CN109369796A - A kind of enzyme-linked immunoassay method detecting sheep Toxoplasma Gondi IgG antibody - Google Patents
A kind of enzyme-linked immunoassay method detecting sheep Toxoplasma Gondi IgG antibody Download PDFInfo
- Publication number
- CN109369796A CN109369796A CN201811127705.4A CN201811127705A CN109369796A CN 109369796 A CN109369796 A CN 109369796A CN 201811127705 A CN201811127705 A CN 201811127705A CN 109369796 A CN109369796 A CN 109369796A
- Authority
- CN
- China
- Prior art keywords
- sheep
- toxoplasma
- enzyme
- gra1
- igg antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
- C07K14/45—Toxoplasma
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56905—Protozoa
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/44—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from protozoa
- G01N2333/45—Toxoplasma
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2469/00—Immunoassays for the detection of microorganisms
- G01N2469/20—Detection of antibodies in sample from host which are directed against antigens from microorganisms
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of toxoplasma dense granule protein GRA1, and the nucleotide sequence of encoding said proteins is as shown in SEQ ID NO:1.The invention also discloses the dense granule protein GRA1 to prepare application and a kind of enzyme-linked immunoassay method for detecting sheep Toxoplasma Gondi IgG antibody in sheep toxoplasmosis enzyme-linked immunologic detecting kit, and this method, which is used to detect toxoplasmosis, has many advantages, such as that high sensitivity, high specificity, accuracy are good, fast and convenient.
Description
Technical field
The present invention relates to a kind of enzyme-linked immunoassay methods (ELISA) for detecting sheep Toxoplasma Gondi IgG antibody, and the invention further relates to one
Kind can be with the toxoplasma dense granule protein GRA1 of sheep Toxoplasma Gondi IgG antibody specific reaction.
Technical background
Toxoplasma is a kind of worldwide widely distributed Zoonosis parasitic protozoa, can cause people and a variety of dynamic
Object illness, it is estimated that, there are about 1/3 people's toxoplasma gondii infections in the whole world.In animal, the infection rate highest of pig, generally 20% with
On, some farms are even as high as 100%.Sheep is most sensitive to toxoplasma animal in addition to mouse, after sheep infection toxoplasma
Easily cause miscarriage, stillborn foetus, weak tire etc., some country, up to 20% sheep miscarriage be by arch insect infection caused by, give
Animal husbandry brings very big loss.In China, flock of sheep average rate reaches 10% or so in the northern and northwestward
20% or higher.Although there is the vaccine for being directed to sheep toxoplasmosis in the world at present, security risk is larger, not by big model
Enclose use.
Due to the different animal of arch insect infection, its expression conditions is variant, and different animals exempt from arch insect infection
Epidemic disease response intensity is also different, and arch insect infection does not have characteristic clinical symptoms for identifying, and the country is also without any inspection
Mark standard and product, so the diagnosis of toxoplasmosis seems particularly difficult, especially for pregnant domestic animal.Detection toxoplasmosis at present
Main method have pathogeny detection, molecular Biological Detection and serological method.Pathogeny detection is from isolated pathological material of disease
Egg capsule or trophozoite are detected, the method is accurate and reliable, but time and effort consuming, and recall rate is low and should not be checked on a large scale.Molecule
Biological method mainly includes PCR, sensitive, special, is the important means of laboratory toxoplasmosis diagnosis.Serological method is benefit
Detect toxoplasma antibody or antigen with immunological response, be broadly divided into LAT (latex agglutination test), IHA (indirect hemagglutination test),
IFA (indirect immunofluorescence assay), ELISA (enzyme-linked immunosorbent assay) etc..Wherein ELISA method sensibility is strong, specific
Height, easily realization automatic operation is fast and convenient, to operator without particular/special requirement, can handle a large amount of samples in a short time
Product are suitable for field investigation and popularization, therefore are widely paid close attention to.
Summary of the invention
The purpose of the present invention is establishing a kind of enzyme-linked immunoassay method for detecting sheep Toxoplasma Gondi IgG antibody, of the invention is another
Purpose be to provide it is a kind of can be with the toxoplasma dense granule protein GRA1 of sheep Toxoplasma Gondi IgG antibody specific reaction.
