

[096] After establishing the indirect ELISA detection method of the DHAV-3 antibody as described above, the DHAV-3 antibody level of duck DHAV-3 serum can be evaluated using this method.

[097] EMBODIMENT 3 Evaluation of reproducibility of VP2 and VP4 recombinant proteins

[098] The purified VP2 and VP4 recombinant proteins with the same batch and different batches were enveloped, respectively. The coefficients of variation in the plate and among plates in the same batch and among different batches of purified recombinant proteins were evaluated. The data of each group were repeated three times. The results as shown in Table 9 and 10 showed that the maximum coefficient of variation in the same batch of VP2 recombinant proteins was 10.4%, the minimum was 3.8%, the average coefficient of variation was 6.12%; The maximum coefficient of variation among different batches was 9.2%, the minimum coefficient of variation was 5.5%, and the average cofficient of variation was 7.32%, which were all less than 10%. The maximum coefficient of variation in the same batch of VP4 recombinant proteins was 5.4%, the minimum was 0.9%, the average coefficient of variation was 2.87%; The maximum coefficient of variation among different batches was 9.5%, the minimum coefficient of variation was 2.5%, and the average cofficient of variation was 5.62%, which were all less than 10%.

[099] Table 9 Reproducibility analysis based on VP2 recombinant protein

Batch Serum Number of Number of Number of Average Standard Coefficient of repetitions 1 repetitions 2 repetitions 3 value deviation variation

1 0.94 1.08 0.96 0.99 0.074 7.4%

2 0.76 0.78 0.86 0.80 0.055 6.8%

Batch 3 1.21 1.03 1.04 1.09 0.101 9.2%

Inter 4 0.13 0.14 0.12 0.13 0.007 5.7%

5 0.12 0.11 0.13 0.12 0.010 8.9%

6 0.14 0.13 0.13 0.13 0.008 5.9%

1 0.73 0.77 0.71 0.74 0.033 4.4%

2 1.34 1.34 1.25 1.31 0.050 3.8%

Batch 3 1.17 1.25 1.15 1.19 0.054 4.5%

Inner 4 0.10 0.11 0.11 0.11 0.005 5.1%

5 0.12 0.10 0.11 0.11 0.011 10.4%

6 0.10 0.09 0.11 0.10 0.009 8.5%

[0100] Note: Bold font is maximum and minimum value, respectively

[0101] Table 10 Reproducibility analysis based on VP4 recombinant protein

Number of Number of Number of Average Standard Coefficient of Batch Serum repetitions repetitions 2 repetitions 3 value deviation variation 1

1 0.92 1.00 0.89 0.94 0.064 6.8%

2 1.31 1.33 1.24 1.94 0.048 2.5%

Batch 3 1.06 1.07 1.02 1.05 0.027 2.6%

Inter 4 0.18 0.16 0.18 0.17 0.009 5.3%

5 0.20 0.18 0.22 0.20 0.019 9.5%

6 0.19 0.19 0.22 0.20 0.014 7.0%

1 0.92 0.93 0.95 0.93 0.017 1.7%

2 1.34 1.34 1.36 1.35 0.012 0.9%

Batch 3 1.06 1.06 1.08 1.06 0.011 1.1%

Inner 4 0.18 0.17 0.16 0.17 0.007 4.2%

5 0.19 0.19 0.20 0.19 0.008 3.9%

6 0.18 0.19 0.20 0.19 0.010 5.4%

[0102] Note: Bold font is maximum and minimum value, respectively

[0103] EMBODIMENT 4 Evaluation of specificity

[0104] (1) Cross Reaction

[0105] The cross-reaction with several common duck diseases was detected by ELISA detection method based on VP2 and VP4 recombinant proteins respectively, as shown in Figures 10 and 11, the reaction between VP2 and VP4 recombinant proteins and other common duck disease positive sera was negative, except DHAV-1 positive serum.

