CN115873079B - Canine infectious hepatitis virus hexon protein antigen, truncated body and application thereof - Google Patents
Canine infectious hepatitis virus hexon protein antigen, truncated body and application thereof Download PDFInfo
- Publication number
- CN115873079B CN115873079B CN202310143209.2A CN202310143209A CN115873079B CN 115873079 B CN115873079 B CN 115873079B CN 202310143209 A CN202310143209 A CN 202310143209A CN 115873079 B CN115873079 B CN 115873079B
- Authority
- CN
- China
- Prior art keywords
- protein
- hepatitis virus
- infectious hepatitis
- canine infectious
- canine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The embodiment of the invention discloses a canine infectious hepatitis virus hexon protein antigen, a truncated body and application thereof. The protein shown in the following M1): m1) canine infectious hepatitis virus hexon protein, amino acids 118-481 from the N-terminus; the amino acid sequence of the canine infectious hepatitis virus hexon protein is shown as SEQ ID No. 1. According to the embodiment of the invention, the structure of the canine infectious hepatitis virus protein is analyzed according to the existing and predicted protein three-dimensional structure, fragments with better stability are selected, a prokaryotic expression system is used for expression, and through immunological experiments, the antigen protein can be well combined with the canine infectious hepatitis virus protein antibody, and the antibody detection kit prepared by using the antigen has good effect, lower cost and strong specificity and stability.
Description
Technical Field
The embodiment of the invention relates to the technical field of biology, in particular to a canine infectious hepatitis virus hexon protein antigen, a truncated body and application thereof.
Background
Adenovirus (adenoviruses) was originally isolated from humans in 1953 and was a double-stranded DNA virus. Viruses of the adenoviridae family are generally non-enveloped, and the virus particles exhibit an orthoicosahedral structure, with diameters of 70-90 nanometers. The adenoviridae are divided into two genera according to the infected subjects: mammalian adenoviruses and avian adenoviruses. The former is infected with mammals such as human beings, apes, cattle, sheep, pigs, dogs, mice and the like, and can induce tumors in rodents such as mice and the like. The adenovirus of the dog has obvious pathogenicity, and can cause infectious hepatitis and tracheobronchitis of the dog. Canine infectious hepatitis virus (Infectious canine hepatitis virus, ICHV), also known as canine adenovirus type I (CAV I), is the causative agent of canine infectious hepatitis (Infectious canine hepatitis). The canine infectious hepatitis belongs to two infectious diseases, clinically divided into hepatitis type and respiratory type, mainly occurs on puppies within 1 year of age, and has high morbidity and mortality. The sick dogs and the dogs with viruses are main infectious agents, and secretions and excretions of the sick dogs contain viruses. The disease is mainly transmitted by infection of digestive tract, placenta, respiratory tract and ectoparasites.
The canine infectious hepatitis virus is widely spread in dog farms, and the pet dogs are infected, so that the virus has a certain threat to dogs. The main prevention and treatment means of the virus are vaccination, common vaccines include canine infectious hepatitis attenuated vaccines, and canine infectious hepatitis and canine parvovirus enteritis bivalent vaccine, canine quintuplet vaccine and the like. Diagnostic methods for detecting protein antibodies can determine the resistance of an animal to a viral strain. Meanwhile, the daily monitoring of vaccine production antibody is an important means for selecting vaccine, evaluating the reasonability of immune program and grasping health state in daily monitoring of population, and can reflect whether management is reasonable or not from the side, and is a main basis for timely vaccine injection.
The diagnosis method of the canine infectious hepatitis virus mainly aims at the Hexon protein Hexon. The hexon protein is the main component of the icov icosahedral capsid of the canine infectious hepatitis virus, and contains neutralizing epitopes that trigger a neutralization reaction. Gene and structural studies have demonstrated that ICHV hexon protein comprises a basal region consisting of P1 and P2 and a tower region consisting of 4 Loop structures Loop1-4, wherein Loop1 (127-310 aa) and Loop2 (383-538 aa) regions comprise hypervariable regions and major antigenic determinants.
In several methods of clinical serological detection, the serum neutralization test has fast reaction, strong specificity, but low sensitivity, the test result can be influenced by different virus titers, and meanwhile, the method has higher requirements on samples, and is not suitable for clinical large-scale detection. The ELISA has the advantages of being quick, simple, low in cost and capable of automatically detecting in batches, but also has the defects of low specificity, high sensitivity, easy occurrence of false positive results, requirement of an ELISA tester for measuring results and inapplicability to detection of single samples. The immunofluorescence staining technique has the advantages of simplicity, convenience, pertinence, high accuracy, rapid diagnosis and the like, is mainly used for diagnosing the infectious hepatitis of dogs, but meanwhile, the method is crossed in specificity and is not suitable for mass detection. The latex agglutination test is similar to the ELISA, is mostly used for early infection detection, has high sensitivity and strong specificity, can be applied in situ, and can be used for rapid serum screening detection. The agar immunodiffusion test is simple to operate, high in cost performance and wider in application range. However, the sensitivity of detection is related to the method of extracting the antigen and the reliability of the positive serum, which brings inconvenience to the detection.