Concrete scheme of the invention the following steps are included:
After extracting Toxoplasma RNA, cDNA is obtained using Takara reverse transcription reagent box, according to required target fragment benefit
Target fragment is expanded by PCR method with clonmanager molecular cloning software design relevant primer, with the side of homologous recombination
GRA1-CDs segment is connected on pE-SUMO carrier by method, after digestion identification sequence verification is errorless, by the pE-SUMO- of building
GRA1 plasmid is gone in e. coli bl21 (DE3) for expressing.PE-SUMO-GRA1 expression bacterial strain is expanded into culture, separate,
Toxoplasma dense granule protein GRA1 is obtained after purification, and the nucleotide sequence of encoding said proteins is as shown in SEQ ID NO:1.
The albumen can be used for preparing sheep toxoplasmosis enzyme-linked immunologic detecting kit or for the non-of sheep Toxoplasma Gondi IgG antibody
Diagnostic purpose enzyme linked immunosorbent detection.
Using dense granule protein GRA1 as the terms and conditions of candidate antigens optimization ELISA, detection sheep Toxoplasma Gondi IgG is obtained
The enzyme-linked immunoassay method of antibody, method includes the following steps:
1) by coated elisa plate after toxoplasma dense granule protein GRA1 dilution；
2) ELISA Plate is closed with confining liquid；
3) ELISA Plate, 37 DEG C of incubation 1h are added after diluting lowlenthal serum；
4) ELISA Plate, 37 DEG C of incubation 45min will be added after the rabbit-anti sheep IgG dilution of HRP label；
5) developing solution is added, room temperature is protected from light chromogenic reaction, reads at 630nm wavelength after reaction terminating.
Preferably, the final concentration of 1.25 μ g/mL after the GRA1 albumen dilution.
Preferably, the diluted multiple of the lowlenthal serum is 100 times of volume.
Preferably, the diluted multiple of rabbit-anti sheep IgG of the HRP label is 5000 times of volume.
Preferably, the time of the chromogenic reaction is 10min.
The beneficial effects of the present invention are:
The present invention has been successfully established the enzyme-linked immunoassay method for sheep Toxoplasma Gondi IgG antibody, compared with other detection methods
The present invention has the following advantages:
1. this method high sensitivity: the GRA1-iELISA diagnostic method sensibility that the present invention is built as the result is shown is greater than 1:
100, meet the demand of on-site test.
2. this method specificity is good: this method is not sent out with sheep Mohs Babesia, Theileria luwenshuni, twisted blood trichina
Raw cross reaction.
3. this method is fast and convenient: easily realization automatic operation can be located in a short time to operator without particular/special requirement
Manage a large amount of samples.
4. this method testing result is simple: can directly be qualitatively judged according to reading size (ratio) as sheep toxoplasma sun
Property/feminine gender.
Detailed description of the invention
Fig. 1 is the PCR amplification of toxoplasma GRA1 coded sequence of the present invention as a result, in figure: swimming lane M:DNA molecular mass mark
It is quasi-；1:GRA1 coded sequence amplified production.
Fig. 2 is the PCR amplification of pE-SUMO of the present invention as a result, in figure: swimming lane M:DNA molecular mass standard；1:pE-SUMO
Vector amplification product.
Fig. 3 is the qualification result of recombinant plasmid pE-SUMO-GRA1 of the present invention, in figure: swimming lane M: protein standard substance；1:pE-
SUMO-GRA1 plasmid enzyme restriction product.
Fig. 4 figure is that the SDS-PAGE of pE-SUMO-GRA1 expression product of the present invention is analyzed as a result, in figure: swimming lane M: albumen point
Protonatomic mass standard；1: induction His-GRA1；2: not inducing His-GRA1.
Specific embodiment
Embodiment 1: the preparation of dense granule protein GRA1
After extracting Toxoplasma RNA, cDNA is obtained using Takara reverse transcription reagent box, according to required target fragment benefit
Target fragment is expanded by PCR method with clonmanager molecular cloning software design relevant primer, with the side of homologous recombination
GRA1-CDs segment is connected on pE-SUMO carrier by method, after digestion identification sequence verification is errorless, by the pE-SUMO- of building
GRA1 plasmid is gone in e. coli bl21 (DE3) for expressing.
The acquisition of 1.GRA1 target fragment
(1) extraction of toxoplasma RNA
The polypide of collection is centrifuged, supernatant is abandoned, by sample after precipitating is resuspended in addition 1ml Trizol, and piping and druming mixes repeatedly
1.5ml is transferred to without in the centrifuge tube of RNase, vortex 3min is acutely shaken, cracks polypide sufficiently, be placed at room temperature for 10min；It presses
200 μ L chloroforms/mL Trizol is added chloroform and is stored at room temperature 2~3min with forced oscillation 15sec；4 DEG C, 12000rpm centrifugation
15min；Careful upper strata aqueous phase of drawing is placed in new 1.5mL without in the centrifuge tube of RNase, isometric isopropanol is added, sufficiently
After mixing, it is placed in precipitation at room temperature 10min；4 DEG C, 12000rpm is centrifuged 10min, abandons supernatant, and RNA will be sunk in the form of white precipitate
In tube bottom；75% ethyl alcohol that 1mL is made into DEPC water is added, overturns centrifuge tube, washing precipitating；4 DEG C, 7500rpm is centrifuged 5min,
It discards supernatant, is air-dried in super-clean bench as far as possible；30 μ L are added without RNase DEPC water, dissolve RNA precipitate；With 1.5% agarose
Gel electrophoresis identifies extracted total serum IgE quality and measures total rna concentration and purity by ultraviolet specrophotometer.
(2) preparation of toxoplasma cDNA
It takes the μ g total serum IgE of 0.1ng~5 to obtain cDNA by Takara reverse transcription reagent box as needed, is added in sequence
Following reactant:
Step 1:
The μ of total serum IgE 0.1ng~5 g
Oligo(dT)18 1μL
The high purity water of nuclease free is mended to 12 μ L
65 DEG C of reaction 5min, cooled on ice in PCR instrument.Following component is added in sequence:
42 DEG C of 60min in PCR instrument, 70 DEG C of 5min, -20 DEG C of product storages.
(3) PCR amplification of target fragment
The cDNA that reverse transcription is obtained specifically draws as the template of amplifying target genes coded sequence, the upstream and downstream of the gene
Object is GRA1-F (CCGGTGGTGGTGGTGGAATTCATGGCAGA respectively by clonmanager molecular cloning software design
CCAGCTGAC), GRA1-R (CAGTCACGATGAATTAAGCTTTTACTTTGCCATCATCATTTTAACG), is expanded by PCR
Increase, obtain the band that size is 579bp, in the same size, the result is shown in Figure 1 of prediction, recycles the segment with gel reclaims kit.
According to the sequence of commercialization pE-SUMO plasmid, the upstream primer of clonmanager software design amplification pE-SUMO carrier is utilized
SUMO-F and downstream primer SUMO-R.Using pE-SUMO plasmid as template, PCR amplification obtains the band of 5727bp size, with expection
Unanimously, as a result see Fig. 2, recycle the segment with gel reclaims kit.
PCR reaction system is as follows:
PCR reaction condition is as follows:
(4) target fragment recycles
Illustrate to be operated according to DNA Ago-Gel QIAquick Gel Extraction Kit, the target fragment of single band is cut
Glue recycling, is put into 1.5mL centrifuge tube；It is added the sol solutions of 3 times of volumes, 55 DEG C of water-baths act on 10min, and every 2min is by centrifuge tube
It is mixed by inversion once, melts gel sufficiently；The gel liquid of thawing is cooled to room temperature, is added in DNA recovery column, room temperature
Stand 5~10min；12000rpm room temperature is centrifuged 1min, discards efflux in collecting pipe；650 μ L washing is added into recovery column
Liquid, 12000rpm room temperature are centrifuged 1min, discard efflux in collecting pipe；Empty recovery column 12000rpm is centrifuged 2min, discards receipts
Remaining efflux, recovery column is put into new 1.5mL centrifuge tube in collector, and drying at room temperature makes remaining ethyl alcohol volatilize；To return
10~30 μ L aqua sterilisas that 65 DEG C of preheatings are added on column intermediate coat are received, 5~10min, the centrifugation of 12000rpm room temperature are stored at room temperature
2min collects trickle, -20 DEG C of preservations.
The building of 2.pE-SUMO-GRA1 plasmid
Using the method for homologous recombination, GRA1-CDS segment is connected with pE-SUMO carrier segments, with heat shock after connection
Method, connection product is transferred in competent escherichia coli cell DH5 α, and converted product is applied to the LB with ammonia benzyl resistance
On plate, it is inverted growth overnight, picking single colonie expands culture and extracts plasmid, and carries out digestion verification to it.Digestion verification is just
True plasmid, then carry out sequence verification.Recombinant plasmid obtains the band of 4094bp and 2212bp after digestion, the result and pre-
Phase is consistent, illustrates the integrality of the pE-SUMO-GRA1 plasmid of building, as a result sees Fig. 3.By the plasmid pE- Jing Guo digestion verification
GRA1-CDS in SUMO-GRA1 is sequenced, and sequencing result is compared with the CDS of the GRA1 gene in database, the two
It can exactly match, the base of frameshit or mutation do not occur, which proves recombinant expression plasmid pE-SUMO-GRA1 structure
Build up function.
(1) homologous recombination construction plasmid
Multiple clips Cloning Kit is only praised according to promise to illustrate to be operated, according to the system configurations in specification:
After aforesaid liquid is mixed, converted after 37 DEG C of reactions 30min, ice bath 5min in PCR instrument.
The most suitable usage amount of every segment=[0.02 × segment base logarithm] ng (0.03pmol).
(2) connection product converts
The Escherichia coli Competent cell for taking -80 DEG C of preservations, melts on ice；It is added connection product (or plasmid), mixes
It is even, 30min is placed on ice；42 DEG C of water-bath thermal shocks swash 90sec, take out rapidly, ice bath 2min；
400 μ L antibiotic-free LB liquid mediums, 37 DEG C of 180rpm recovery culture 60min are added；300 μ L are taken to be coated on phase
On the LB plate answered, it is inverted in 37 DEG C of 10~12h of culture.
3. the expression and purifying of dense granule protein GRA1
The successful prokaryotic expression plasmid pE-SUMO-GRA1 of above-mentioned building is transformed into Bacillus coli expression competence bacterial strain
In BL21 (DE3), the bacterium solution after conversion is applied on the LB plate with ammonia benzyl resistance, 37 DEG C of overnight incubations choose single colonie, expand
Big culture is 37 DEG C, shake speed 180rpm/min in cultivation temperature, induction time is with the IPTG of final concentration of 1.0mM
Inducing expression is carried out under conditions of 4h, and the control group not induced is set.It does not lure the induction group after inducing expression and
The bacterium solution collection bacterium of group is led, supernatant is abandoned, carries out SDS-PAGE analysis after sample treatment, as a result see Fig. 4.As a result, it has been found that with not luring
It leads group to compare, induction group has a thicker protein band at 38kDa, illustrates that recombinant plasmid pE-SUMO-GRA1 is smoothly feeling
By expression in state bacterial strain BL21 (DE3).Bacterium is expressed with above-mentioned the same terms culture and induction SUMO-GRA1, then carries out pressure
Broken, 12000rpm is centrifuged 10min and separates supernatant inclusion body, handles the sampling of supernatant inclusion body, is SDS- later
PAGE analysis, the analysis the result shows that, compared with inclusion body sample, most of SUMO-GRA1 expression is in supernatant.
PE-SUMO-GRA1 expression bacterial strain is expanded into culture, 37 DEG C of the inducer (IPTG) that final concentration of 1.0mM is added lures
4h is led, thalline were collected by centrifugation, is crushed thallus, 4 DEG C of centrifuging and taking supernatants, by the filter of supernatant 0.45um with pressure breaking instrument
Then in conjunction with the affinity column of his label overnight filtering with the imidazoles of various concentration, elutes albumen from low to high, will wash
The albumen taken off does SDS-PAGE analysis, and then the preferable albumen of purity is dialysed and is concentrated, is surveyed through BCA protein concentration
Determine kit measurement protein concentration.
Embodiment 2: fast and accurately sheep toxoplasmosis field diagnostic method (GRA1-iELISA) is established
1. (1) determination of antigen coat concentration and serum diluting multiple: GRA1 albumen is pressed 5 μ g/mL, 2.5 μ g/ respectively
The gradient dilution of mL, 1.25 μ g/mL, 0.625 μ g/mL, 0.3125 μ g/mL, coated elisa plate, each concentration are coated with a file 5
Hole.Positive and negative control serum is pressed into 1:25,1:50,1:100,1:200,1:400 dilution, each dilution with heat preservation liquid respectively
It is added to 5 hole of a row.It is operated by ELISA conventional steps, measures OD with microplate reader630Value, the corresponding P/N value of more each antigen
Size, the corresponding antigen coat concentration of P/N value maximum for selecting wherein optimal antigen and serum diluting multiple are as best
Condition.
(2) the most preferably optimization of closing concentration and best off-period: dilute according to the antigen coat concentration and serum that have optimized
The optimum condition for releasing multiple carries out the optimization of closing concentration and off-period.Fix other experimental conditions, respectively with 0.5%,
1%, 1.5%, 2% BSA (bovine serum albumin(BSA)) closes 20min, 30min, 45min, 60min, grasps by ELISA conventional steps
Make, is read with microplate reader, be depicted as line chart, compare OD630Locate the size of P/N (positive serum/negative serum) value, selects P/N
It is worth the corresponding closing concentration of maximum and off-period as optimum condition.
(3) optimization of serum the best use time: according to the above-mentioned condition determined, fixing other experimental conditions, is added
30min, 45min, 60min, 75min are acted on after serum respectively, is operated by ELISA conventional steps, blood is selected according to P/N value size
Clear action time.
(4) according to the above-mentioned condition determined, other test bars the optimization of secondary antibody the best use concentration and time: are fixed
ELIAS secondary antibody is pressed the dilution proportion of 1:3000,1:4000,1:5000,1:6000 by part respectively, is operated by ELISA conventional steps,
Secondary antibody activity is selected according to P/N value size.Similarly, other experimental conditions are fixed, are acted on respectively after ELIAS secondary antibody is added
30min, 45min, 60min, 75min are operated by ELISA conventional steps, select secondary antibody action time according to P/N value size.
(5) other experimental conditions are fixed in the optimization of substrate the best use time, make respectively substrate-function 5min, 7.5min,
10min, 12.5min are operated by ELISA conventional steps, select the substrate-function time according to P/N value size.
It is final to determine that detection method is as follows:
1) GRA1 albumen is diluted to final concentration of 1.25 μ g/mL, coated elisa plate with dilution；
2) with confining liquid closing ELISA Plate (best off-period is 30min)；
3) ELISA Plate, 37 DEG C of incubation 1h are added after lowlenthal serum being diluted 100 times with dilution；
4) ELISA Plate, 37 DEG C of incubation 45min are added after the rabbit-anti sheep IgG that HRP is marked being diluted 5000 times with dilution；
5) developing solution is added, room temperature is protected from light colour developing 10min, is eventually adding hydrofluoric acid and terminates reaction, reads at 630nm wavelength
Number.
2. the determination of sheep Toxoplasma indirect ELISA detection kit yin-yang critical value
Detection is detected as 40 parts of lowlenthal serum samples of sheep Toxoplasma Gondi IgG antibody feminine gender through indirect immunofluorescence (IFA), together
When set standard positive control and negative control, through be repeated several times detect OD630Value, the final yin and yang attribute critical value for determining this method
Criterion is as follows:
Positive control mean OD value (PC): greater than 0.7；
Negative control mean OD value (NC): less than 0.3；
Cut-off value calculating method :+3 standard deviation (SD) of average value (X)
The criterion of yin and yang attribute boundary line:
S (sample OD630Value) >=0.324 and S/N >=2.3 can be judged to the positive；It otherwise is feminine gender.
It the results are shown in Table 1.
1 critical point of table determines result
Detailed operating procedures are as follows:
GRA1 albumen is diluted to final concentration of 1.25 μ g/mL with carbonate coating buffer (pH 9.6), coated elisa plate,
4 DEG C overnight.3 are washed with 200ul PBS-T (0.01mol/L PBS, 0.05%Tween-20, pH 7.4) washing buffer in every hole
It is secondary, with 1% BSA (bovine serum albumin(BSA)), 37 DEG C of closing 30min of preparation.0.1% BSA of lowlenthal serum is pressed into 1:100
100uL is added in every hole after dilution, and each sample sets 3 repetitions, and in 37 DEG C of incubation 1h.Then PBS-T (0.01mol/L is used
PBS, 0.05%Tween-20, pH 7.4) washing buffer washing 3 times, it will be by the rabbit-anti sheep of the diluted HRP label of 1:5000
IgG is added with the every hole 100ul/, 37 DEG C of incubation 45min.Every hole be added 100uL developing solution (substrate buffer solution: mother liquor=1 TMB:
19,0.2uL/mL 30% hydrogen peroxide), room temperature is protected from light colour developing 10min.The hydrofluoric acid that 50uL0.25% is added in last every hole is whole
It only reacts, is read at 630nm wavelength.If sample OD630 values>=0.324 and S (sample OD630 values)/N (negative serum OD630 values)≥
2.3 are judged to the positive；Conversely, being then judged to feminine gender.
Embodiment 3: sheep Toxoplasma indirect ELISA detection method sensitivity tests and specific test
According to embodiment 2 method to 5 parts of positive serums respectively make 1:25,1:50,1:100,1:200,1:400,1:800,
1:1600 dilution is detected, and sets positive, negative, blank control.It the results are shown in Table 2.The GRA1- that the present invention is built as the result is shown
IELISA diagnostic method sensibility is greater than 1:100.With the method for foundation to goat without slurry positive serum, goat Mohs babe this
Worm positive serum, goat Theileria luwenshuni positive serum, haemonchus contortus positive serum are detected.It the results are shown in Table 3.As a result
It shows that this method specificity is good, cross reaction does not occur with sheep Mohs Babesia, Theileria luwenshuni, twisted blood trichina.
2 sensitivity tests result of table
| Extension rate | 1:25 | 1:50 | 1:100 | 1:200 | 1:400 | 1:800 | 1:1600 |
| Serum 1 | 1.219 | 1.138 | 1.099 | 0.993 | 0.943 | 0.887 | 0.729 |
| Serum 2 | 0.737 | 0.56 | 0.493 | 0.316 | 0.172 | 0.115 | 0.078 |
| Serum 3 | 1.102 | 0.899 | 0.864 | 0.696 | 0.464 | 0.291 | 0.162 |
| Serum 4 | 0.833 | 0.68 | 0.562 | 0.38 | 0.211 | 0.128 | 0.089 |
| Serum 5 | 1.22 | 1.088 | 1.099 | 0.998 | 0.902 | 0.838 | 0.675 |
3 specific test result of table
| Classification | Sheep is without slurry | Sheep Mohs Babesia | Sheep Theileria luwenshuni | Sheep haemonchus contortus |
| OD630Value | 0.376 | 0.254 | 0.305 | 0.173 |
| There is no cross reaction | Have | Nothing | Nothing | Nothing |
Embodiment 4: sheep Toxoplasma indirect ELISA detection method repetitive test
Repetitive test repeats test including batch interior repetition test and between criticizing.Test is repeated in batch to be coated with using same batch
ELISA Plate, 3 parts of positive serums and 2 parts of negative serums are carried out according to optimized good condition in five different times respectively
Detection, and calculate its average value, standard deviation and the coefficient of variation.It the results are shown in Table 4.Test is repeated between batch takes five batch coatings respectively
ELISA Plate 3 parts of positive serums and 2 parts of negative serums are detected according to optimized good condition in the same time, and count
Calculate its average value, standard deviation and the coefficient of variation.It the results are shown in Table 5.As can be seen from the test results, the test coefficient of variation is repeated in criticizing
Less than 10%, illustrate repeated good；The test coefficient of variation is repeated between batch less than 10%, is illustrated repeated good.
4 batches, table interior repetition test results
Test result is repeated between 5 batches, table
Sequence table
<110>Hua Zhong Agriculture University
<120>a kind of enzyme-linked immunoassay method for detecting sheep Toxoplasma Gondi IgG antibody
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 570
<212> DNA
<213>toxoplasma (Toxoplasma gondii)
<400> 1
atggtgcgtg tgagcgctat tgtcggagct gctgcatcgg tgttcgtgtg cctgtctgcc 60
ggcgcttacg ctgccgaagg cggcgacaac cagtcgagcg ccgtctcaga tcgggcgtct 120
ctctttggtt tgctgagtgg agggacaggg cagggattag gaatcggaga atctgtagat 180
ttggagatga tggggaacac gtatcgtgtg gagagaccca caggcaaccc ggacttgctc 240
aagatcgcca ttaaagcttc agatggatcg tacagcgaag tcggcaatgt taacgtggag 300
gaggtgattg atactatgaa aagcatgcag agggacgagg acattttcct tcgtgcgttg 360
aacaaaggcg aaacagtaga ggaagcgatc gaagacgtgg ctcaagcaga agggcttaat 420
tcggagcaaa ccctgcaact ggaagatgca gtgagcgcgg tggcgtctgt tgttcaagac 480
gagatgaagg tgatcgacga tgtgcagcag cttgaaaagg acaaacaaca gcttaaggat 540
gacattgggt tcctaacagg agagagagag 570
Claims (7)
1. toxoplasma dense granule protein GRA1, the nucleotide sequence of encoding said proteins is as shown in SEQ ID NO:1.
2. toxoplasma dense granule protein GRA1 described in claim 1 is in preparation sheep toxoplasmosis enzyme-linked immunologic detecting kit
In application.
3. a kind of enzyme-linked immunoassay method for detecting sheep Toxoplasma Gondi IgG antibody, it is characterised in that the following steps are included:
1) by coated elisa plate after toxoplasma dense granule protein GRA1 described in claim 1 dilution；
2) ELISA Plate is closed with confining liquid；
3) ELISA Plate, 37 DEG C of incubation 1h are added after diluting lowlenthal serum；
4) ELISA Plate, 37 DEG C of incubation 45min will be added after the rabbit-anti sheep IgG dilution of HRP label；
5) developing solution is added, room temperature is protected from light chromogenic reaction, reads at 630nm wavelength after reaction terminating.
4. the enzyme-linked immunoassay method of detection sheep Toxoplasma Gondi IgG antibody as claimed in claim 3, it is characterised in that: the GRA1 egg
Final concentration of 1.25 μ g/mL after white dilution.
5. the enzyme-linked immunoassay method of detection sheep Toxoplasma Gondi IgG antibody as claimed in claim 3, it is characterised in that: the blood of goats
Clear diluted multiple is 100 times of volume.
6. the enzyme-linked immunoassay method of detection sheep Toxoplasma Gondi IgG antibody as claimed in claim 3, it is characterised in that: the HRP label
The diluted multiple of rabbit-anti sheep IgG be 5000 times of volume.
7. the enzyme-linked immunoassay method of detection sheep Toxoplasma Gondi IgG antibody as claimed in claim 3, it is characterised in that: the colour developing is anti-
The time answered is 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811127705.4A CN109369796A (en) | 2018-09-27 | 2018-09-27 | A kind of enzyme-linked immunoassay method detecting sheep Toxoplasma Gondi IgG antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811127705.4A CN109369796A (en) | 2018-09-27 | 2018-09-27 | A kind of enzyme-linked immunoassay method detecting sheep Toxoplasma Gondi IgG antibody |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109369796A true CN109369796A (en) | 2019-02-22 |
Family
ID=65402131
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811127705.4A Pending CN109369796A (en) | 2018-09-27 | 2018-09-27 | A kind of enzyme-linked immunoassay method detecting sheep Toxoplasma Gondi IgG antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109369796A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110229827A (en) * | 2019-05-22 | 2019-09-13 | 华中农业大学 | A kind of dog Ji Shi Babesia surface protein and its application |
| CN114524869A (en) * | 2022-01-25 | 2022-05-24 | 华中农业大学 | Toxoplasma gondii microglin MIC17a and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101137674A (en) * | 2005-03-08 | 2008-03-05 | 肯顿有限公司 | Chimeric recombinant antigens of toxoplasma gondii |
| CN101373189A (en) * | 2008-04-29 | 2009-02-25 | 北京科美东雅生物技术有限公司 | Chemical luminescence immune analysis diagnosis reagent kit detecting Toxoplasma Gondi IgG antibody and preparation method thereof |
| CN101812516A (en) * | 2010-01-11 | 2010-08-25 | 华中农业大学 | Molecular detection method for toxoplasma in soil |
| US20150204876A1 (en) * | 2012-07-23 | 2015-07-23 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Protein microarray for characterizing the specificity of the monoclonal immunoglobulins of mgus or myeloma patients |
| KR101581036B1 (en) * | 2014-07-30 | 2015-12-29 | 주식회사 바이오노트 | Composition and kit for diagnosing acute and chronic Toxoplasma gondii infection and method for diagnosing acute and chronic Toxoplasma gondii infection |
| CN105759030A (en) * | 2016-03-15 | 2016-07-13 | 中国农业大学 | Colloidal gold test strip for testing toxoplasma gondii antibodies |
| WO2018002938A1 (en) * | 2016-06-29 | 2018-01-04 | Ramot At Tel-Aviv University Ltd. | Engineered parasites for delivering protein to the central nervous system (cns) |
-
2018
- 2018-09-27 CN CN201811127705.4A patent/CN109369796A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101137674A (en) * | 2005-03-08 | 2008-03-05 | 肯顿有限公司 | Chimeric recombinant antigens of toxoplasma gondii |
| CN101373189A (en) * | 2008-04-29 | 2009-02-25 | 北京科美东雅生物技术有限公司 | Chemical luminescence immune analysis diagnosis reagent kit detecting Toxoplasma Gondi IgG antibody and preparation method thereof |
| CN101812516A (en) * | 2010-01-11 | 2010-08-25 | 华中农业大学 | Molecular detection method for toxoplasma in soil |
| US20150204876A1 (en) * | 2012-07-23 | 2015-07-23 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Protein microarray for characterizing the specificity of the monoclonal immunoglobulins of mgus or myeloma patients |
| KR101581036B1 (en) * | 2014-07-30 | 2015-12-29 | 주식회사 바이오노트 | Composition and kit for diagnosing acute and chronic Toxoplasma gondii infection and method for diagnosing acute and chronic Toxoplasma gondii infection |
| CN105759030A (en) * | 2016-03-15 | 2016-07-13 | 中国农业大学 | Colloidal gold test strip for testing toxoplasma gondii antibodies |
| WO2018002938A1 (en) * | 2016-06-29 | 2018-01-04 | Ramot At Tel-Aviv University Ltd. | Engineered parasites for delivering protein to the central nervous system (cns) |
Non-Patent Citations (9)
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110229827A (en) * | 2019-05-22 | 2019-09-13 | 华中农业大学 | A kind of dog Ji Shi Babesia surface protein and its application |
| CN114524869A (en) * | 2022-01-25 | 2022-05-24 | 华中农业大学 | Toxoplasma gondii microglin MIC17a and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109709338B (en) | Enzyme linked immunosorbent assay kit for detecting skeletal muscle troponin I of cattle or sheep and preparation method and application thereof | |
| CN105906714B (en) | A kind of preparation and application of brucellosis specific fusion protein antigen | |
| CN105606826B (en) | A kind of kit of enzyme linked immunosorbent detection fowl chlamydia psittaci | |
| Nguyen et al. | Diagnostic value of the recombinant tandem repeat antigen TeGM6-4r for surra in water buffaloes | |
| CN105273065B (en) | 1 type duck hepatitis A virus VP2 recombinant protein of one kind, ELISA kit and preparation method thereof | |
| CN110105436A (en) | The ELISA detection kit and the preparation method and application thereof of 3 type antibody of pig circular ring virus | |
| CN109369796A (en) | A kind of enzyme-linked immunoassay method detecting sheep Toxoplasma Gondi IgG antibody | |
| CN107167611B (en) | A kind of ELISA detection method of Porcine epidemic diarrhea virus antibody sIgA | |
| CN104166000A (en) | A method of indentifying brucella natural infection or immunifaction for livestock | |
| CN103235119A (en) | A diagnosis antigen for Toxoplasma gondii infection and a preparation method and applications thereof | |
| CN102533663B (en) | Foot-and-mouth disease hybridoma cell line, monoclonal antibody, detection reagent and test kit | |
| CN110183527A (en) | A kind of neospora NcMIC26 antigen and its application | |
| CN109239341A (en) | A kind of indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test and its application | |
| CN107167609B (en) | Distinguish the antibody indirect ELISA detection method of pig blue-ear disease street strain and the strain of vaccine strain Tianjin | |
| CN108318686A (en) | A kind of bovine coronavirus ELISA detection kit | |
| CN104845981A (en) | Babesia microti Bm1524 antigen and application thereof | |
| CN107402304A (en) | One kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method | |
| CN105137076B (en) | Small-fragment gG antigen and application of small-fragment gG antigen in detecting pseudorabies virus gG antibody | |
| CN105572375B (en) | Mink Parvovirus Enteritis pathogen antigen colloidal gold colloidal gold detection test paper strip and preparation method thereof | |
| CN111273005B (en) | Enzyme linked immunosorbent assay kit and method for detecting toxoplasma gondii IgG antibody | |
| CN111393510B (en) | African swine fever virus recombinant antigen and application thereof | |
| CN1851463B (en) | Method for detecting horse arteritis virus by indirect enzyme-linked immunosorbent test | |
| CN103290020A (en) | Monoclonal antibody and polyclonal antibody to swine Foxp3 protein and application thereof | |
| CN110484511B (en) | Hybridoma cell strain, monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
| CN113884674A (en) | Mycoplasma bovis colloidal gold immunoassay test strip, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190222 |