[0106] (2) Blocking test

[0107] DHAV-3 and DHAV-1 positive sera were blocked with DHAV-3 virus respectively. The results showed that the positive blocking rates of DHAV-3 against DHAV-3 serum enveloped with VP2 and VP4 recombinant protein were 67.4% and 70.5%, respectively, and the positive blocking rates of DHAV-1 against DHAV-1 serum enveloped with VP2 and VP4 recombinant protein were 63.8% and 68.3%, respectively, as shown in Table 11.

[0108] Table 11 Blocking test of VP2, VP4 recombinant protein

Serum Recombinant Before blocking After blocking Blocking rate protein

DHAV-3 VP2 1.098 0.359 67.4%

DHAV-1 VP2 0.884 0.320 63.8%

Negativity VP2 0.238 0.217 8.9%

DHAV-3 VP4 1.054 0.308 70.5%

DHAV-1 VP4 0.844 0.317 68.3%

Negativity VP4 0.197 0.165 16.2%

[0109] EMBODIMENT 5 Sensitivity evaluation

[0110] Based on the VP2 and VP4 recombinant proteins enveloped respectively, three DHAV-3 positive sera were detected simultaneously and diluted from 1:160 and 1:20, respectively. As shown in Tables 12 and 13, the VP2 recombinant protein was able to detect the maximum dilution of 1:5120 and the VP4 recombinant protein was able to detect the maximum dilution of 1:640.

[0111] Table 12 ELISA sensitivity based on VP2 recombinant protein

Serum 1:160 1:320 1:640 1:1280 1:2560 1:5120 1:10240 1:20480 sample 1 1.17 1.05 0.89 0.67 0.39 0.28 0.20 0.12 2 1.46 1.29 1.07 0.91 0.72 0.47 0.35 0.24 3 0.95 0.79 0.66 0.49 0.33 0.26 0.17 0.08 4 1.32 1.17 0.93 0.70 0.42 0.29 0.23 0.14

[0112] Note: Bold font is the maximum dilution degree

[0113] Table 13 ELISA sensitivity based on VP4 recombinant protein

Semu 1:40 1:80 1:160 1:320 1:640 1:1280 1:2560 1:5120

1 1.26 1.05 0.82 0.63 0.45 0.32 0.23 0.18 2 1.33 1.26 1.05 0.84 0.60 0.46 0.34 0.23 3 0.93 0.75 0.54 0.42 0.35 0.26 0.21 0.12 4 1.00 0.84 0.59 0.44 0.32 0.23 0.19 0.16

[0114] Note: Bold font is the maximum dilution degree

[0115] EMBODIMENT 6 Calculation of coincidence rate

[0116] In the invention, 30 clinical sera are detected, 15 positive and 15 negative are detected through neutralization reaction, and 13 and 11 positive sera and 15+2 and +4 negative sera are respectively detected through the detection method based on V2 and VP4 recombinant proteins. Compared with the neutralization test, the positive coincidence rates of VP2-ELISA and VP4-ELISA are 86.7% and 73.3% respectively, and the negative coincidence rates are 100%, and the total coincidence rates are 90.0% and 80.0% respectively. As shown in Table 14, the two detection methods established by the test have higher coincidence rates, and the coincidence rates of VP2-ELISA are higher than those of VP4-ELISA.

[0117] Table 14 Calculation of coincidence rate based on VP2 and VP4 ELISA methods

Sample type Neutralization test VP2-ELISA VP4-ELISA Positive serum 15 13 11 Negative serum 15 15+2 15+4 Positive coincidence / 86.7% 73.3% rate Negative coincidence / 100% 100% rate Total coincidence rate / 90% 80%

[0118] The indirect ELISA detection method in the invention based on VP2 and VP4 recombinant proteins has strong specificity, can specifically detect DHAV-3 positive serum, and does not generate cross reaction with the positive sera of other duck common diseases such as duck plague, Riemerella anatipestifer, duck plague, duck Escherichia coli, avian influenza, swelling disease, duck salmonella and other duck common diseases, and has negative detection results except for DHAV-1 positive serum. This indicates that the cross reaction between DHAV-1 and DHAV-3 exists, which is related to the similarity of DHAV-1 and DAV-3VP2 and VP4 proteins in amino acid level and base sequence level. Therefore, the establishment of indirect ELISA based on VP2 and VP4 recombinant protein provides the guarantee for the accuracy of detection of DHAV-3. At the same time, IgM is the main marker of early disease diagnosis. The IgG antigenic determinant on VP1 is the main marker of early disease diagnosis, and the IgM antigenic determinant is mainly on the surface of VP2 and VP3, so the method established in the test could provide reference basis to early diagnosis and early treatment of the disease to some extent, and the achievement of early diagnosis and early treatment could reduce the economic loss.

[0119] While there have been shown and described several preferred embodiments of the invention, it is to be understood, as previously described, that the invention is not limited to the forms disclosed herein, but is not to be construed as the exclusion of other embodiments, and that various other combinations, modifications, and environments may be utilized, and modifications may be made within the scope of the inventive concepts described herein, either by the above teachings or by techniques or knowledge of the relevant art. Modifications and variations made by those skilled in the art without departing from the spirit and scope of the invention are intended to be within the scope of the appended claims.

[0120] Sequence Listing

<110 > Sichuan Agricultural University

<130> 2017

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 702

<212> DNA

<213> VP2 recombinant gene

<400> 1

atgcaccatcatcatcatca ttcttctggtctggtgccacgcggttctgg tatgaaagaa 60

accgctgctg ctaaattcga acgccagcacatggacagcccagatctggg taccgacgac 120

gacgacaagg ccatggctga tatcggatccgaattcggtg acaacatctcacgtttagtc 180

catctacaca ctggacagtg gtccacacag catggtgtta ctacatgcct tagatggttg 240

gccactcctggatgttttta tacagttaatacccaaccag catatggaca aaccaggtat 300 tttaggttca tcagatgtgg ctaccacttc cgccttcttg tgaatgcacc atctggtgct 360 gctggtggac taatgatggt gtggatgcct tatccatatt gccgggttct cactggatct 420 tacaatgtgg atgcatcagt agatcgcagg tcgttgttaa atcttcccta tgccatcttg 480 gatctgcgca ccaacactga aattgacttg gttattccat atgtaaattt tagaaattat 540 gttgaaatta ctgccacaga tagtgttggt ggggccatat gtgtctttgt gttgggagct 600 tttacacatg ggtcaggaac ctccaatact gttgattata ctctctttgg tgagatgctt 660 gaaactgact tacaatgtcc tcggcctttt aatgaccagt aa 702

<210> 2

<211> 233

<212> PRT

<213> VP2 Recombinant Protein (VP2 recombination Protein)

<400> 2

Met His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser

1 5 10 15

Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gin His Met Asp

20 25 30

Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met Ala Asp Ile

35 40 45

Gly Ser Glu Phe Gly Asp Asn Ile Ser Arg Leu Val His Leu His Thr

50 55 60

Gly GIn Trp Ser Thr GIn His Gly Val Thr Thr Cys Leu Arg Trp Leu

70 75 80

Ala Thr Pro Gly Cys Phe Tyr Thr Val Asn Thr Gin Pro Ala Tyr Gly

85 90 95

Gin Thr Arg Tyr Phe Arg Phe Ile Arg Cys Gly Tyr His Phe Arg Leu

100 105 110

Leu Val Asn Ala Pro Ser Gly Ala Ala Gly Gly Leu Met Met Val Trp

115 120 125

Met Pro Tyr Pro Tyr Cys Arg Val Leu Thr Gly Ser Tyr Asn Val Asp

130 135 140

Ala Ser Val Asp Arg Arg Ser Leu Leu Asn Leu Pro Tyr Ala lle Leu

145 150 155 160

Asp Leu Arg Thr Asn Thr Glu Ile Asp Leu Val Ile Pro Tyr Val Asn

165 170 175

Phe Arg Asn Tyr Val Glu Ile Thr Ala Thr Asp Ser Val Gly Gly Ala

180 185 190

Ile Cys Val Phe Val Leu Gly Ala Phe Thr His Gly Ser Gly Thr Ser

195 200 205

Asn Thr Val Asp Tyr Thr Leu Phe Gly Glu Met Leu Glu Thr Asp Leu

210 215 220

GIn Cys Pro Arg Pro Phe Asn Asp GIn

225 230

<210> 3

<211> 738

<212> DNA

<213> VP4 recombination gene (VP4 Recombination gene)

<400> 3

atgagcgata aaattattca cctgactgacgacagttttg acacggatgt actcaaagcg 60

gacggggcga tcctcgtcga tttctgggca gagtggtgcg gtccgtgcaa aatgatcgcc 120

ccgattctgg atgaaatcgctgacgaatat cagggcaaactgaccgttgc aaaactgaac 180

atcgatcaaa accctggcac tgcgccgaaa tatggcatcc gtggtatccc gactctgctg 240

ctgttcaaaa acggtgaagt ggcggcaacc aaagtgggtg cactgtctaa aggtcagttg 300

aaagagttcc tcgacgctaa cctggccggt tctggttctg gccatatgca ccatcatcat 360

catcattctt ctggtctggt gccacgcggt tctggtatga aagaaaccgc tgctgctaaa 420

ttcgaacgcc agcacatgga cagcccagat ctgggtaccg acgacgacga caaggccatg 480

gctgatatcg gatccgaatt ccttcatcga atggatactc taactaaaaa cattgaagat 540

gaaactgtca agattattgg atcctgtgctgagaaggcacaagaagcaat ctctggtctt 600

ggagcagttg agagtgttgc ttcaactaac tctgtggttg ctactgcaaa tgctacaaca 660

acacaaacaa ttcctgatcc aacagatggt tccacagatg acttttattc atgttcctat 720

gaggttgggg cccagtaa 738

<210> 4

<211> 245

<212> PRT

<213> VP4 recombinant protein

<400> 4

Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr Asp

1 5 10 15

Val Leu Lys Ala Asp Gly Ala lle Leu Val Asp Phe Trp Ala Glu Trp

20 25 30

Cys Gly Pro Cys Lys Met Ile Ala Pro lle Leu Asp Glu Ile Ala Asp

35 40 45

Glu Tyr Gin Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp Gin Asn

50 55 60

Pro Gly Thr Ala Pro Lys Tyr Gly lle Arg Gly lle Pro Thr Leu Leu

70 75 80

Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys Val Gly Ala Leu Ser

85 90 95

Lys Gly Gin Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala Gly Ser Gly

100 105 110

Ser Gly His Met His His His His His His Ser Ser Gly Leu Val Pro

115 120 125

Arg Gly Ser Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gin

130 135 140

His Met Asp Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met

145 150 155 160

Ala Asp Ile Gly Ser Glu Phe Leu His Arg Met Asp Thr Leu Thr Lys

165 170 175

Asn Ile Glu Asp Glu Thr Val Lys Ile Ile Gly Ser Cys Ala Glu Lys

180 185 190

Ala Gin Glu Ala Ile Ser Gly Leu Gly Ala Val Glu Ser Val Ala Ser

195 200 205

Thr Asn Ser Val Val Ala Thr Ala Asn Ala Thr Thr Thr Gin Thr lIle

210 215 220

Pro Asp Pro Thr Asp Gly Ser Thr Asp Asp Phe Tyr Ser Cys Ser Tyr

225 230 235 240

Glu Val Gly Ala Gln

245

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence

<400> 5

ccggaattcc ttcatgcaat ggatactcta ac 32

<210> 6

<211> 31

<212> DNA

<213> Artificial sequence

<400> 6

ccgctcgagt tactgggccc caacctcata g 31

<210> 7

<211> 31

<212> DNA

<213> Artificial sequence

<400> 7

ccggaattcg gtgacaacat ctcacgttta g 31

<210> 8

<211> 33

<212> DNA

<213> Artificial sequence

<400> 8 ccgctcgagt tactggtcat taaaaggccg agg 33

[0121] Although the invention has been described with reference to specific examples, it will be appreciated by those skilled in the art that the invention may be embodied in many other forms, in keeping with the broad principles and the spirit of the invention described herein.

[0122] The present invention and the described embodiments specifically include the best method known to the applicant of performing the invention. The present invention and the described preferred embodiments specifically include at least one feature that is industrially applicable

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. An indirect ELISA detection kit for detecting the DHAV-3 antibody based on VP2 or VP4 recombinant protein antigen, which is characterized in that the kit takes VP2 or VP4 recombinant protein as the envelope antigen.

2. The kit described in claim 1 is characterized in that the amino acid sequence of the VP2 recombinant protein is shown as SEQ ID NO.2; and the amino acid sequence of the VP4 recombinant protein is shown as SEQ ID NO.4.

3. The kit described in claim 1 is characterized in that the VP2 recombinant protein exists in the form of the inclusion body and the VP4 recombinant protein exists in the form of the supernatant.

4. The kit described in claim 1 is characterized in that the kit comprises an enzyme labeled second antibody, which is HRP-labeled anti-duck IgG.

5. An indirect ELISA detection method of the DHAV-3 antibody based on the VP2 or VP4 recombinant protein antigen, which is characterized by comprising the following steps:

(1) Envelope ELISA plate: Diluting purified VP2 or VP4 recombinant protein with the envelope solution, adding it into the ELISA plate, 100L/hole, incubating at 37°C for 1 hour, and then overnight at 4°C;

(2) Washing the ELISA plate: Taking out the enveloped ELISA plate, discarding antigen liquid, washing the plate with PBST for 5 times, 5min/time, and patting dry the liquid in the hole on filter paper after the last washing;

(3) Blocking: Adding the blocking solution into the ELISA plate, 250tL/hole 37C, and blocking for 1 hour;

(4) Washing the ELISA plate: The washing method is as in step (2);

(5) Diluting the DHAV-3 serum, adding the diluted DHAV-3 duck serum primary antibody to be detected, 100L/hole, 37C, and conducting incubation;

(6) Washing the ELISA plate: The washing method is as in step (2);

(7) Adding the enzyme labeled second antibody:

Diluting HRP labeled anti-duck IgG in the ratio of 1:2000, adding diluted HRP labeled anti-duck IgG, 100 L/hole , 37°C, and conducting incubation;

(8) Washing the ELISA plate: The washing method is as in step (2);

(9) And color development and stopping color development: Adding TMB color development solution, 100 L/hole, performing color development for 10 min, adding 2 mol/L H2SO4 with equal volume to stop the reaction, and determining OD4nm.

6. The indirect ELISA detection method described in claim 5 is characterized in that the envelope solution in step (1) is 0.05 mol/L pH 9.6 carbonate buffer solution; The envelope condition of the VP2 recombinant protein is of 1:1600 protein dilution (2.23[tg/mL), and the optimal envelope condition of the VP4 recombinant protein is of 1:2000 protein dilution (2.6[tg/mL).

7. The indirect ELISA detection method described in claim 5 is characterized in that the indirect ELISA detection method described in claim 6 is characterized in that the blocking solution of the VP2 recombinant protein in step (3) is 1% of skim milk powder, and the blocking solution of the VP4 recombinant protein is 5% of skim milk powder.

8. The indirect ELISA detection method described in claim 5 is characterized in that the incubation time of the serum to be detected of the VP2 recombinant protein in step (5) is 1 hour, the DHAV-3 serum is diluted in the ratio of 1:160; And the incubation time of the serum to be detected of the VP4 recombinant protein is 0.5 hour, and the DHAV-3 serum is diluted in the ratio of 1:20.

9. The indirect ELISA detection method described in claim 5 is characterized in that the enzyme labeled second antibody incubation time of the VP2 recombinant protein in step (7) is 0.5 h, and the enzyme labeled second antibody incubation time of the VP4 recombinant protein is 1 h.

10. Application of the kit described in any of claims 1-5 for detecting the level of the DHAV-3 antibody based on VP2 or VP4 recombinant protein antigens.