CN115873079A - Canine infectious hepatitis virus hexon protein antigen, truncation and application thereof - Google Patents

Abstract

The embodiment of the invention discloses a canine infectious hepatitis virus hexon protein antigen, a truncation and application thereof. A protein represented by the following M1): m1) 118-481 amino acids from the N end of canine infectious hepatitis virus hexon protein; the amino acid sequence of the canine infectious hepatitis virus hexon protein is shown as SEQ ID No. 1. According to the embodiment of the invention, the structure of the canine infectious hepatitis virus protein is analyzed according to the existing and predicted protein three-dimensional structure, a fragment with better stability is selected, a prokaryotic expression system is used for expression, and immunological experiments prove that the antigen protein can be well combined with the canine infectious hepatitis virus protein antibody.

Description

Canine infectious hepatitis virus hexon protein antigen, truncation and application thereof

Technical Field

The embodiment of the invention relates to the technical field of biology, in particular to a canine infectious hepatitis virus hexon protein antigen, a truncation and application thereof.

Background

Adenovirus (adenoviruses) was originally isolated from humans in 1953 and was a double-stranded DNA virus. Viruses of the family adenoviridae are generally non-enveloped, with the virus particles exhibiting a regular icosahedral structure, with diameters of 70-90 nm. The family adenoviridae is divided into two genera, depending on the subject to which it is infected: mammalian adenoviruses and avian adenoviruses. The former infects human and mammals such as apes, cows, sheep, pigs, dogs, and mice, and the latter induces tumors in rodents such as mice. The dog adenovirus has obvious pathogenicity and can cause infectious hepatitis and tracheobronchitis of the dog. Canine Infectious hepatitis virus (ICHV), also known as canine adenovirus type I (CAV I), is the causative agent of canine Infectious hepatitis. Infectious hepatitis of dogs belongs to two types of infectious diseases, which are clinically divided into hepatitis type and respiratory type, mainly occurs in puppies within 1 year of age, and has high morbidity and mortality. The sick dog and the virus-carrying dog are main infection sources, and secretion and excrement of the sick dog contain viruses. The disease is mainly transmitted via infections of the digestive tract, as well as placental, respiratory and ectoparasites.

The canine infectious hepatitis virus is spread widely in dog farms, and pet dogs are also infected, so that the virus has certain threat to dogs. The main prevention and treatment means of the virus is vaccination, and common vaccines comprise a canine infectious hepatitis attenuated vaccine, a canine infectious hepatitis and canine parvovirus enteritis bigeminy vaccine, a canine quingeminy vaccine and the like. Diagnostic methods for detecting protein antibodies allow determination of the resistance of an animal to a viral strain. Meanwhile, the antibody generated by daily monitoring of the vaccine is an important means for selecting the vaccine, evaluating the rationality of the immunization program and mastering the health state in daily monitoring of the group, and meanwhile, whether the management is reasonable or not can be reflected from the side face, and the method is also a main basis for timely vaccine injection.

The diagnosis method of canine infectious hepatitis virus mainly aims at Hexon protein Hexon. The hexon protein is the main component of the icov regular icosahedral capsid of the canine infectious hepatitis virus, contains neutralizing antigenic determinants and can initiate a neutralizing reaction. Gene and structure studies have confirmed that the ICHV hexon protein comprises a base region composed of P1 and P2 and a tower region composed of 4 Loop structures Loop1-4, wherein Loop1 (127-310 aa) and Loop2 (383-538 aa) regions comprise hypervariable regions and major antigenic determinants.

Among several methods for clinical serological detection, the serum neutralization test has fast reaction, strong specificity but low sensitivity, the test result can be influenced by different virus titers, and the method has higher requirements on samples and is not suitable for large-scale clinical detection. The ELISA has the advantages of rapidness, simplicity, convenience, low price and automatic batch detection, but also has the defects of weak specificity, high sensitivity, easy occurrence of false positive results, requirement of an enzyme-linked immunosorbent assay for determining results, and unsuitability for detecting a single sample. The immunofluorescence staining technology has the advantages of simplicity, convenience, pertinence, high accuracy, rapid diagnosis and the like, is mainly used for diagnosing the canine infectious hepatitis, but is not suitable for large-scale detection due to specific cross. The latex agglutination test is similar to the enzyme-linked immunosorbent assay, is multi-purpose for early infection detection, has high sensitivity and strong specificity, can be applied in situ, and can be used for rapid serum screening detection. The agar immunodiffusion test has the advantages of simple operation, high cost performance and wider application range. However, the sensitivity of the detection is related to the method for extracting the antigen and the reliability of the positive serum, which brings inconvenience to the detection.

In the prior art, it is imperative to establish a rapid, sensitive, highly specific, simple to operate, economical and practical diagnostic method for the level of pathogens and antibodies thereof. The focus of the invention is mainly on the hexon antigen protein and the application thereof.

Disclosure of Invention

To this end, embodiments of the present invention provide canine infectious hepatitis virus hexon protein antigens, truncations, and uses thereof.

In order to achieve the above object, the embodiments of the present invention provide the following technical solutions:

the present invention provides a protein represented by the following M1):

m1) 118 th to 481 th amino acid residues of the canine infectious hepatitis virus hexon protein from the N end;

the amino acid sequence of the canine infectious hepatitis virus hexon protein is shown as SEQ ID No. 1.

The invention also provides a protein or a truncation, wherein the truncation is shown in any one of the following (1) to (4):

(1) The amino acid sequence is protein shown in SEQ ID No. 2;

(2) A fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in SEQ ID No. 2;

(3) The protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2;

(4) And (b) a protein having 95% or more identity to the amino acid sequence shown in SEQ ID No.2 and having the same function.

A gene encoding the above-mentioned protein or a truncated form thereof.

In one embodiment of the present invention, the gene encoding the protein or the truncation described in M1) is any one of the following 1) to 3):

1) A DNA molecule shown as SEQ ID No. 3;

2) A DNA molecule which hybridizes under stringent conditions with the DNA molecule defined in 1) and which encodes the protein described in M1) in claim 1 or the truncation described in claim 2;

3) A DNA molecule having 95% or more identity to the DNA molecule defined in 1) or 2) and encoding the protein defined in M1) above or the truncation described in claim 2.

Any one of the following biomaterials (a 1) to (a 4): (a1) An expression cassette comprising the encoding gene of claim 3 or 4; (a2) A recombinant vector comprising the gene encoding the gene of claim 3 or 4; (a3) A recombinant bacterium containing the coding gene of claim 3 or 4; (a4) A transgenic cell line comprising the gene encoding the gene of claim 3 or 4 is also within the scope of the present invention.

The invention also provides the application of the protein and/or the protein or the truncation thereof and/or the coding gene and/or the biological material in preparing immunogen and/or antigen, or the immunogen or antigen is directed against canine infectious hepatitis virus or canine infectious hepatitis virus hexon protein.

The protein and/or the protein or the truncated body thereof and/or the coding gene and/or the biological material are/is used as antigen in the preparation of the antibody against the canine infectious hepatitis virus;

or, the protein and/or the protein or the truncation thereof and/or the coding gene and/or the biological material in the preparation of products for preventing and/or treating diseases caused by canine infectious hepatitis virus;

or, the application of the protein and/or the protein or the truncation thereof and/or the coding gene and/or the biological material in preventing and/or treating diseases caused by the canine infectious hepatitis virus belongs to the protection scope of the invention.

Use of the protein and/or the protein or a truncated form thereof and/or the encoding gene and/or the biological material as described above in any one of the following (a 1) to (a 6): (a 1) inhibiting viral infection; (a 2) a product that inhibits viral infection; (a 3) inhibiting viral entry; (a 4) products that inhibit viral entry; (a 5) detecting a virus antibody; (a 6) products for detecting viral antibodies; the virus is canine infectious hepatitis virus.

The invention also provides a product, the active ingredient of which is the protein or the truncated body thereof; the product functions as (b 1) - (b 3), (b 1) a medicament or vaccine for inhibiting viral infection; (b 2) a drug or vaccine that inhibits viral entry; (b 3) a reagent for detecting a virus antibody; the virus is canine infectious hepatitis virus.

The invention also provides a polyclonal antibody which is prepared by taking the protein or the truncated body thereof as immunogen.

The embodiment of the invention has the following advantages:

according to the embodiment of the invention, the structure of the canine infectious hepatitis virus protein is analyzed according to the existing and predicted three-dimensional structure of the protein, a fragment with better stability is selected, a prokaryotic expression system is used for expression, and immunological experiments prove that the antigen protein can be well combined with the canine infectious hepatitis virus protein antibody.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It should be apparent that the drawings in the following description are merely exemplary, and that other embodiments can be derived from the drawings provided by those of ordinary skill in the art without inventive effort.

The structures, ratios, sizes, and the like shown in the present specification are only used for matching with the contents disclosed in the specification, so that those skilled in the art will understand and read the present invention, and do not limit the conditions for implementing the present invention, so that the present invention has no technical essence, and any modifications of the structures, changes of the ratio relationships, or adjustments of the sizes, should still fall within the scope covered by the technical contents disclosed in the present invention without affecting the efficacy and the achievable purpose of the present invention.

FIG. 1 shows the alignment of the protein sequences of hexon protein of canine infectious hepatitis virus provided in the examples of the present invention;

FIG. 2 is a schematic diagram of the A chain structure of published human adenovirus 41 hexon 6YBA according to the present invention;

FIG. 3 is the structure of the AlphaFold predicted hexon protein of canine infectious hepatitis virus provided by the embodiment of the invention;

FIG. 4 is a graph comparing the human adenovirus 41 hexon 6YBA (green) and canine infectious hepatitis virus hexon protein (blue) provided in accordance with an embodiment of the present invention;

FIG. 5 is a schematic diagram of different domains of the hexon protein of the canine infectious hepatitis virus provided by the embodiment of the invention;

FIG. 6 is a diagram of the result of CAV I118-481 aa protein electrophoresis provided by the embodiment of the present invention.

Description of the preferred embodiment

The present invention is described in terms of particular embodiments, other advantages and features of the invention will become apparent to those skilled in the art from the following disclosure, and it is to be understood that the described embodiments are merely exemplary of the invention and that it is not intended to limit the invention to the particular embodiments disclosed. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the present invention, the capsid of the adenovirus icosahedral capsid is composed of 122 capsomeres, of which 110 capsomeres are hexon proteins and 12 capsomeres are penton proteins. The hexon protein is the main antigen epitope of the adenovirus, and the conserved region has strong antigenicity and exposition, can induce high-titer anti-adenovirus specific antibody, and can be used for routine immunological diagnosis of the adenovirus with different types and groups of specific antigen epitopes. Through searching the canine infectious hepatitis virus hexon protein sequence by NCBI (national center for Biotechnology information) in the American biotechnology information center, the 905 amino acid with the serial number ALY06351 is finally determined to be the canine infectious hepatitis virus hexon protein sequence, the corresponding nucleotide sequence is numbered KP840545, and the total length is 2718 bp. The amino acid sequence (SEQ ID No. 1) of the canine infectious hepatitis virus hexon protein is as follows:

MATPSMLPQWSYMHIAGQDAAEYLSPALVQFAQATSSYFKLDNKFRNPTVAPTHDVTTERSQRLQLRFVPVMQEDGQYTYKTRFQLAVGDNRVLDMASTYFDIRGTLDRGPSFKPYSGTAYNALAPRAGANNCLFNGSGANINTLAQVPFAGAITVNGQAAVTDNTYQPEPQLGPESWVDGTLADLGDASGRALKASTPRMPCYGSYAPPTNENGGQATGAVERRFYKVTTNNNNEADALLYTEDVNLQTPDTHLVHQVSDDQVTGVQGLGQQAAPNRPNYIGFRDNFIGLMYYNSNGNLGVLAGQSSQLNAVVDLQDRNTELSYQLLLDALTDRSRYFSMWNQAVDSYDQDVRIIDNHGVEDDMPNYCFPLSGMGPLTNMTAMKVNSQNFQTDNTNVGPIQKIGFGNVEAMEINLNANLFKGFLYSNVALYLPDAYKYTPDNIVAPANANTYAYMNVRLPAANLIDTFVNIGARWSPDVMDSVNPFNHHRNAGLRYRSQLLGNGRYCSFHIQVPQKFFAIKNLLLLPGTYTYEWSFRKDVNMILQSSLGNDLRVDGASINIQSINLYASFFPMAHNTASTLEAMLRNDVNDQSFADYLSAANMLYPIPANTTNLPISIPARNWAGFRGWSFTRIKQRETPALGSPYDPYFTYSGSIPYLDSTFYLSHTFRRVSIMFDSSVSWPGNDRLLTPNEFEIKRYVDGEGYNVAQSNMTKDWFLVQMLAHYNIGYQGYHLPESYKDRMYSFLRNFEPMCRQLVDVTNYATYQSVTVGHQHNNSGYASALSTFNPREGHPYPANWPYPLIGVNAVPTVTQKKFLCDRTLWRIPFSSNFMSMGTLTDLGQNLLYSNSAHALDMTFEVDAMNEPTLLYVLFEVFDVARVHQPHRGVIEVVYLRTPFSAGNATT。

the nucleotide sequence (SEQ ID No. 4) of the encoding canine infectious hepatitis virus hexon protein is as follows:

atggcaactccgtcgatgctgccacaatggtcttacatgcacattgctggccaggacgccgccgaatacttgtctcccgccctggttcagtttgcccaagcaaccagttcttactttaagttggacaacaagttcagaaaccccactgtggcccccactcacgatgtaaccactgaaaggtctcagcgcttgcagttgcgctttgtgccagttatgcaagaagatggccagtacacttacaaaacccggttccaattggcagtgggagataacagggttctggacatggccagtacctactttgacattaggggcaccctagacagaggcccctccttcaagccctacagtgggacggcttacaatgctctcgctcccagagctggggctaataactgcctatttaatggatcaggtgccaacattaacactttagcccaagtgccatttgcgggcgccattaccgttaatggtcaagccgcagtcacagacaacacctaccagccagagccccagctgggccctgaaagttgggtggatggcaccttggcagacctaggagatgcgtctggccgcgccctgaaagcatcgaccccacgcatgccttgctacggttcttatgctccccccaccaatgaaaacggaggtcaagcaactggggccgtggaacgaagattctataaagtgaccaccaacaataataatgaagctgatgccctactatatacagaagatgtgaacctccaaaccccagacacccacttggtgcatcaggtgtcagacgatcaggttacaggtgtacagggactggggcaacaagctgccccaaacaggccaaattacattggctttagagataactttataggtttaatgtattacaatagtaatggaaacctaggggtgctggcgggtcaatcgtctcaactaaatgccgtggtggacttgcaagacagaaacacagagctttcttatcagctgttgctagatgcccttacagataggtctcgctacttttccatgtggaaccaggcagtagatagctatgaccaggatgtcaggattattgacaatcacggcgtggaagacgacatgccaaactattgcttcccactgagcggcatgggaccattaactaacatgacagctatgaaggtcaatagtcaaaactttcaaacggacaacactaacgtgggtcccattcaaaagattggtttcggaaatgttgaggccatggagataaatctcaatgctaacctctttaaaggttttctctactccaatgtggccctatacctacctgatgcctataaatacacacctgataacattgtagctcctgctaatgcaaatacctatgcttacatgaatgtgagattgcccgctgctaaccttatagacacatttgtaaatattggcgccagatggtcacctgatgtaatggactctgttaatccttttaaccaccacagaaatgcaggactccgctaccgatcacagctgcttggcaatggccgctattgctcgttccatattcaggtccctcaaaaattttttgcaatcaaaaatcttctccttctaccgggtacgtacacgtacgagtggtctttcaggaaggatgtaaacatgatccttcagagcagcttgggcaatgacctccgagtggatggagcctctatcaacattcaaagcatcaacctatatgccagctttttccccatggcacacaacacagcctccactttggaagccatgctgcgcaatgatgtaaatgaccagtcctttgcagactacctgtctgccgccaacatgctttatccgatccctgccaacactacaaacctaccaatctccattcctgccagaaattgggccggattcagagggtggagctttaccagaattaagcagcgggaaactccagccctgggctcaccttacgacccctactttacttactcgggtagcattccctacctggattcaactttctatcttagccacaccttcagaagagtctccatcatgtttgactcttctgtatcttggccgggtaatgacaggctcctcactccaaatgagtttgagattaaaaggtatgtggacggtgaaggctacaacgtggcccagtccaacatgacaaaagattggtttctggttcaaatgctggctcattacaacattggctatcaaggctaccacttgcccgagagctacaaagacagaatgtactcattcctcagaaattttgagcccatgtgcagacaactggtagatgtaactaactatgctacctaccagtcagtcaccgtaggtcaccagcataacaattctggatatgctagcgccctttcaacctttaacccaagggagggtcacccctatccggcaaactggccttatcccctaatcggggtcaatgctgtgcctactgttacccaaaaaaagttcctttgtgacagaaccctatggcgcatccccttctcttccaactttatgtctatgggcaccctcactgaccttggtcaaaacctgctgtactccaactccgctcacgcccttgacatgactttcgaggttgatgccatgaatgagcccactctgttgtacgttttgtttgaagtgttcgacgtggcacgtgttcatcaaccccaccgaggggtgattgaagtagtgtacctcagaactcccttctccgccggcaacgccacgacctaa。

comparing the protein sequence with data in a protein structure database (PDB) in NCBI Blast function, as shown in figure 1, the three-dimensional structure of the protein of canine infectious hepatitis virus hexon protein hexon is not analyzed yet, but has higher sequence similarity with the existing structure, the most similar structure is the structure of human adenovirus 41 hexon (PDB number 6YBA chain A), the sequence homology is 71.26%, and the full length is 905 amino acids.

The published structure of chain A in hexon 6YBA of human adenovirus 41 is shown in FIG. 2, wherein the leftmost alpha helices are N-terminal of the whole protein, the central alpha helices, beta sheets and the domain with dense random coil are C-terminal domains, and the rightmost extended part with beta sheets and random coil as main parts belongs to the middle of the full-length sequence. The structure is obtained by directly analyzing the whole structure of the virus particles, and the virus particles are obtained by directly culturing eukaryotic cells, so that the cost is relatively high.

The invention utilizes an AlphaFold structure prediction function provided by a free structure display software ChimeraX developed by UCSF of the university of san Francisco in California, inputs 905 amino acid sequences of canine infectious hepatitis virus hexon protein hexon, uses AlphaFold software to calculate and predict a three-dimensional structure of the protein, the predicted structure is shown in figure 3, the structure is relatively similar to a homologous structure 6YBA in sequence space position distribution, two alpha helices and irregular curls on the leftmost side are N ends of the whole protein, alpha helices, beta sheets and irregular curls extending from the rightmost side belong to the middle part of a full-length sequence, and alpha helices, long beta sheets and structural domains with dense irregular curls in the middle part of the structure are C-end structural domains. Through the alignment of specific structures, as shown in fig. 4, the two are greatly different in details of protein structures, and the root mean square deviation r.m.s.d. of the structural alignment was calculated to be 3.4 a using Dali server provided by university of helsinki, finland, with a large difference.

The structure of canine infectious hepatitis virus hexon protein is divided according to the space structure, as shown in fig. 5, the N-terminal domain composed of 1-56 aa at the N-terminal is shown to be golden yellow and is distributed outside the other two larger domains. The middle, dark blue domain includes 57-117aa,280-349aa,482-766aa, and 810-905aa, which includes the structural body and the C-terminal amino acids. The bluish domain on the right comprises the three portions 118-279aa,350-481aa and 767-809aa, and has fewer amino acids relative to the middle domain. From this spatial distribution, it was predicted that the three truncation fragments 57-905aa,118-481aa, and 482-905aa might be more stable over full length and predicted to have antigenic activity.

According to the prediction result of the canine infectious hepatitis virus hexon protein structure, the full-length canine infectious hepatitis virus hexon protein CAV I1-905 aa and three truncation fragments CAV I57-905 aa, CAV I118-481 aa and CAV I482-905 aa are expressed and purified. The gene sequence of the full-length protein was synthesized at gene company, and then PCR amplification was performed by designing primer pairs for 3 truncation fragments.

Then, a molecular cloning method is used for respectively connecting 4 segments in total, which encode the full-length canine infectious hepatitis virus hexon protein CAV I1-905 aa, the truncation segment CAV I57-905 aa, the truncation segment CAV I118-481 aa and the truncation segment CAV I482-905 aa, into the prokaryotic expression vector pGEX-6p-1, and performing prokaryotic protein expression of the 4 segments in escherichia coli.

The result shows that the nucleotide fragment encoding the two longer fragments CAV I1-905 aa and CAV I57-905 aa does not express soluble expressed protein, and the target protein is in an inclusion body precipitation state. Encoding CAV I118-481 aa and CAV I482-905 aa, and obtaining the target protein. The electrophoresis result of the CAV I118-481 aa fragment protein is shown in FIG. 6, and the target protein has correct size and high purity and contains partial impurity fragments.

The CAV I118-481 aa and CAV I482-905 aa proteins purified from canine infectious hepatitis virus (CAV I) were tested for antigenic activity by ELISA. The protein concentration of CAV I118-481 aa and CAV I482-905 aa respectively coated and purified is 0.1 mu g/mL,100 mu L/hole, PBST washing liquor (0.1%) of 0.1% gelatin at 37 ℃ for 2 h and 250 mu L/hole is washed for 3 times, the diluted CAV I virus monoclonal antibody 100 mu L/hole is washed for 1 h at 37 ℃ (positive control group is CAV I virus particles, negative control group is PBS buffer solution, each group is repeated for three times), PBST washing liquor (0.1%) of 250 mu L/hole is washed for 3 times, after drying, 100 mu L/hole of HRP enzyme-labeled rabbit anti-mouse secondary antibody (diluted by PBS according to 1 10000) is added, reaction is carried out at 37 ℃ for 30 min, and the plate is washed again3 times, drying, adding TMB developing solution (commercial) 100 μ L/well, developing at room temperature for 10 min, adding 0.5M sulfuric acid, 50 μ L/well, terminating reaction, and measuring OD with enzyme-labeling instrument _450nm The value is obtained.

The results of the antigen activity verification of the purified and expressed CAV I118-481 aa protein and CAV I482-905 aa protein are shown in Table 1, the CAV I118-481 aa protein is close to a positive control and has better antigen activity, and the CAV I482-905 aa protein is close to a negative control and does not have antigen activity. Therefore, an ELISA detection antibody kit can be prepared by using the CAV I118-481 aa according to the system.

Positive control	Negative control	CAV I 118-481aa	CAV I 482-905aa
				2.594	0.056	2.245	0.068
2.567	0.061	2.304	0.073
				2.624	0.064	2.285	0.070

TABLE 1 verification of antigen Activity

In the invention, the amino acid sequence of the CAV I118-481 aa protein is (SEQ ID NO. 2):

GTAYNALAPRAGANNCLFNGSGANINTLAQVPFAGAITVNGQAAVTDNTYQPEPQLGPESWVDGTLADLGDASGRALKASTPRMPCYGSYAPPTNENGGQATGAVERRFYKVTTNNNNEADALLYTEDVNLQTPDTHLVHQVSDDQVTGVQGLGQQAAPNRPNYIGFRDNFIGLMYYNSNGNLGVLAGQSSQLNAVVDLQDRNTELSYQLLLDALTDRSRYFSMWNQAVDSYDQDVRIIDNHGVEDDMPNYCFPLSGMGPLTNMTAMKVNSQNFQTDNTNVGPIQKIGFGNVEAMEINLNANLFKGFLYSNVALYLPDAYKYTPDNIVAPANANTYAYMNVRLPAANLIDTFVNIGARWSPDVM。

the nucleotide molecule 352-1443bp sequence (SEQ ID NO. 3) corresponding to the CAV I118-481 aa protein is coded:

gggacggcttacaatgctctcgctcccagagctggggctaataactgcctatttaatggatcaggtgccaacattaacactttagcccaagtgccatttgcgggcgccattaccgttaatggtcaagccgcagtcacagacaacacctaccagccagagccccagctgggccctgaaagttgggtggatggcaccttggcagacctaggagatgcgtctggccgcgccctgaaagcatcgaccccacgcatgccttgctacggttcttatgctccccccaccaatgaaaacggaggtcaagcaactggggccgtggaacgaagattctataaagtgaccaccaacaataataatgaagctgatgccctactatatacagaagatgtgaacctccaaaccccagacacccacttggtgcatcaggtgtcagacgatcaggttacaggtgtacagggactggggcaacaagctgccccaaacaggccaaattacattggctttagagataactttataggtttaatgtattacaatagtaatggaaacctaggggtgctggcgggtcaatcgtctcaactaaatgccgtggtggacttgcaagacagaaacacagagctttcttatcagctgttgctagatgcccttacagataggtctcgctacttttccatgtggaaccaggcagtagatagctatgaccaggatgtcaggattattgacaatcacggcgtggaagacgacatgccaaactattgcttcccactgagcggcatgggaccattaactaacatgacagctatgaaggtcaatagtcaaaactttcaaacggacaacactaacgtgggtcccattcaaaagattggtttcggaaatgttgaggccatggagataaatctcaatgctaacctctttaaaggttttctctactccaatgtggccctatacctacctgatgcctataaatacacacctgataacattgtagctcctgctaatgcaaatacctatgcttacatgaatgtgagattgcccgctgctaaccttatagacacatttgtaaatattggcgccagatggtcacctgatgtaatg。

1. ELISA antibody detection kit detection process

In this embodiment, the CAV I118-481 aa protein prepared in example 2 is used as an antigen to prepare an ELISA detection antibody kit detection process, and the process for detecting the antibody comprises the following steps:

step one, taking out a CAV I118-481 aa protein antigen coated plate from an ELISA detection kit, diluting the serum to be detected with 2 times of sample diluent on a serum dilution plate (60 mu L of sample diluent is mixed with 60 mu L of serum to be detected), taking 100 mu L of mixed solution and adding the mixed solution into the ELISA plate, and simultaneously adding 2 holes of positive serum and negative serum, wherein each hole is 100 mu L.

And step two, gently oscillating the sample in each well, covering the coating plate with a sealing plate film, and incubating for 30 minutes at 37 ℃.

And step three, discarding the solution in the plate hole of the coating plate, adding 250 mu L of working washing solution into each hole, and repeating for 3 times. And thoroughly drying the liquid after the plate is washed for the last time.

And step four, adding 100 mu L of enzyme-labeled antibody into each hole, covering the coating plate with a sealing plate film, and incubating for 30 minutes at 37 ℃.

And step five, discarding the solution in the plate holes of the preparation plate, adding 250 mu L of working washing solution into each hole, and repeating for 3 times. And thoroughly drying the liquid after the plate is washed for the last time.

And step six, adding 100 mu L of substrate solution into each hole, covering the coated plate with a sealing plate film, and incubating for 10 minutes at room temperature.

And step seven, adding 50 mu L of stop solution into each hole to stop the reaction. Determination of the absorbance (OD) at 450 nm for the samples and controls _450nm ). Interpretation criteria: S/P = (sample to be tested OD) _450nm Mean-negative control OD _450nm Mean)/(positive control OD _450nm Mean-negative control OD _450nm Mean value). The S/P is more than or equal to 0.3, and the serum antibody of the sample to be detected reaches the protection level; the S/P is less than 0.3, the sample is negative, and the serum antibody of the sample to be detected does not reach the protection level.

2. Specificity test of ELISA antibody detection kit

The canine infectious hepatitis virus antibody level detection kit is used for detecting standard antibody positive serum of canine parvovirus CPV, canine distemper virus CDV, rabies virus RABV and the like and canine infectious hepatitis virus CAV I antibody positive serum.

The detection results are shown in table 2, except that the S/P value of the positive serum of the CAV I standard antibody is significantly greater than 0.3, the S/P values of the other sera are less than 0.3, and the determination standard of the negative serum is met, which indicates that the ELISA detection antibody kit prepared in the embodiment 2 of the invention has good specificity.

TABLE 2 specific serum test results

Item	CAV I	CPV	CDV	RABV	Positive control	Negative control
							S/P	0.935	0.025	0.084	0.055	1
OD 450nm	2.293	0.108	0.250	0.181	2.450	0.049

3. ELISA antibody detection kit sensitivity test

The positive serum of the CAV I standard antibody is respectively diluted by 2, 4, 8, 16, 32 and 64 times, and the ELISA detection antibody kit prepared in the embodiment 2 of the invention and the ELISA detection kit for the outsourcing canine infectious hepatitis virus are used for simultaneous detection. The detection result is shown in the following table 3, the ELISA kit can detect CAV I standard antibody positive serum diluted by 32 times, and the externally purchased kit can detect CAV I standard antibody positive serum diluted by 16 times, which indicates that the canine infectious hepatitis virus Elisa antibody detection kit has good sensitivity.

TABLE 3 detection results of the sensitivity of the ELISA kit of the present invention

4. Comparison of compliance rates of ELISA assay kits

The ELISA kit and the externally purchased dog infectious hepatitis virus Elisa antibody detection kit are used for simultaneously detecting 25 serum samples, and the results are compared, the coincidence rate of the whole sample detection of the ELISA kit and the externally purchased kit is 96%, so that the ELISA kit and the externally purchased kit have good adaptability with an externally purchased control kit, and the specific results are shown in the following tables 4 and 5.

TABLE 4 comparison of sample conformity rates of ELISA kit and outsourcing kit of the present invention

TABLE 5 sample compliance rate results for ELISA and outsourcing kits of the invention

The CAV I118-481 aa protein antigen prepared by the invention has strong affinity with an antibody, and is used for establishing a high-sensitivity detection and diagnosis method. The CAV I118-481 aa protein has better antigen stability, higher expression quantity, lower cost and better specificity and sensitivity for detecting the antibody level, and can be used for establishing a more accurate and faster detection kit.

Although the invention has been described in detail above with reference to a general description and specific examples, it will be apparent to one skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, it is intended that all such modifications and alterations be included within the scope of this invention as defined in the appended claims.

Claims (10)

1. A protein represented by the following M1):

m1) 118 th to 481 th amino acid residues of the canine infectious hepatitis virus hexon protein from the N end; the amino acid sequence of the canine infectious hepatitis virus hexon protein is shown as SEQ ID No. 1.

2. A protein or a truncation thereof, wherein the truncation is as shown in any one of the following (1) to (4):

(1) The amino acid sequence is protein shown as SEQ ID No. 2;

(2) A fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in SEQ ID No. 2;

(3) The protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2;

(4) And (b) a protein having 95% or more identity to the amino acid sequence shown in SEQ ID No.2 and having the same function.

3. A gene encoding the protein according to claim 1 or the protein according to claim 2 or a truncation thereof.

4. The coding gene of claim 3,

the gene encoding the protein of claim 1) or the truncated form of the protein of claim 2 is any one of the following 1) to 3):

a DNA molecule shown as SEQ ID No. 3;

a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in 1) and which encodes the protein M1) of claim 1 or the truncation of claim 2;

a DNA molecule having more than 95% identity to the DNA molecule defined in 1) or 2) and encoding the protein of M1) of claim 1 or the truncation of claim 2.

5. Any one of the following biomaterials (a 1) to (a 4):

(a1) An expression cassette comprising the encoding gene of claim 3 or 4;

(a2) A recombinant vector comprising the gene encoding the polypeptide of claim 3 or 4;

(a3) A recombinant bacterium containing the coding gene of claim 3 or 4;

(a4) A transgenic cell line comprising the gene encoding the gene of claim 3 or 4.

6. Use of a protein according to claim 1 and/or a protein according to claim 2 or a truncation thereof and/or a gene encoding a protein according to claim 3 or 4 and/or a biological material according to claim 5 in the preparation of an immunogen and/or an antigen, or the immunogen or antigen is directed against canine infectious hepatitis virus or canine infectious hepatitis virus hexon protein.

7. Use of the protein of claim 1 and/or the protein of claim 2 or a truncation thereof and/or the coding gene of claim 3 or 4 and/or the biological material of claim 5 as an antigen in the preparation of an antibody against canine infectious hepatitis virus;

or, the use of the protein of claim 1 and/or the protein of claim 2 or a truncation thereof and/or the coding gene of claim 3 or 4 and/or the biological material of claim 5 in the preparation of a product for preventing and/or treating diseases caused by canine infectious hepatitis virus;

or, the use of the protein of claim 1 and/or the protein of claim 2 or a truncation thereof and/or the coding gene of claim 3 or 4 and/or the biological material of claim 5 for the prevention and/or treatment of a disease caused by canine infectious hepatitis virus.

8. Use of the protein of claim 1 and/or the protein of claim 2 or a truncation thereof and/or the coding gene of claim 3 or 4 and/or the biological material of claim 5 in any one of (a 1) to (a 6) below:

(a1) Inhibiting viral infection;

(a2) Products that inhibit viral infection;

(a3) Inhibiting virus invasion;

(a4) Products that inhibit viral entry;

(a5) Detecting the virus antibody;

(a6) Products for detecting viral antibodies;

the virus is canine infectious hepatitis virus.

9. A product comprising as an active ingredient the protein of claim 1 or the protein of claim 2 or a truncation thereof;

the function of the product is as follows (b 1) - (b 3)

(b1) Drugs or vaccines that inhibit viral infection;

(b2) Drugs or vaccines that inhibit viral entry;

(b3) Reagents for detecting viral antibodies;

the virus is canine infectious hepatitis virus.

10. A polyclonal antibody prepared by using the protein of claim 1 or the protein of claim 2 or a truncated form thereof as an immunogen.

Images