In the prior art, aiming at the uneven diagnosis reagent of the pathogen and the antibody level thereof, the establishment of a rapid, sensitive, strong-specificity, simple-operation, economical and practical diagnosis method is imperative. The focus of the invention is mainly on hexon antigen proteins and their use.
Disclosure of Invention
Therefore, the embodiment of the invention provides a canine infectious hepatitis virus hexon protein antigen, a truncated body and application thereof.
In order to achieve the above object, the embodiment of the present invention provides the following technical solutions:
the present invention provides a protein represented by the following M1):
m1) the 118 th to 481 th amino acid residues of the canine infectious hepatitis virus hexon protein from the N-terminus;
the amino acid sequence of the canine infectious hepatitis virus hexon protein is shown as SEQ ID No. 1.
The invention also provides a protein or a truncated body, wherein the truncated body is shown in any one of the following (1) - (4):
(1) The amino acid sequence is a protein shown as SEQ ID No. 2;
(2) A fusion protein obtained by connecting a tag to the N-terminal and/or C-terminal of the protein shown in SEQ ID No. 2;
(3) A protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 2;
(4) A protein which has more than 95% of identity with the amino acid sequence shown in SEQ ID No.2 and has the same function.
The above-mentioned protein or a gene encoding the protein or a truncated form thereof.
In one embodiment of the invention, M1) said protein or said truncating gene is as set forth in any one of the following 1) to 3):
1) A DNA molecule shown in SEQ ID No. 3;
2) A DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in 1) and which codes for the protein described in M1) above or for the truncations described above;
3) A DNA molecule which has more than 95% identity with the DNA molecule defined in 1) or 2) and which encodes the protein described in M1) above or the truncations described above.
A biological material of any one of the following (a 1) to (a 4): (a 1) an expression cassette comprising the above-described coding gene; (a 2) a recombinant vector comprising the above-mentioned coding gene; (a 3) a recombinant bacterium comprising the above-mentioned coding gene; (a4) Transgenic cell lines containing the above-described coding genes are also within the scope of the present invention.
In another aspect, the invention also provides the use of said protein and/or said protein or a truncate thereof and/or said coding gene and/or said biological material in the preparation of an immunogen and/or antigen, or said immunogen or antigen is directed against canine infectious hepatitis virus or canine infectious hepatitis virus hexon protein.
The application of the protein and/or the protein or the truncated body thereof and/or the encoding gene and/or the biological material as antigen in preparing the antibody against the canine infectious hepatitis virus;
or, the application of the protein and/or the protein or the truncated body thereof and/or the coding gene and/or the biological material in preparing products for preventing and/or treating diseases caused by canine infectious hepatitis virus;
or, the application of the protein and/or the protein or the truncated body thereof and/or the coding gene and/or the biological material in preventing and/or treating diseases caused by canine infectious hepatitis virus belongs to the protection scope of the invention.
The use of a protein as described above and/or a truncating thereof and/or a gene encoding said protein and/or said biological material in any one of the following (a 1) to (a 6): (a 1) inhibiting viral infection; (a 2) a product that inhibits viral infection; (a 3) inhibiting viral entry; (a 4) a product that inhibits viral entry; (a 5) detecting viral antibodies; (a 6) a product for detecting viral antibodies; the virus is canine infectious hepatitis virus.
The invention also provides a product, the active ingredient of which is the protein or the truncations thereof; the function of the product is as follows (b 1) - (b 3), (b 1) a drug or vaccine that inhibits viral infection; (b 2) a drug or vaccine that inhibits viral entry; (b 3) a reagent for detecting a viral antibody; the virus is canine infectious hepatitis virus.
The invention also provides a polyclonal antibody which is prepared by taking the protein or the truncated body thereof as an immunogen.
The embodiment of the invention has the following advantages:
according to the embodiment of the invention, the structure of the canine infectious hepatitis virus protein is analyzed according to the existing and predicted protein three-dimensional structure, fragments with better stability are selected, a prokaryotic expression system is used for expression, and through immunological experiments, the antigen protein can be well combined with the canine infectious hepatitis virus protein antibody, and the antibody detection kit prepared by using the antigen has good effect, lower cost, good specificity and high stability.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It will be apparent to those of ordinary skill in the art that the drawings in the following description are exemplary only and that other implementations can be obtained from the extensions of the drawings provided without inventive effort.
The structures, proportions, sizes, etc. shown in the present specification are shown only for the purposes of illustration and description, and are not intended to limit the scope of the invention, which is defined by the claims, so that any structural modifications, changes in proportions, or adjustments of sizes, which do not affect the efficacy or the achievement of the present invention, should fall within the scope of the invention.
FIG. 1 shows the result of protein sequence alignment of the hexon protein of the canine infectious hepatitis virus provided by the example of the present invention;
FIG. 2 is a schematic diagram showing the structure of the A chain in the published human adenovirus 41 hexon 6YBA according to the embodiment of the invention;
FIG. 3 shows the structure of the hexon protein of the canine infectious hepatitis virus predicted by the alpha fold provided by the embodiment of the present invention;
FIG. 4 is a graph showing a comparison of human adenovirus 41 hexon 6YBA (green) and canine infectious hepatitis virus hexon protein (blue) provided by an embodiment of the present invention;
FIG. 5 is a schematic diagram of different domains of a canine infectious hepatitis virus hexon protein provided by an embodiment of the present invention;
FIG. 6 is a graph showing the results of electrophoresis of CAV I118-481 aa proteins provided in the examples of the present invention.
Description of the embodiments
Other advantages and advantages of the present invention will become apparent to those skilled in the art from the following detailed description, which, by way of illustration, is to be read in connection with certain specific embodiments, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
In the present invention, the capsid of the adenovirus n-icosahedron is composed of 122 capsomers, 110 of which are hexon proteins and 12 of which are penton proteins. The hexon protein is the main epitope of adenovirus, and the conserved region has strong antigenicity and exposition, can induce high-titer anti-adenovirus specific antibody, and can be used for conventional immunological diagnosis of adenovirus with different types and different groups of specific epitopes. Through searching the canine infectious hepatitis virus hexon protein sequence in NCBI of the American biotechnology information center, the 905 amino acid with the final determination of the number ALY 06321 is the canine infectious hepatitis virus hexon protein sequence, and the corresponding nucleotide sequence is the KP840545, and is the common 2718 bp. The amino acid sequence of the canine infectious hepatitis virus hexon protein (SEQ ID No. 1) is:
MATPSMLPQWSYMHIAGQDAAEYLSPALVQFAQATSSYFKLDNKFRNPTVAPTHDVTTERSQRLQLRFVPVMQEDGQYTYKTRFQLAVGDNRVLDMASTYFDIRGTLDRGPSFKPYSGTAYNALAPRAGANNCLFNGSGANINTLAQVPFAGAITVNGQAAVTDNTYQPEPQLGPESWVDGTLADLGDASGRALKASTPRMPCYGSYAPPTNENGGQATGAVERRFYKVTTNNNNEADALLYTEDVNLQTPDTHLVHQVSDDQVTGVQGLGQQAAPNRPNYIGFRDNFIGLMYYNSNGNLGVLAGQSSQLNAVVDLQDRNTELSYQLLLDALTDRSRYFSMWNQAVDSYDQDVRIIDNHGVEDDMPNYCFPLSGMGPLTNMTAMKVNSQNFQTDNTNVGPIQKIGFGNVEAMEINLNANLFKGFLYSNVALYLPDAYKYTPDNIVAPANANTYAYMNVRLPAANLIDTFVNIGARWSPDVMDSVNPFNHHRNAGLRYRSQLLGNGRYCSFHIQVPQKFFAIKNLLLLPGTYTYEWSFRKDVNMILQSSLGNDLRVDGASINIQSINLYASFFPMAHNTASTLEAMLRNDVNDQSFADYLSAANMLYPIPANTTNLPISIPARNWAGFRGWSFTRIKQRETPALGSPYDPYFTYSGSIPYLDSTFYLSHTFRRVSIMFDSSVSWPGNDRLLTPNEFEIKRYVDGEGYNVAQSNMTKDWFLVQMLAHYNIGYQGYHLPESYKDRMYSFLRNFEPMCRQLVDVTNYATYQSVTVGHQHNNSGYASALSTFNPREGHPYPANWPYPLIGVNAVPTVTQKKFLCDRTLWRIPFSSNFMSMGTLTDLGQNLLYSNSAHALDMTFEVDAMNEPTLLYVLFEVFDVARVHQPHRGVIEVVYLRTPFSAGNATT。
the nucleotide sequence (SEQ ID No. 4) encoding the canine infectious hepatitis virus hexon protein is:
atggcaactccgtcgatgctgccacaatggtcttacatgcacattgctggccaggacgccgccgaatacttgtctcccgccctggttcagtttgcccaagcaaccagttcttactttaagttggacaacaagttcagaaaccccactgtggcccccactcacgatgtaaccactgaaaggtctcagcgcttgcagttgcgctttgtgccagttatgcaagaagatggccagtacacttacaaaacccggttccaattggcagtgggagataacagggttctggacatggccagtacctactttgacattaggggcaccctagacagaggcccctccttcaagccctacagtgggacggcttacaatgctctcgctcccagagctggggctaataactgcctatttaatggatcaggtgccaacattaacactttagcccaagtgccatttgcgggcgccattaccgttaatggtcaagccgcagtcacagacaacacctaccagccagagccccagctgggccctgaaagttgggtggatggcaccttggcagacctaggagatgcgtctggccgcgccctgaaagcatcgaccccacgcatgccttgctacggttcttatgctccccccaccaatgaaaacggaggtcaagcaactggggccgtggaacgaagattctataaagtgaccaccaacaataataatgaagctgatgccctactatatacagaagatgtgaacctccaaaccccagacacccacttggtgcatcaggtgtcagacgatcaggttacaggtgtacagggactggggcaacaagctgccccaaacaggccaaattacattggctttagagataactttataggtttaatgtattacaatagtaatggaaacctaggggtgctggcgggtcaatcgtctcaactaaatgccgtggtggacttgcaagacagaaacacagagctttcttatcagctgttgctagatgcccttacagataggtctcgctacttttccatgtggaaccaggcagtagatagctatgaccaggatgtcaggattattgacaatcacggcgtggaagacgacatgccaaactattgcttcccactgagcggcatgggaccattaactaacatgacagctatgaaggtcaatagtcaaaactttcaaacggacaacactaacgtgggtcccattcaaaagattggtttcggaaatgttgaggccatggagataaatctcaatgctaacctctttaaaggttttctctactccaatgtggccctatacctacctgatgcctataaatacacacctgataacattgtagctcctgctaatgcaaatacctatgcttacatgaatgtgagattgcccgctgctaaccttatagacacatttgtaaatattggcgccagatggtcacctgatgtaatggactctgttaatccttttaaccaccacagaaatgcaggactccgctaccgatcacagctgcttggcaatggccgctattgctcgttccatattcaggtccctcaaaaattttttgcaatcaaaaatcttctccttctaccgggtacgtacacgtacgagtggtctttcaggaaggatgtaaacatgatccttcagagcagcttgggcaatgacctccgagtggatggagcctctatcaacattcaaagcatcaacctatatgccagctttttccccatggcacacaacacagcctccactttggaagccatgctgcgcaatgatgtaaatgaccagtcctttgcagactacctgtctgccgccaacatgctttatccgatccctgccaacactacaaacctaccaatctccattcctgccagaaattgggccggattcagagggtggagctttaccagaattaagcagcgggaaactccagccctgggctcaccttacgacccctactttacttactcgggtagcattccctacctggattcaactttctatcttagccacaccttcagaagagtctccatcatgtttgactcttctgtatcttggccgggtaatgacaggctcctcactccaaatgagtttgagattaaaaggtatgtggacggtgaaggctacaacgtggcccagtccaacatgacaaaagattggtttctggttcaaatgctggctcattacaacattggctatcaaggctaccacttgcccgagagctacaaagacagaatgtactcattcctcagaaattttgagcccatgtgcagacaactggtagatgtaactaactatgctacctaccagtcagtcaccgtaggtcaccagcataacaattctggatatgctagcgccctttcaacctttaacccaagggagggtcacccctatccggcaaactggccttatcccctaatcggggtcaatgctgtgcctactgttacccaaaaaaagttcctttgtgacagaaccctatggcgcatccccttctcttccaactttatgtctatgggcaccctcactgaccttggtcaaaacctgctgtactccaactccgctcacgcccttgacatgactttcgaggttgatgccatgaatgagcccactctgttgtacgttttgtttgaagtgttcgacgtggcacgtgttcatcaaccccaccgaggggtgattgaagtagtgtacctcagaactcccttctccgccggcaacgccacgacctaa。
the protein sequence is compared with data in a protein structure database PDB in NCBI Blast function, as shown in figure 1, the three-dimensional structure of the protein of the hexon protein of the canine infectious hepatitis virus is still unresolved, but has higher sequence similarity with the existing structure, and the highest similarity is the structure of the hexon of the human adenovirus 41 (the A chain of PDB number 6 YBA), the sequence homology is 71.26%, and the full length 905 amino acids are covered.
The structure of the A chain in the published human adenovirus 41 hexon 6YBA is shown in FIG. 2, the leftmost alpha helices are N-terminal of the whole protein, the central alpha helix, the beta sheet and the domain with more dense random coil are C-terminal domains, and the rightmost extended two parts with the beta sheet and the random coil mainly belong to the middle part of the full-length sequence. The structure is obtained by directly analyzing the whole structure of virus particles, and the virus particles are obtained by directly culturing eukaryotic cells, so that the cost is relatively high.
The invention utilizes the free structure display software ChimeraX developed by UCSF of san francisco of university of California to provide the alpha fold structure prediction function, inputs 905 amino acid sequences of hexon protein of canine infectious hepatitis virus, uses the alpha fold software to calculate and predict the three-dimensional structure of the protein, the prediction structure is shown in figure 3, the structure is similar to the homologous structure 6YBA in sequence space position, two leftmost alpha helices and random curls are N end of the whole protein, the alpha helices, beta sheets and random curls extending from the rightmost part belong to the middle part of the full-length sequence, and the structural domain with the alpha helices, the long beta sheets and the random curls in the middle part of the structure are C end structural domains. By comparison of specific structures, as shown in fig. 4, the two are very different in terms of details of protein structure, and the root mean square deviation r.m.s.d. of the comparison of the two structures is calculated to be 3.4 a using a Dali server provided by university of helsinki, finland, with a large difference.
The canine infectious hepatitis virus hexon protein structure was divided according to spatial structure, as shown in fig. 5, the N-terminal domain consisting of N-terminal 1-56 aa was shown to be golden yellow, distributed outside the other two larger domains. The middle dark blue domain includes 57-117aa,280-349aa,482-766aa and 810-905aa, which includes the structural body and the C-terminal amino acid. The bluish right domain comprises three parts 118-279aa,350-481aa and 767-809aa, with fewer amino acids relative to the middle domain. Based on this spatial distribution, three truncate fragments 57-255 aa,118-481aa and 482-905aa were predicted to be more stable relative to full length and predicted to have antigenic activity.
According to the result of the structural prediction of the canine infectious hepatitis virus hexon protein, the invention carries out expression purification on the full-length canine infectious hepatitis virus hexon protein CAV I1-905 aa and three truncated fragments CAV I57-905 aa, CAV I118-481 aa and CAV I482-905 aa. The gene sequence of the full-length protein is synthesized in a gene company, and then the PCR amplification is carried out by designing primer pairs for 3 truncated fragments.
Then, the coding full-length canine infectious hepatitis virus hexon protein CAV I1-905 aa, truncated fragment CAV I57-905 aa, truncated fragment CAV I118-481 aa and truncated fragment CAV I482-905 aa are respectively connected into a prokaryotic expression vector pGEX-6p-1 through molecular cloning means, and the prokaryotic protein expression of 4 fragments is carried out in escherichia coli.
The results show that the nucleotide fragments encoding the two longer fragments of CAV I1-905 aa and CAV I57-905 aa do not express the soluble expressed protein, and the target protein is in an inclusion body precipitation state. The nucleotide sequences encoding CAV I118-481 aa and CAV I482-905 aa are expressed and the target protein is obtained. The result of electrophoresis of the CAV I118-481 aa fragment protein is shown in FIG. 6, the target protein is correct in size and high in purity, and meanwhile, the target protein contains part of impurity fragments.
The purified CAV I118-481 aa and CAV I482-905 aa proteins from canine infectious hepatitis virus (CAV I) were used to verify antigen activity by ELISA. The purified CAV I118-481 aa and CAV I482-905 aa protein were coated separately, the protein concentration was 0.1. Mu.g/mL, 100. Mu.L/well, 0.1% gelatin 37℃for 2 h, 250. Mu.L/well of PBST wash (0.1%) 3 wash plate, 100. Mu.L/well of diluted CAV I virus monoclonal antibody, 37℃for 1 h (positive control group was CAV I virus particles, negative control group was PBS buffer, three replicates per group), 250. Mu.L/well of PBST wash (0.1%) 3 wash plate, after drying by beating, 100. Mu.L/well of HRP enzyme-labeled rabbit anti-mouse secondary antibody (diluted with PBS at 1:10000) was added, reacted for 30 min at 37℃again, washed 3 times, after drying by beating, 100. Mu.L/well of TMB color development solution (commercialized), developed at room temperature for 10 min, finally 0.5M sulfuric acid was added, 50. Mu.L/well was stopped, and the reaction was stopped by measuring OD by an enzyme-labeled instrument 450nm Values.
The results of the verification of the antigen activities of the purified and expressed CAV I118-481 aa protein and CAV I482-905 aa protein are shown in Table 1, and the CAV I118-481 aa protein is close to a positive control, has better antigen activity, and the CAV I482-905 aa protein is close to a negative control and has no antigen activity. Thus, ELISA detection antibody kits can be prepared using CAV I118-481 aa according to the above system.
TABLE 1 results of antigen Activity verification
In the present invention, the amino acid sequence of CAV I118-481 aa protein is (SEQ ID NO. 2):
GTAYNALAPRAGANNCLFNGSGANINTLAQVPFAGAITVNGQAAVTDNTYQPEPQLGPESWVDGTLADLGDASGRALKASTPRMPCYGSYAPPTNENGGQATGAVERRFYKVTTNNNNEADALLYTEDVNLQTPDTHLVHQVSDDQVTGVQGLGQQAAPNRPNYIGFRDNFIGLMYYNSNGNLGVLAGQSSQLNAVVDLQDRNTELSYQLLLDALTDRSRYFSMWNQAVDSYDQDVRIIDNHGVEDDMPNYCFPLSGMGPLTNMTAMKVNSQNFQTDNTNVGPIQKIGFGNVEAMEINLNANLFKGFLYSNVALYLPDAYKYTPDNIVAPANANTYAYMNVRLPAANLIDTFVNIGARWSPDVM。
nucleotide molecule 352-1443bp sequence (SEQ ID NO. 3) corresponding to CAV I118-481 aa protein:
gggacggcttacaatgctctcgctcccagagctggggctaataactgcctatttaatggatcaggtgccaacattaacactttagcccaagtgccatttgcgggcgccattaccgttaatggtcaagccgcagtcacagacaacacctaccagccagagccccagctgggccctgaaagttgggtggatggcaccttggcagacctaggagatgcgtctggccgcgccctgaaagcatcgaccccacgcatgccttgctacggttcttatgctccccccaccaatgaaaacggaggtcaagcaactggggccgtggaacgaagattctataaagtgaccaccaacaataataatgaagctgatgccctactatatacagaagatgtgaacctccaaaccccagacacccacttggtgcatcaggtgtcagacgatcaggttacaggtgtacagggactggggcaacaagctgccccaaacaggccaaattacattggctttagagataactttataggtttaatgtattacaatagtaatggaaacctaggggtgctggcgggtcaatcgtctcaactaaatgccgtggtggacttgcaagacagaaacacagagctttcttatcagctgttgctagatgcccttacagataggtctcgctacttttccatgtggaaccaggcagtagatagctatgaccaggatgtcaggattattgacaatcacggcgtggaagacgacatgccaaactattgcttcccactgagcggcatgggaccattaactaacatgacagctatgaaggtcaatagtcaaaactttcaaacggacaacactaacgtgggtcccattcaaaagattggtttcggaaatgttgaggccatggagataaatctcaatgctaacctctttaaaggttttctctactccaatgtggccctatacctacctgatgcctataaatacacacctgataacattgtagctcctgctaatgcaaatacctatgcttacatgaatgtgagattgcccgctgctaaccttatagacacatttgtaaatattggcgccagatggtcacctgatgtaatg。
1. ELISA detection antibody kit detection process
In this example, the CAV I118-481 aa protein prepared in example 2 was used as antigen to prepare ELISA detection antibody kit detection procedures, which include:
step one, taking out the CAV I118-481 aa protein antigen coated plate from the ELISA detection kit, diluting the serum to be detected (60 mu L of sample diluent and 60 mu L of serum to be detected) on a serum dilution plate by 2 times by using the sample diluent, taking 100 mu L of mixed solution, adding the mixed solution into an ELISA plate, and simultaneously adding 2 holes into positive serum and negative serum respectively, wherein each hole is 100 mu L.
And step two, lightly shaking samples in each well, covering a coating plate by using a sealing plate film, and incubating at 37 ℃ for 30 minutes.
And thirdly, discarding the solution in the wells of the coating plate, adding 250 mu L of working washing solution into each well, and repeating for 3 times. After the last washing of the plate, the liquid is thoroughly beaten to dryness.
And step four, adding 100 mu L of enzyme-labeled antibody into each hole, covering the coated plate by using a sealing plate film, and incubating for 30 minutes at 37 ℃.
And fifthly, discarding the solution in the wells of the coating plate, adding 250 mu L of working washing solution into each well, and repeating for 3 times. After the last washing of the plate, the liquid is thoroughly beaten to dryness.
Step six, adding 100 mu L of substrate solution into each hole, covering the coating plate by using a sealing plate film, and incubating for 10 minutes at room temperature.
And step seven, adding 50 mu L of stop solution into each well to stop the reaction. Determination of the sample and absorbance (OD) against 450 nm wavelength 450nm ). Interpretation criteria: S/P= (sample to be tested OD) 450nm Mean-negative control OD 450nm Mean value)/(positive control OD 450nm Mean-negative control OD 450nm Mean value). S/P is more than or equal to 0.3 and positive, and the serum antibody of the sample to be detected reaches the protection level; S/P is less than 0.3, and the serum antibody of the sample to be detected does not reach the protection level.
2. Specificity test of ELISA detection antibody kit
And detecting standard antibody positive serum such as canine parvovirus CPV, canine distemper virus CDV, rabies virus RABV and the like and canine infectious hepatitis virus CAV I antibody positive serum by using a canine infectious hepatitis virus antibody level detection kit.
The detection results are shown in Table 2, and the S/P values of the serum are less than 0.3 except that the S/P value of the CAV I standard antibody positive serum is obviously more than 0.3, so that the detection results meet the judgment standard of negative serum, and the ELISA detection antibody kit prepared in the embodiment 2 of the invention has good specificity.
TABLE 2 specific serum assay results
3. ELISA detection antibody kit sensitivity test
The CAV I standard antibody positive serum was diluted 2, 4, 8, 16, 32, 64-fold, respectively, and the ELISA detection antibody kit prepared in example 2 of the present invention and the outsourced canine infectious hepatitis virus ELISA antibody detection kit were used for simultaneous detection. The detection results are shown in the following table 3, and the ELISA kit can detect the CAV I standard antibody positive serum with 32 times dilution, and the outsourcing kit can detect the CAV I standard antibody positive serum with 16 times dilution, so that the canine infectious hepatitis virus Elisa antibody detection kit has good sensibility.
TABLE 3 sensitivity detection results of ELISA kits of the invention
4. ELISA detection kit coincidence rate comparison
The ELISA kit and the outsourcing canine infectious hepatitis virus Elisa antibody detection kit are used for simultaneously detecting 25 serum samples, the results are compared, the coincidence rate of the detection of the ELISA kit and the whole sample of the outsourcing kit is 96%, the ELISA kit and the outsourcing control kit are proved to have good adaptability, and the specific results are shown in the following table 4.
TABLE 4 comparison of sample coincidence rate of ELISA kits and outsourcing kits of the invention
The CAV I118-481 aa protein antigen prepared by the invention has strong affinity with the antibody, and is used for establishing a high-sensitivity detection diagnosis method. The CAV I118-481 aa protein antigen has better stability, higher expression quantity, lower cost and better specificity and sensitivity of detecting antibody level, and can be used for establishing a more accurate and faster detection kit.
While the invention has been described in detail in the foregoing general description and specific examples, it will be apparent to those skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Claims (7)
1. The protein shown in the following M1):
m1) the 118 th to 481 th amino acid residues of the canine infectious hepatitis virus hexon protein from the N-terminus; the amino acid sequence of the canine infectious hepatitis virus hexon protein is shown as SEQ ID No. 1.
2. A protein truncate, which truncate is as set forth in (1) or (2) below:
(1) The amino acid sequence is a protein shown as SEQ ID No. 2;
(2) A fusion protein obtained by ligating a tag to the N-terminus and/or the C-terminus of the protein shown in SEQ ID No. 2.
3. A gene encoding the protein of claim 1 or the protein truncate of claim 2.
4. The coding gene of claim 3, wherein the gene is,
the coding gene of the protein of M1) or the protein truncated body of claim 2 in claim 1 is as follows 1) or 2):
1) A DNA molecule shown in SEQ ID No. 3;
2) A DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in 1) and which codes for a protein according to M1) of claim 1 or a protein truncate according to claim 2.
5. A biological material of any one of the following (a 1) to (a 4):
(a1) An expression cassette comprising the coding gene of claim 3 or 4;
(a2) A recombinant vector comprising the coding gene of claim 3 or 4;
(a3) A recombinant bacterium comprising the coding gene of claim 3 or 4;
(a4) A transgenic cell line comprising the coding gene of claim 3 or 4.
6. Use of a protein according to claim 1 and/or a protein truncate according to claim 2 and/or a coding gene according to claim 3 or 4 and/or a biomaterial according to claim 5 as an antigen for the preparation of antibodies against canine infectious hepatitis virus.
7. A product comprising as active ingredient the protein of claim 1 or the protein truncate of claim 2;
the function of the product is to detect the reagent of the virus antibody;
the virus is canine infectious hepatitis virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310143209.2A CN115873079B (en) | 2023-02-21 | 2023-02-21 | Canine infectious hepatitis virus hexon protein antigen, truncated body and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310143209.2A CN115873079B (en) | 2023-02-21 | 2023-02-21 | Canine infectious hepatitis virus hexon protein antigen, truncated body and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115873079A CN115873079A (en) | 2023-03-31 |
| CN115873079B true CN115873079B (en) | 2023-07-25 |
Family
ID=85761405
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310143209.2A Active CN115873079B (en) | 2023-02-21 | 2023-02-21 | Canine infectious hepatitis virus hexon protein antigen, truncated body and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115873079B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116462754B (en) * | 2023-06-12 | 2023-09-12 | 北京纳百生物科技有限公司 | Monoclonal antibody for identifying N protein of canine distemper virus, detection reagent and application |
| CN117567634B (en) * | 2024-01-12 | 2024-03-26 | 北京纳百生物科技有限公司 | Application of canine pancreatic lipase monoclonal antibody in detection reagent |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101116750A (en) * | 2007-05-10 | 2008-02-06 | 河北医科大学 | Canine adenovirus DNA vaccines pVAX1-CpG-Loop |
| CN105884889A (en) * | 2016-04-18 | 2016-08-24 | 内蒙古神元生物工程股份有限公司 | Canine distemper/infectious hepatitis/parvovirus triple egg yolk antibody and preparation method thereof |
-
2023
- 2023-02-21 CN CN202310143209.2A patent/CN115873079B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN115873079A (en) | 2023-03-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN115873079B (en) | Canine infectious hepatitis virus hexon protein antigen, truncated body and application thereof | |
| CN105384803B (en) | A kind of Schistosoma japonicum recombinant protein SjSAPLP4 and its encoding gene and application | |
| CN113956362B (en) | Recombinant feline parvovirus VP2 protein antigen and application thereof in antibody diagnosis and vaccine preparation | |
| CN105906714A (en) | Preparation method and application of brucellosis specific fusion protein antigen | |
| BR112016014010B1 (en) | METHOD TO DETECT ANTIBODIES AGAINST CLASSICAL WILD-TYPE SWINE FEVER VIRUS (CSFV) IN A TEST SAMPLE AND DIAGNOSTIC TEST KIT | |
| CN106442981B (en) | A kind of 1 type antibody indirect ELISA diagnostic kit of human bocavirus | |
| WO2012163263A1 (en) | Reagents and methods for prrsv detection | |
| KR101652962B1 (en) | A Kit Using Antibodies for Differentiating Recombinant CSFV Vaccinated Swine and Wild Type CSFV Infected Swine, and Differentiating Method Using Thereof | |
| CN105061602B (en) | For detecting fusion protein, the preparation method and application of anti-pig enterotoxigenic escherichia coil antibody | |
| CN114736290B (en) | Nanometer antibody capable of recognizing porcine pseudorabies virus with high accuracy and sensitivity, preparation method and application | |
| CN109239341B (en) | Indirect ELISA kit for detecting bovine haemolytic mannheimia antibody and application thereof | |
| CN116375889B (en) | Rabies virus glycoprotein antigen, truncated body and application thereof | |
| CN110376388A (en) | A kind of haemophilus parasuis antibody detection method and its kit | |
| CN113045673B (en) | African swine fever virus antibody detection kit based on chimeric P54 epitope and application | |
| CN109824766A (en) | A kind of indirect ELISA testing kit using 4 type antibody of Fiber2 Protein Detection aviadenovirus | |
| Chen et al. | Development and application of a fiber2 protein-based indirect ELISA for detection of duck adenovirus 3 | |
| Li et al. | Development and application of a novel triplex protein microarray method for rapid detection of antibodies against avian influenza virus, Newcastle disease virus, and avian infectious bronchitis virus | |
| McCrae | Nucleic Acid‐Based Analyses of Non‐Group A Rotaviruses | |
| CN113884674A (en) | Mycoplasma bovis colloidal gold immunoassay test strip, preparation method and application thereof | |
| Wang et al. | Identification of an antigenic domain in the N-terminal region of avian hepatitis E virus (HEV) capsid protein that is not common to swine and human HEVs | |
| CN112213493A (en) | Peste des petits ruminants detection kit capable of distinguishing vaccine immunity from natural infection | |
| CN114989306B (en) | Pig pseudorabies virus gE and gI nano antibody, preparation method and application | |
| CN117050196B (en) | Chimeric antigen of porcine reproductive and respiratory syndrome virus and application thereof | |
| JPH11346768A (en) | Protein having antigenicity of canine distemper virus nucleocapsid protein and reagent for assaying anti-canine distemper virus nucleocapsid protein antibody | |
| CN114106158B (en) | Nanometer antibody targeting porcine pseudorabies virus gD protein, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |