CN109239341A - A kind of indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test and its application - Google Patents
A kind of indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test and its application Download PDFInfo
- Publication number
- CN109239341A CN109239341A CN201810726228.7A CN201810726228A CN109239341A CN 109239341 A CN109239341 A CN 109239341A CN 201810726228 A CN201810726228 A CN 201810726228A CN 109239341 A CN109239341 A CN 109239341A
- Authority
- CN
- China
- Prior art keywords
- group
- chr1502
- mannheimia haemolytica
- solid phase
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Food Science & Technology (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test and its application, the kit includes the IgG ELIAS secondary antibody marked with the coated solid phase carrier of ox Mannheimia haemolytica specific proteins chr1502 and HRP；Chr1502 albumen of the present invention has expression in each period of ox Mannheimia haemolytica infection host, and it is able to detect that within the 8th day that corresponding antibody generates in infection, time existing for its antibody generated is longer, high specificity, detection sensitivity is high, the present invention realizes the monitoring of antibody level after specificity, highly sensitive detection and the vaccine immunity infected early stage ox Mannheimia haemolytica, detecting step of the present invention facilitates operation, detection time is short, has broad application prospects.
Description
Technical field
The invention belongs to veterinary biological detection technique fields, and in particular to a kind of ox Mannheimia haemolytica antibody test
Indirect ELISA reagent kit and its application.
Background technique
Ox Mannheimia haemolytica disease is a kind of ox respiratory disease as caused by ox Mannheimia haemolytica.In recent years
Come, with the rapid development of China's beef cattle breeding scale, originally the low ox Mannheimia haemolytica lesion sent out less of sending out obtains high-incidence frequency
Hair, only 2015, just there were a lot of calf infection Mannheimia haemolytica cases in the whole nation, and the death rate is in 20%-50%.Ox haemolysis
Property Mannheimia disease be common in transport after calf, wean, long-distance transport, bad weather etc. are the risk factors of the disease.The disease is in
The whole world is widely distributed, North America every year the economic loss as caused by the disease just up to 200,000,000 dollars or more.
Ox Mannheimia haemolytica is to lead to the most common most important bacterial pathogen of cattle respiratory disease, which is
A kind of opportunist can be used as a kind of homobium and be present in the healthy ox upper respiratory tract, but its content is low under normal circumstances.One
The variation of denier external environment, ox body are changed upper respiratory tract microorganism by various distress, the factors such as other bacterial viruses
Group's microenvironment, ox Mannheimia haemolytica will quickly be bred, and cause the bacterium to extend to lower respiratory tract, so as to cause pneumonia
Occur.Ox Mannheimia haemolytica be considered as cause ox seriousness or lethal Bronchopneumonia it is most common and important cause a disease
Cause of disease.
Precise Diagnosis is the key link for controlling ox Mannheimia haemolytica disease.Currently, both at home and abroad for medical diagnosis on disease and
The detection method of vaccine potency mainly have Antigen isolation and identification, PCR detection technique, agar gel diffusion test, indirect hemagglutination test with
And ELISA test etc..PCR detection technique is mainly used for laboratory research, agar gel diffusion test and indirect hemagglutination test sensibility
Lower, ELISA detection method has many advantages, such as sensitivity height and easy batch detection.
China there is no for ox Mannheimia haemolytica disease seroepidemiological survey and vaccine immunity effect evaluation at present
ELISA antibody assay kit.Therefore, specific antigen target is found, it is anti-to develop a kind of ELISA quickly, sensitive, special
Body detection kit, to be used for vaccine immunity effect evaluation and epidemic disease seroepidemiological survey, for effective prevention and control ox haemolysis
Property Mannheimia disease is of great significance.
Summary of the invention
In view of the above shortcomings of the prior art, it solves no commercialization domestic at present and is directed to ox Mannheimia haemolytica
The technical issues of detection kit that antibody level is detected, provides a kind of energy effective evaluation ox Mannheinzia haemolytica vaccine
The ox Mannheimia haemolytica antibody of immune effect and not immune cows Mannheimia haemolytica infection seroepidemiological survey
The indirect ELISA reagent kit of detection and its application, the kit have the characteristics that quick, special, sensitive, stable.
To achieve the above object, the present invention adopts the following technical scheme: a kind of ox Mannheimia haemolytica antibody test
Indirect ELISA reagent kit, including marked with the coated solid phase carrier of ox Mannheimia haemolytica specific proteins chr1502 and HRP
The IgG ELIAS secondary antibody of note；The nucleotide sequence such as SEQ ID NO.1 of the special chr1502 gene of ox Mannheimia haemolytica
Shown, the amino acid sequence of the protein of coding is as shown in SEQ ID NO.2.
Further, chr1502 base in the coated solid phase carrier of the ox Mannheimia haemolytica specific proteins chr1502
The screening technique of cause, specifically includes the following steps: with ox Mannheimia haemolytica infecting mouse different time (8d, 12d, 16d,
21d, 48d, 120d) serum as primary antibody, using ox Mannheimia haemolytica bacterial protein as antigen to be checked, carry out
Western blot, screening all have the protein band of Immunel response within each period to get to primary dcreening operation protein band,
The primary dcreening operation protein band is subjected to Mass Spectrometer Method again and obtains multiple Protein Informations, is distributed in cell according to each albumen, antigen
Epitope and secretion characteristic analysis, obtain primary dcreening operation antigen protein, then by primary dcreening operation antigen protein in expression in escherichia coli, with ox haemolysis
Property Mannheimia infection serum carry out Western blot detection, screen have strong reactionogenicity (gray value is higher) albumen one
With corresponding albumen, candidate antigens albumen is obtained, the candidate antigens albumen is subjected to ELISA and specificity verification, that is, is screened
Obtain final antigen protein chr1502.
Further, the coated solid phase carrier of the ox Mannheimia haemolytica specific proteins chr1502 uses such as lower section
Method is made: the ox Mannheimia haemolytica specific proteins chr1502 solution that concentration is 6 μ g/mL is added into solid phase carrier, in
After 4 DEG C of coatings are stayed overnight, the ox Mannheimia haemolytica specific proteins chr1502 solution is discarded, is added into solid phase carrier
The skimmed milk power solution that mass concentration is 2%, closes 0.5h at 37 DEG C, obtains ox Mannheimia haemolytica specific proteins
The coated solid phase carrier of chr1502.
Further, the indirect ELISA reagent kit of the ox Mannheimia haemolytica antibody test further includes standard positive pair
According to serum, standard negative control serum, sample diluting liquid, concentrated cleaning solution, developing solution and terminate liquid；The sample diluting liquid is
PBS buffer solution containing 0.5wt.%BSA, 0.05wt.% polysorbas20,5mmol/L EDTA and 0.35mol/L NaCl, the sample
The pH of product dilution is 7.2；The concentrated cleaning solution is 25 × PBST cleaning solution；The developing solution is TMB, and the terminate liquid is
The sulfuric acid solution of 2mol/L；The solid phase carrier is 96 hole polystyrene ELISA Plates；The IgG ELIAS secondary antibody of HRP label is
The rabbit-anti ox IgG ELIAS secondary antibody of HRP label.
Further, the detection method of the indirect ELISA reagent kit of the ox Mannheimia haemolytica antibody test, including will
Blood serum sample to be detected is contacted with ox Mannheimia haemolytica specific proteins chr1502 coated on solid phase carrier and heat preservation is incubated
It educates, specifically captures the specific antibody being incorporated on chr1502 proteantigen with the IgG ELIAS secondary antibody that HRP is marked, and with developing the color
Agent colour developing, so that measurement obtains the antibody level for being directed to chr1502 albumen in blood serum sample to be detected；Specifically include following step
It is rapid:
1) blood serum sample to be detected, standard positive control serum and standard negative control serum are used into sample diluting liquid respectively
It is diluted according to the volume ratio of 1:200, it is right to obtain serum samples diluted liquid to be detected, positive control serum dilution and feminine gender
According to serum dilution；
2) blank group, positive criteria group, negative standards' group and blood serum sample group to be detected is respectively set, to ox hemolytic
100 μ L sample dilutions are added in the coated solid phase carrier of Mannheimia specific proteins chr1502 and obtain the blank group,
Positive control blood described in 100 μ L is added to in the coated solid phase carrier of ox Mannheimia haemolytica specific proteins chr1502
Clear dilution obtains positive criteria group, to the coated solid phase carrier of ox Mannheimia haemolytica specific proteins chr1502
Negative control sera dilution described in 100 μ L of middle addition obtains negative standards' group, to ox Mannheimia haemolytica specificity
Serum samples diluted liquid to be detected described in 100 μ L is added in the coated solid phase carrier of albumen chr1502 and obtains serum to be detected
Sample sets, by blank group, positive criteria group, negative standards' group and the blood serum sample group to be detected after sample-adding in 37 DEG C of incubation reactions
30 minutes；
3) after step 2) is incubated for, blank group, positive criteria group, negative standards' group and blood serum sample group to be detected are discarded
Liquid in solid phase carrier, concentrated cleaning solution is diluted to 1 × after wash respectively each group solid phase carrier 3 times, every time 5 minutes；
4) the IgG ELIAS secondary antibody of HRP label and sample diluting liquid are diluted according to the volume ratio of 1:20000, are obtained
ELIAS secondary antibody dilution, respectively to blank group, positive criteria group, negative standards' group and the serum sample to be detected after step 3) washing
The 100 μ L of ELIAS secondary antibody dilution is added in product group solid phase carrier, is incubated for 60 minutes in 37 DEG C；
5) after step 4) is incubated for, the liquid in each group solid phase carrier is discarded, washs each group respectively with the cleaning solution after dilution
Solid phase carrier 3 times, every time 5 minutes；
6) 100 μ L developing solutions are added into each group solid phase carrier after step 5) washing respectively, colour developing is protected from light at 37 DEG C
Reaction 15 minutes；
7) after step 6) chromogenic reaction, 50 μ L of terminate liquid is added into each group solid phase carrier respectively and terminates reaction, and
Absorbance value of the liquid at D450nm in measurement blank group, positive criteria group, negative standards' group and blood serum sample group to be detected,
When positive criteria group D450nm value is greater than 1.0, and negative standards organize D450nm value less than 0.18, blood serum sample group data to be detected
Effectively, it is judged as positive when blood serum sample group D450nm value to be detected is greater than 0.192, i.e., contains Niu Rong in blood serum sample to be detected
Hemorrhagic Mannheimia antibody, blood serum sample group D450nm value to be detected is judged as negative when being less than or equal to 0.192, i.e., to be detected
Ox Mannheimia haemolytica antibody is not contained in blood serum sample.
Compared with prior art, the invention has the following beneficial effects:
1, the indirect ELISA method that the present invention is constructed with chr1502 recombinant protein, all has ox Mannheimia haemolytica
Good specificity avoids and Mycoplasma bovis positive serum, ox aftosa positive serum, ox pasteurella multocida (Pm) sun
Property serum occur cross reaction.The method of the present invention detection limit is low, detection sensitivity is high, and weak positive serum is in 1:800 dilution
The positive still can be detected；This method repeatability is good, and testing result is true and reliable, and False Rate is low；And established based on this method
Kit carries out ELISA detection, serum OD value after there is longer pot-life, the ELISA Plate being coated with to place 7 days at 37 DEG C
And P/N value is all more constant.Ox Mannheimia haemolytica antibody is detected using the method for the present invention, detecting step facilitates behaviour
Make, detection time is short, it is only necessary to which detection can be completed in about 3h.
2, the present invention carries out Western using serum in different time periods after ox Mannheimia haemolytica infecting mouse
Blot can be used as indirect ELISA diagnosis target target specific antigen, the indirect ELISA antibody established based on the antigen to screen
Detection method can cover each period of ox Mannheimia haemolytica infection host, and be able to detect that within the 8th day in infection
Corresponding antibody generates, and the time existing for the antibody generated is longer, therefore using the present invention in ox Mannheimia haemolytica sense
Dye can make diagnosis compared with early stage, this provides more accurate direction for follow-up clinical treatment, reduce blindly treatment and brought
Economic cost, while also reducing the time and cost of labor consumed by clinical diagnosis, envelope antigen ox used in the present invention
Mannheimia haemolytica chr1502 albumen can be obtained by genetic engineering clonal expression, and biological safety is high, and the present invention has wide
Wealthy application prospect.
3, the present invention establishes the indirect ELISA diagnostic reagent kit of ox Mannheimia haemolytica antibody, breaches at present still
Without ox Mannheimia haemolytica indirect ELISA antibody diagnosing reagent kit, the shortcoming of existing diagnostic techniques is compensated for, is ox hemolytic
Mannheimia antibody surveillance provides support, so that more various to the diagnostic techniques of ox Mannheimia haemolytica infection
Change, there is good market value and economic value.
Detailed description of the invention
Fig. 1 is that the SDS-PAGE of chr1502 gene expression product detects figure；
M: albumen Marker；A is not plus the control group of IPTG induction, B are the induction group that IPTG is added；
The SDS-PAGE detection figure that Fig. 2 is the recombinant protein chr1502 of purifying；
M: albumen Marker；A: the albumen of purifying；
The Western-blot that Fig. 3 is recombinant protein chr1502 after purification detects figure；
M: albumen Marker；A: the albumen of purifying；
Fig. 4 is chr1502 protein antibodies titration figure；
Fig. 5 is to attack mouse survival curve graph after malicious ox Mannheimia haemolytica spl422；
Fig. 6 is the sensitivity analysis result of ELISA Plate.
Specific embodiment
Invention is further described in detail with attached drawing combined with specific embodiments below.Experiment side as described in the examples
Method is without special instruction, i.e., routinely experimental methods of molecular biology operates.
Ox Mannheimia haemolytica strain spl422 in following embodiments: animal doctor is prevented by Southwest University's Animal Science And Technology
Learn laboratory separation identification preservation from the nose swab of the calf with respiratory syndrome.Other reagents unless otherwise specified,
As ordinary commercial products.
The screening of 1 N of Mannheimia haemolytica specific antigen protein of embodiment
The ox Mannheimia haemolytica spl422 bacterial strain for taking -80 DEG C of preservations, activates, picking single bacterium is fallen on Martin's plate
In Martin's fluid nutrient medium, 37 DEG C of constant-temperature table 220r/min cultivate 12h, and thallus and supernatant are collected in centrifugation respectively, will be above-mentioned
The supernatant after bacterial protein and concentration after bacterial cell disruption is as antigen to be checked, with ox Mannheimia haemolytica infecting mouse
(8d, 12d, 16d, 21d, 48d, 120d) mice serum in different time periods afterwards carries out SDS-PAGE and Western as primary antibody
Blot detection.
Generated immune band after different serum are incubated for is compared by Western Blot, is screened equal in each period
In the presence of and reactionogenicity relatively strong (band gray scale is higher) specific immune band.The immune band of reference Western blot,
Polyacrylamide gel (PAGE gel) corresponding position cuts corresponding protein band and is analyzed by mass spectrometry.According to mass spectrum knot
Fruit, albumen similar in molecular size range corresponding to the protein band for screening and cutting.Composite mass spectrum annotates again, to measurement albumen
The analysis such as cell distribution, epitope, secretion characteristic, be screened out from it with high antigenic, signal peptide, subcellular localization in
Outer membrane or extracellular albumen are to get arriving primary dcreening operation antigen protein.
In conjunction with ox Mannheimia haemolytica spl422 strain gene group sequence, the primary dcreening operation antigen protein of acquisition is passed through into protokaryon
The mode of expression is expressed, then using the serum after ox Mannheimia haemolytica infecting mouse as primary antibody, carries out Western
Blot screening wherein the antigen protein with strong reactionogenicity to get to the time detected to ox Mannheimia haemolytica antibody
Select target antigen albumen.Obtained candidate targets antigen protein is coated with polystyrene ELISA Plate, carries out ELISA, preliminary test
Whether the antigen protein can be used as diagnosis target to establish ELISA method.After undergoing a series of above-mentioned screenings, finally screen
Antigen protein is obtained, i.e. chr1502 albumen establishes ox Mannheimia haemolytica indirect ELISA diagnosis side as diagnosis target
Method.
The clonal expression of 2 Ns of Mannheimia haemolytica chr1502 genes of embodiment
The genomic DNA that ox Mannheimia haemolytica spl422 bacterial strain is extracted using conventional method, according to SEQ ID NO.1
Shown in chr1502 gene nucleotide sequence, design the primer as shown in SEQ ID NO.3 and SEQ ID NO.4
Chr1502-F and chr1502-R, using the genomic DNA of extraction as template, with chr1502-F (upstream primer) and chr1502-R
(downstream primer) is the amplification that primer carries out chr1502 gene.
The primer sequence is as follows:
Chr1502-F:5 '-GCCATGGCTGATATCGGATCCAGTAGTGGTGGTTCGGGCAG-3’
Chr1502-R:5 '-GTGGTGGTGGTGGTGCTCGAGTTTTTGGATATCGCCACGAG-3’
Wherein, the underscore of chr1502-F is BamHI restriction enzyme site, and the underscore of chr1502-R is XhoI digestion position
Point.
PCR reaction condition: 94 DEG C of 3min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min, 35 circulations；72 DEG C of extension 10min,
4 DEG C of preservations.
By PCR product after agarose gel electrophoresis gel extraction, the PCR product of recycling and pET32a are used respectively
BamHI and XhoI carries out double digestion, then recovered, connection, conversion, screening and sequence verification, acquisition contain target gene
The recombinant expression plasmid pET32a-chr1502 of chr1502, by recombinant plasmid transformed Escherichia coli E.coil BL21 (DE3)
Competent cell is expressed.When recombinating bacterium solution OD600 ≈ 0.5, IPTG (500mmol/L) is added in recombination bacterium solution
Final concentration of 0.1mmol/L induces 4h under conditions of 37 DEG C, 220r/min, obtains expression product.
Expression product is detected using SDS-PAGE, testing result as shown in Figure 1, recombinant protein realizes overexpression, and
And obtained recombinant protein molecular size range is consistent with expected results, that is, obtains chr1502 albumen.
A large amount of inducing expressions are carried out to the recombinant bacterium using method same as described above, a large amount of recombinant protein is obtained, leads to
After crossing Ni-NTA Superflow Cartridges His affinity column (abbreviation Ni column) purifying and using dialysis desalination, adopt
With SDS-PAGE detect purified product, testing result as shown in Fig. 2, obtained purified product molecular size range and expected results
Unanimously, that is, the chr1502 albumen of high-purity is obtained.
It is detected using chr1502 albumen of the Western Blot method to purifying, wherein graceful with infected cattle hemolytic
The mice serum of family name's bacillus spl422 bacterial strain is as primary antibody, and testing result is as shown in figure 3, immunoblotting reaction, table occur for serum
Antibody containing chr1502 albumen in the mice serum of bright infection Mannheimia haemolytica spl422 bacterial strain.
3 Ns of Mannheimia haemolytica indirect ELISA reagent kits of embodiment
The component of kit includes being carried with the coated solid phase of ox Mannheimia haemolytica specific proteins chr1502 of purifying
Body, positive control serum, negative control sera, the rabbit-anti ox IgG ELIAS secondary antibody of HRP label, developing solution, terminate liquid, concentration are washed
Wash liquid and sample diluting liquid.The nucleotide sequence such as SEQ ID NO.1 of the ox Mannheimia haemolytica differential protein chr1502
Shown, amino acid sequence is as shown in SEQ ID NO.2.
Wherein, solid phase carrier is 96 hole polystyrene ELISA Plates；The ox Mannheimia haemolytica differential protein chr1502
For using the product purified after the method Recombinant protein expression of above-described embodiment；It is special with the ox Mannheimia haemolytica of purifying
Foreign preteins chr1502 coating solid phase carrier, which refers to, uses purified recombinant antigens albumen chr1502 of the concentration for 6 μ g/mL in 4 DEG C
It is coated with solid phase carrier to stay overnight, then with 2% skimmed milk power, 37 DEG C of closing 0.5h；Positive control serum is calf infected cattle hemolytic
Serum after Mannheimia, negative control sera are calf serum that is not immune and being uninfected by Mannheimia haemolytica；Developing solution
For TMB, reaction terminating liquid is the H of 2mol/L2SO4, concentrated cleaning solution is 25 times of PBST cleaning solutions, and sample diluting liquid is containing 0.5%
The PBS liquid of BSA, 0.05%Tween 20,5mmol/L EDTA, 0.35mol/L NaCl, pH7.2.
Specifically, the present embodiment devises the kit commodity of following specification:
1, plate: 96 holes/plate × 1 is coated with the ox Mannheimia haemolytica specific proteins chr1502 of purifying.
2, standard positive control serum: 30 branch × 1 μ L/.
3, standard negative control serum is each: 30 branch × 1 μ L/.
4, sample diluting liquid: 50mL/ bottles × 1.
5, the rabbit-anti ox IgG ELIAS secondary antibody of HRP label: 50 branch × 1 μ L/.Before use with sample diluting liquid dilute according to
The volume ratio of 1:20000 dilutes.
6,25 × PBST concentrated cleaning solution: 30mL/ bottles × 1 bottle.
7, terminate liquid: 10mL/ bottles × 1 bottle (2mol/L H2SO4)。
8, TMB developing solution: 20mL/ bottles × 1 bottle.
9, serum dilutes plate: 96 holes/plate × 1 piece
4 detection method of embodiment
It is detected using above-mentioned detection kit, when detection needs using 1) microplate reader (it is recommended that reference instrument is using saying
It is bright to preheat in advance)；2) micropipet and suction nozzle, EP pipe；3) distilled water or deionized water.
The principle detected using the kit are as follows: ox Mannheimia haemolytica specific antigen has been coated on ELISA Plate
Test serum sample is added in chr1502 albumen；If containing specific antibody in serum, will resist with the specificity on ELISA Plate
Original combines；Then be added can with antibody ining conjunction with HRP mark rabbit-anti ox IgG ELIAS secondary antibody, add TMB developing solution show
Color, ox Mannheimia haemolytica antibody content is positively correlated in the intensity and blood serum sample of color reaction, can pass through microplate reader
Reading display.
Specific detection operating procedure is as follows:
1) dilute serum: before experiment starts, each reagent should all be balanced to room temperature；It is dilute to blood serum sample sample to be detected
It releases liquid to be diluted according to the volume ratio of 1:200, so that the absorbance value of the sample detection after dilution meets the detection of kit
Range, multiplied by corresponding extension rate when calculating；Positive standard serum and negative standards' serum also use sample diluting liquid according to
The volume ratio of 1:200 is diluted.
2) it is loaded: in 96 orifice plates with the coated solid phase carrier of ox Mannheimia haemolytica specific proteins chr1502
Blank well, gauge orifice, sample to be tested hole are set respectively.Blank well adds 100 μ L sample dilutions, and positive criteria hole adds 100 μ L to dilute
Positive control serum afterwards, negative standards hole add the negative control sera after 100 μ L dilution, and sample to be tested hole adds 100 μ L dilute
Sample to be tested after releasing, when sample-adding, are careful not to make have bubble in hole, and each solution is added on ELISA Plate hole bottom, is not touched as far as possible
Hole wall, shakes gently mixing, ELISA Plate plus lid or overlay film, in 37 DEG C incubation reaction 30 minutes.To guarantee that experimental result is effective
Property, experiment please use new standard solution every time.
3) it washs: after step 2) is incubated for, liquid in hole is discarded and dry, to every Kong Zhongjia cleaning solution after drying
300 μ L impregnate 5 minutes, carry out second of washing again after drying (can also pat and pat dry liquid in hole), wash 3 times in total.
4) it is incubated for: the rabbit-anti ox IgG ELIAS secondary antibody of HRP label: the enzyme diluted to every Kong Zhongjia after step 3) washing
Mark secondary antibody (ELIAS secondary antibody and sample diluting liquid are diluted according to the volume ratio of l:20000, are diluted in using preceding ten minutes) 100 μ
L, 37 DEG C are incubated for 60 minutes.
5) wash: step 4) discards and dries liquid in hole after being incubated for, with step 3) method washing hole 5 times.
6) it develops the color: 100 μ L of developing solution being sequentially added into every hole, 37 DEG C are protected from light 15 minutes.
7) terminate reaction: sequentially every hole adds 50 μ L of terminate liquid, terminates reaction, and blue is vertical at this time turns yellow.Terminate liquid adds
Entering sequence should be identical as the addition sequence of substrate solution as far as possible.After guaranteeing that the accuracy of experimental result, substrate reactions time arrive
Terminate liquid should be added as early as possible.
8) it measures: being detected immediately after adding terminate liquid, sequentially measure the optical density in each hole in 450nm wavelength with microplate reader
(OD value).Measurement should carry out within 15 minutes after adding terminate liquid.
9) result judgement: positive control serum OD450nm value is greater than 1.0, and negative control sera OD450nm value is less than 0.18
When, experimental result is determined as qualification；Conversely, need to detect again to be unqualified；Yin and yang attribute critical value is 0.192, sample to be tested
OD450nm value is positive when being greater than 0.192, is feminine gender when being less than or equal to 0.192.
The measurement of 5 recombinant protein chr1502 immune protective of embodiment:
Immune programme
One exempts from: recombination chr1502 albumen after purification is emulsified with Freund's complete adjuvant 1:1 mixing, it is every after emulsification
The subcutaneous 200 μ L of multi-point injection of mouse (containing 50 μ g albumen) lotion.The subcutaneous 200 μ L PBS solution of multi-point injection of control group.
Two exempt from: after one exempts from 7d, recombination chr1502 albumen and retrial Freund's incomplete adjuvant 1:1 mixing being emulsified, after emulsification
The subcutaneous 200 μ L of multi-point injection of every mouse (containing 40 μ g albumen) lotion.The subcutaneous 200 μ L PBS solution of multi-point injection of control group.
Antibody level and protectiveness measurement: two exempt from rear 10d in a manner of blood sampling of docking, and acquire 5 immune groups, 3 controls
Group mice serum measures mice serum antibody titer using the method that the kit is established, as a result as shown in figure 4, wherein horizontal
Coordinate is serum diluting multiple, and ordinate is P/N value, and P/N=2.1 is yin and yang attribute critical value.5 groups of immune groups (39-1,39-2,
39-3,39-4 and 39-5) when reaching 1:51200, P/N value illustrates that chr1502 protein immunization is small still 2.1 or more for serum dilution
High-caliber serum antibody is produced after mouse.The mice serum after acquiring 1d is taken, malicious 1* is attacked in a manner of intraperitoneal injection
108CFU ox Mannheimia haemolytica spl422 attacks every 12h observation dead mouse situation after poison, observes 7d.As a result such as Fig. 5 institute
Show, the mouse of control group and immune group (39) is all dead after attacking malicious 12h, shows that chr1502 albumen does not have immune protect
Shield property.
Different periods mice serum chr1502 protein antibodies measure after 6 infected cattle Mannheimia haemolytica of real-time example
With chr1502 albumen coated elisa plate, according to conventional indirect ELISA operating process to infected cattle hemolytic Mans bar
The mice serum (8d, 12d, 16d, 20d, 30d are taken a blood sample by eyeball and separate serum after infection) of different periods is detected after bacterium,
It is greater than 2.1 with final positive OD450/ feminine gender OD450, that is, P/N value for the positive.As shown in Table 1, graceful in three parts of infected cattle hemolytics
In mice serum after family name bacillus 8 days, there are a to be positive, two parts of feminine genders, and in the longer serum of infection time, all blood
It is positive that chr1502 protein antibodies can be detected clearly.Illustrate that chr1502 albumen can produce in infection early stage to be able to detect that
Antibody level, the good specificity having along with itself, stability etc., the indirect ELISA diagnosis established with the albumen
Method can infect early stage in ox Mannheimia haemolytica and make rapid diagnosis, have important clinical significance.
The measurement of 1 mouse infection ox Mannheimia haemolytica different time sections serum chr1502 protein antibodies of table
The specificity of embodiment 7 indirect ELISA reagent kit and detection method
Respectively using Mycoplasma bovis positive serum, ox aftosa positive serum and ox pasteurella multocida positive serum as
Primary antibody carries out specificity to coating recombinant antigen chr1502.The results are shown in Table 2.
Table 2
Experiments have shown that coating recombinant antigen chr1502 and Mycoplasma bovis (Mycoplasma bovis, Mb) positive serum,
Ox aftosa (Foot-and-Mouth Disease Virus, FMDV) positive serum, ox pasteurella multocida
Cross reaction does not occur for (Pasteurella multocida, Pm) positive serum, illustrates with the building of chr1502 recombinant protein
Indirect ELISA method have preferable specificity.
Meanwhile chr1502 protein sequence is committed to NCBI and carries out BLAST, it is found by way of sequence alignment
Chr1502 also has good specificity, does not find there is homology with other cause of diseases of bovine respiratory.
The stability of embodiment 8 indirect ELISA reagent kit and detection method
The IgG ELIAS secondary antibody and other same reagents of the ELISA reaction plate, HRP label that are prepared with same batch, in identical item
Under part with the method established to 5 parts of blood serum samples carry out detection independent detection 3 times, statistic mixed-state as a result, calculate standard deviation and
The coefficient of variation, the results are shown in Table 3.
Table 3
Repetitive test shows that three pieces of different ELISA Plates are coated with using the albumen of same Batch purification carries out ELISA in batch,
The coefficient of variation of final result illustrates to have with the ELISA method that chr1502 albumen is established good between 1.34%~6.93%
Batch in repeatability.
The IgG ELIAS secondary antibody and other same reagents marked with ELISA reaction plate, HRP prepared with three batches, identical
Under the conditions of with the method established independent detection is carried out to other 5 parts of blood serum samples, statistic mixed-state is as a result, calculate standard deviation and change
Different coefficient, the results are shown in Table 4.
Table 4
Repeated experiment shows that being coated with same ELISA Plate using the albumen that different batches purify carries out ELISA between batch, finally
As a result the coefficient of variation illustrates there is good batch with the ELISA method that chr1502 albumen is established between 2.09%~10.99%
Between repeatability.
The sensitivity of embodiment 9 indirect ELISA reagent kit and detection method
It chooses 3 parts of strong positive cow's serum sample (sample 1,2 and 3), 3 parts of weakly positive cow's serum sample (sample 4,5 and 6),
After carrying out doubling dilution to positive sample, the serum of each dilution is as an independent sample, according to the ELISA established
Method is detected, and is calculated the P/N value of each dilution, the sensitivity of kit is determined with this, as a result as shown in Figure 6.
The results show that still can detecte the positive after volume ratio dilution of the weakly positive cow's serum with 1:800, and it is strong positive
Property cow's serum remain to detect the positive when being diluted to 1:3200, illustrate this this method have good sensitivity.
The accelerated aging test of embodiment 10 indirect ELISA reagent kit and detection method
After chr1502 albumen coated elisa plate, 37 DEG C of constant incubators are placed in, every other day take out a column enzyme mark hole pair
A strong positive cow's serum 1, a weakly positive cow's serum 2 carry out ELISA detection, and the results are shown in Table 5.
Table 5
Accelerated aging test show the chr1502 albumen ELISA Plate being coated with after 37 DEG C of placement 7d, positive serum OD value
And the variation of P/N value is less, illustrates that the albumen its stability after coated elisa plate is fine, can save for a long time, meet
The requirement of ELISA kit pot-life.
Finally, it is stated that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although referring to compared with
Good embodiment describes the invention in detail, those skilled in the art should understand that, it can be to skill of the invention
Art scheme is modified or replaced equivalently, and without departing from the objective and range of technical solution of the present invention, should all be covered at this
In the scope of the claims of invention.
<110>Southwest University
<120>a kind of indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test and its application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1131
<212> DNA
<213>Mannheimia haemolytica (Mannheimiahaemolytica)
<400> 1
atgtctatcaaaaaagtaactttagccagtttgattttattgggtttaacggcgtgtagt 60
agtggtggttcgggcagtagctcaaacaatgtggcaaaaccgaatactaaaccgcaaact 120
actcagcaacaaaccgataaagcggcagcagaaaaagcagcaaaagacaaggcagcgaaa 180
gagaaagcagaagcagaacgtttagcagcagaaaaagcagctaaagagaaagcggaagca 240
gaacgtttagcggcggaaaaagcagcgaaagaaaaagccgaagcggaacgtttagcggcg 300
gaaaaagcagcgaaagaaaaagccgaagcagaacgtttagcggcggaaaaagcggcgaaa 360
gagaaagcggaagcagaacgtttagcggcagaaaaagcggcgaaagagaaagcggaagcg 420
gagcgtttagcggcggaaaaagcagcgaaagaaaaagccgaagcagaacgtttagcggcg 480
gaaaaagcggcgaaagagaaagcggaagcggagcgtttagcagcagaaaaagaagtagat 540
cctatagctattattaaagcaaaaggtattgatgatacaaattacggcttaaaacttggt 600
aatagtaaagaaactattgagggtaaagtcacagtcagaacacagagttatttatataat 660
cagccatattctgtagtaacagcacaagcagttcaaagaaatggctgggaaaacggtaat 720
tatattgataaagttgatggaacagttacagttaaaggattgaaaacagagaaattacca 780
acagagggtactgcaacatattcaggaaaagcatttaaccacgatggagctaaaggtttt 840
aatggtggtgatctaacctataatgttaatttctctaagcgtaccggttcaggtagagtt 900
gagggagaatttggaaacttaatcgtattagaagaggggacgattaataatactcagatt 960
tcttcaacagtacatggcaataatcctttaaacctttctggaaaatatacagtcgaattt 1020
ttcggtaaaaatgcagaggaaattgccggtgaaattcagacaaaagcaaatcttactggg 1080
gaagtgagtaattttggacttgccggcactcgtggcgatatccaaaaata a 1131
<210> 2
<211> 376
<212> PRT
<213>Mannheimia haemolytica (Mannheimiahaemolytica)
<400> 2
Met Ser Ile Lys Lys Val Thr Leu Ala Ser Leu Ile Leu Leu Gly Leu
1 5 10 15
Thr Ala Cys Ser Ser Gly Gly Ser Gly Ser Ser Ser Asn Asn Val Ala
20 25 30
Lys Pro Asn Thr Lys Pro Gln Thr Thr Gln Gln Gln Thr Asp Lys Ala
35 40 45
Ala Ala Glu Lys Ala Ala Lys Asp Lys Ala Ala Lys Glu Lys Ala Glu
50 55 60
Ala Glu Arg Leu Ala Ala Glu Lys Ala Ala Lys Glu Lys Ala Glu Ala
65 70 75 80
Glu Arg Leu Ala Ala Glu Lys Ala Ala Lys Glu Lys Ala Glu Ala Glu
85 90 95
Arg Leu Ala Ala Glu Lys Ala Ala Lys Glu Lys Ala Glu Ala Glu Arg
100 105 110
Leu Ala Ala Glu Lys Ala Ala Lys Glu Lys Ala Glu Ala Glu Arg Leu
115 120 125
Ala Ala Glu Lys Ala Ala Lys Glu Lys Ala Glu Ala Glu Arg Leu Ala
130 135 140
Ala Glu Lys Ala Ala Lys Glu Lys Ala Glu Ala Glu Arg Leu Ala Ala
145 150 155 160
Glu Lys Ala Ala Lys Glu Lys Ala Glu Ala Glu Arg Leu Ala Ala Glu
165 170 175
Lys Glu Val Asp Pro Ile Ala Ile Ile Lys Ala Lys Gly Ile Asp Asp
180 185 190
Thr Asn Tyr Gly Leu Lys Leu Gly Asn Ser Lys Glu Thr Ile Glu Gly
195 200 205
Lys Val Thr Val Arg Thr Gln Ser Tyr Leu Tyr Asn Gln Pro Tyr Ser
210 215 220
Val Val Thr Ala Gln Ala Val Gln Arg Asn Gly Trp Glu Asn Gly Asn
225 230 235 240
Tyr Ile Asp Lys Val Asp Gly Thr Val Thr Val Lys Gly Leu Lys Thr
245 250 255
Glu Lys Leu Pro Thr Glu Gly Thr Ala Thr Tyr Ser Gly Lys Ala Phe
260 265 270
Asn His Asp Gly Ala Lys Gly Phe Asn Gly Gly Asp Leu Thr Tyr Asn
275 280 285
Val Asn Phe Ser Lys Arg Thr Gly Ser Gly Arg Val Glu Gly Glu Phe
290 295 300
Gly Asn Leu Ile Val Leu Glu Glu Gly Thr Ile Asn Asn Thr Gln Ile
305 310 315 320
Ser Ser Thr Val His Gly Asn Asn Pro Leu Asn Leu Ser Gly Lys Tyr
325 330 335
Thr Val Glu Phe Phe Gly Lys Asn Ala Glu Glu Ile Ala Gly Glu Ile
340 345 350
Gln Thr Lys Ala Asn Leu Thr Gly Glu Val Ser Asn Phe Gly Leu Ala
355 360 365
Gly Thr Arg Gly Asp Ile Gln Lys
370 375
<210> 3
<211> 41
<212> DNA
<213>artificial sequence (Artificial)
<400> 3
gccatggctgatatcggatccagtagtggtggttcgggca g 41
<210> 4
<211> 41
<212> DNA
<213>artificial sequence (Artificial)
<400> 4
gtggtggtggtggtgctcgagtttttggatatcgccacga g 41
Claims (6)
1. a kind of indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test, which is characterized in that including with ox haemolysis
Property the coated solid phase carrier of Mannheimia specific proteins chr1502 and HRP label IgG ELIAS secondary antibody；The ox hemolytic
Mannheimia specificitychr1502The nucleotide sequence of gene is as shown in SEQ ID NO.1, the amino acid of the protein of coding
Sequence is as shown in SEQ ID NO.2.
2. the indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test according to claim 1, which is characterized in that
In the coated solid phase carrier of the ox Mannheimia haemolytica specific proteins chr1502chr1502Gene is with the following method
Screening: respectively using the serum of ox Mannheimia haemolytica infecting mouse 8d, 12d, 16d, 21d, 48d and 120d as primary antibody, with
Ox Mannheimia haemolytica bacterial protein carries out Western blot as antigen to be checked, and screening has within each period
There is the protein band of Immunel response to carry out Mass Spectrometer Method to get to primary dcreening operation protein band, then by the primary dcreening operation protein band
Multiple Protein Informations are obtained, is distributed in cell according to each albumen, the analysis of epitope and secretion characteristic, obtains primary dcreening operation antigen egg
It is white, then by primary dcreening operation antigen protein in expression in escherichia coli, Western is carried out with ox Mannheimia haemolytica infection serum
Blot detection, screens the corresponding albumen of protein band with strong reactionogenicity, obtains candidate antigens albumen, will be described candidate anti-
Former albumen carries out ELISA and specificity verification, i.e. screening obtains final antigen protein chr1502.
3. the indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test according to claim 1, which is characterized in that
The coated solid phase carrier of the ox Mannheimia haemolytica specific proteins chr1502 is made with the following method: carrying to solid phase
The ox Mannheimia haemolytica specific proteins chr1502 solution that concentration is 6 μ g/mL is added in body, after 4 DEG C of coatings are stayed overnight,
The ox Mannheimia haemolytica specific proteins chr1502 solution is discarded, it is 2 %'s that mass concentration is added into solid phase carrier
Skimmed milk power solution closes 0.5h at 37 DEG C to get coated solid to ox Mannheimia haemolytica specific proteins chr1502
Phase carrier.
4. the indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test according to claim 1, which is characterized in that
The kit further includes standard positive control serum, standard negative control serum, sample diluting liquid, concentrated cleaning solution, colour developing
Liquid and terminate liquid；The sample diluting liquid be containing 0.5 wt.% BSA, 0.05 wt.% polysorbas20,5 mmol/L EDTA and
The PBS buffer solution of 0.35 mol/L NaCl, the pH of the sample diluting liquid are 7.2；The concentrated cleaning solution is that 25 × PBST is washed
Wash liquid；The developing solution is TMB, and the terminate liquid is the sulfuric acid solution of 2mol/L；The solid phase carrier is 96 hole polystyrenes
ELISA Plate.
5. a kind of indirect ELISA reagent kit of any one of application claim 1 ~ 4 ox Mannheimia haemolytica antibody test
The method for carrying out detection ox Mannheimia haemolytica antibody, which is characterized in that including by blood serum sample to be detected and solid phase carrier
Upper coated ox Mannheimia haemolytica specific proteins chr1502 contact and heat preservation are incubated for, the rabbit-anti ox IgG marked with HRP
ELIAS secondary antibody specifically captures the specific antibody being incorporated on chr1502 proteantigen, and with chromogenic reagent, to measure
The antibody level of chr1502 albumen is directed into blood serum sample to be detected；Specifically comprise the following steps:
1) by blood serum sample to be detected, standard positive control serum and standard negative control serum use respectively sample diluting liquid according to
The volume ratio of 1:200 is diluted, and obtains serum samples diluted liquid, positive control serum dilution and negative control blood to be detected
Clear dilution；
2) blank group, positive criteria group, negative standards' group and blood serum sample group to be detected is respectively set, to ox hemolytic Mans
100 μ L sample dilutions are added in the coated solid phase carrier of bacillus specific proteins chr1502 and obtain the blank group, Xiang Yong
It is dilute that positive control serum described in 100 μ L is added in the coated solid phase carrier of ox Mannheimia haemolytica specific proteins chr1502
It releases liquid and obtains positive criteria group, add to in the coated solid phase carrier of ox Mannheimia haemolytica specific proteins chr1502
Enter negative control sera dilution described in 100 μ L and obtain negative standards' group, to ox Mannheimia haemolytica specific proteins
Serum samples diluted liquid to be detected described in 100 μ L is added in the coated solid phase carrier of chr1502 and obtains blood serum sample to be detected
Group divides blank group, positive criteria group, negative standards' group and the blood serum sample group to be detected after sample-adding in 37 DEG C of incubation reactions 30
Clock；
3) after step 2 is incubated for, blank group, positive criteria group, negative standards' group and blood serum sample group solid phase to be detected are discarded
Liquid in carrier, concentrated cleaning solution is diluted to 1 × after wash respectively each group solid phase carrier 3 times, every time 5 minutes；
4) the IgG ELIAS secondary antibody of HRP label and sample diluting liquid are diluted according to the volume ratio of 1:20000, obtain enzyme mark
Secondary antibody diluent, respectively to blank group, positive criteria group, negative standards' group and the blood serum sample group to be detected after step 3) washing
The 100 μ L of ELIAS secondary antibody dilution is added in solid phase carrier, is incubated for 60 minutes in 37 DEG C；
5) after step 4) is incubated for, the liquid in each group solid phase carrier is discarded, washs each group solid phase respectively with the cleaning solution after dilution
Carrier 3 times, every time 5 minutes；
6) 100 μ L developing solutions are added into each group solid phase carrier after step 5) washing respectively, are protected from light chromogenic reaction at 37 DEG C
15 minutes；
7) after step 6) chromogenic reaction, 50 μ L of terminate liquid is added into each group solid phase carrier respectively and terminates reaction, and measures
Absorbance value of the liquid at D450nm in blank group, positive criteria group, negative standards' group and blood serum sample group to be detected, works as sun
Property standard group D450nm value be greater than 1.0, negative standards organize D450nm value less than 0.18 when, blood serum sample group data to be detected have
Effect, blood serum sample group D450nm value to be detected are judged as positive, i.e., contain ox haemolysis in blood serum sample to be detected when being greater than 0.192
Property Mannheimia antibody, blood serum sample group D450nm value to be detected is judged as negative when being less than or equal to 0.192, i.e., blood to be detected
Ox Mannheimia haemolytica antibody is not contained in final proof product.
6. such as application of the described in any item kits of claim 1 ~ 4 in detection ox Mannheimia haemolytica antibody.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810726228.7A CN109239341B (en) | 2018-07-04 | 2018-07-04 | Indirect ELISA kit for detecting bovine haemolytic mannheimia antibody and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810726228.7A CN109239341B (en) | 2018-07-04 | 2018-07-04 | Indirect ELISA kit for detecting bovine haemolytic mannheimia antibody and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109239341A true CN109239341A (en) | 2019-01-18 |
| CN109239341B CN109239341B (en) | 2021-08-24 |
Family
ID=65071692
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810726228.7A Active CN109239341B (en) | 2018-07-04 | 2018-07-04 | Indirect ELISA kit for detecting bovine haemolytic mannheimia antibody and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109239341B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110713524A (en) * | 2019-10-31 | 2020-01-21 | 湖北工业大学 | High-sensitivity acinetobacter baumannii antigen Elisa determination kit |
| WO2021133328A1 (en) * | 2019-12-26 | 2021-07-01 | T.C. Erciyes Universitesi | Mannheimia haemolytica serotype a1 lateral flow immunochromatography diagnosis kit |
| CN115161211A (en) * | 2021-04-01 | 2022-10-11 | 金宇保灵生物药品有限公司 | Bovine haemolytic mannheimia strain, inactivated vaccine prepared from same and preparation method of vaccine |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101014698A (en) * | 2004-05-14 | 2007-08-08 | 加拿大国家研究委员会 | Conserved inner core lipopolysaccharide epitopes as multi-species vaccine candidates |
| CN105980562A (en) * | 2013-12-02 | 2016-09-28 | A·B·施里维斯 | Immunogenic compositions and vaccines derived from bacterial surface receptor proteins |
| CN106053807A (en) * | 2016-07-26 | 2016-10-26 | 西南大学 | Indirect ELISA (enzyme-linked immuno sorbent assay) detection reagent kit and detection method for bovine-derived pasteurella multocida antibodies |
-
2018
- 2018-07-04 CN CN201810726228.7A patent/CN109239341B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101014698A (en) * | 2004-05-14 | 2007-08-08 | 加拿大国家研究委员会 | Conserved inner core lipopolysaccharide epitopes as multi-species vaccine candidates |
| CN105980562A (en) * | 2013-12-02 | 2016-09-28 | A·B·施里维斯 | Immunogenic compositions and vaccines derived from bacterial surface receptor proteins |
| CN106053807A (en) * | 2016-07-26 | 2016-10-26 | 西南大学 | Indirect ELISA (enzyme-linked immuno sorbent assay) detection reagent kit and detection method for bovine-derived pasteurella multocida antibodies |
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "ASW16724.1", 《GENBANK》 * |
| GENBANK: "CP004753.2", 《GENBANK》 * |
| TULASI RAO等: "Genomic Islands of Mannheimia Haemolytica – In Silico Analysis", 《CURRENT BIOINFORMATICS》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110713524A (en) * | 2019-10-31 | 2020-01-21 | 湖北工业大学 | High-sensitivity acinetobacter baumannii antigen Elisa determination kit |
| CN110713524B (en) * | 2019-10-31 | 2023-02-03 | 湖北工业大学 | High-sensitivity acinetobacter baumannii antigen Elisa determination kit |
| WO2021133328A1 (en) * | 2019-12-26 | 2021-07-01 | T.C. Erciyes Universitesi | Mannheimia haemolytica serotype a1 lateral flow immunochromatography diagnosis kit |
| CN115161211A (en) * | 2021-04-01 | 2022-10-11 | 金宇保灵生物药品有限公司 | Bovine haemolytic mannheimia strain, inactivated vaccine prepared from same and preparation method of vaccine |
| CN115161211B (en) * | 2021-04-01 | 2023-07-14 | 金宇保灵生物药品有限公司 | Cattle haemolyticus mannich bacillus strain, inactivated vaccine prepared from cattle haemolyticus mannich bacillus strain and vaccine preparation method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109239341B (en) | 2021-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109239341A (en) | A kind of indirect ELISA reagent kit of ox Mannheimia haemolytica antibody test and its application | |
| CN107056898A (en) | 3 type of carp herpesviral, 1301 plants of ORF136 DNA recombinant expressions albumen, antibody and its application | |
| CN110133284A (en) | Proteantigen and its encoding gene and they identifying the application in mycoplasma hyopneumoniae inactivated vaccine antibody and natural infection antibody | |
| Wu et al. | Serologic detection of duck enteritis virus using an indirect ELISA based on recombinant UL55 protein | |
| CN106442981B (en) | A kind of 1 type antibody indirect ELISA diagnostic kit of human bocavirus | |
| CN114736290B (en) | Nanometer antibody capable of recognizing porcine pseudorabies virus with high accuracy and sensitivity, preparation method and application | |
| CN106053807B (en) | A kind of indirect ELISA testing kit and its detection method of ox source pasteurella multocida antibody | |
| CN115873079A (en) | Canine infectious hepatitis virus hexon protein antigen, truncation and application thereof | |
| KR20210106181A (en) | Antigen protein composition for diagnosing infection of African Swan Fever and use thereof | |
| CN110483625A (en) | A kind of Mycoplasma bovis imagination albumen MbovP732 and its application | |
| Ellis et al. | Validation of an ELISA for the concurrent detection of total antibodies (IgM and IgG) to Rift Valley fever virus | |
| CN114773483A (en) | African swine fever virus antigen recombinant tandem epitope protein, construction method and application thereof, and antibody ELISA kit | |
| CN105646680A (en) | IELISA (indirect enzyme-linked immunosorbent assay) detection reagent for detecting S2 vaccine immunity of livestock as well as B.melitensis and B.abortus infection | |
| CN105153287B (en) | A kind of recombinant protein for being used to diagnose ovine coenurosis | |
| CN105137076B (en) | Small-fragment gG antigen and application of small-fragment gG antigen in detecting pseudorabies virus gG antibody | |
| CN114807178B (en) | African swine fever virus P72 protein C-terminal multi-epitope recombinant antigen and application thereof | |
| CN107664694B (en) | A kind of ELISA kit based on E2 Protein Detection pig atypia pestivirus antibody | |
| CN109824766A (en) | A kind of indirect ELISA testing kit using 4 type antibody of Fiber2 Protein Detection aviadenovirus | |
| CN110095607A (en) | For detecting universal indirect ELISA reagent kit and its application of 1 type and 3 type duck hepatitis A virus serum antibodies | |
| CN111393510B (en) | African swine fever virus recombinant antigen and application thereof | |
| CN109187952A (en) | One boar atypia pestivirus ELISA antibody assay kit | |
| CN111208302B (en) | Chemiluminescence detection kit for detecting O-type antibody of pig foot-and-mouth disease by using multi-epitope tandem protein | |
| CN101979406B (en) | Multi-epitope protein for South Africa type II foot-and-mouth disease, and preparation method and application thereof | |
| CN109884314B (en) | Indirect ELISA antibody detection method for porcine epidemic diarrhea virus S2 protein and kit thereof | |
| CN113884674A (en) | Mycoplasma bovis colloidal gold immunoassay test strip, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |