CN101116750A - Canine adenovirus DNA vaccines pVAX1-CpG-Loop - Google Patents
Canine adenovirus DNA vaccines pVAX1-CpG-Loop Download PDFInfo
- Publication number
- CN101116750A CN101116750A CN 200710061856 CN200710061856A CN101116750A CN 101116750 A CN101116750 A CN 101116750A CN 200710061856 CN200710061856 CN 200710061856 CN 200710061856 A CN200710061856 A CN 200710061856A CN 101116750 A CN101116750 A CN 101116750A
- Authority
- CN
- China
- Prior art keywords
- loop
- cpg
- pvax1
- minutes
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relating to the medical bioengineering technical filed is a canine adenovirus DNA vaccine pVAX1-CpG-Loop for preventing infectious canine hepatitis. The vaccine is prepared by inserting an encoding gene after modification of canine adenovirus hexon protein into a eukaryotic expression vector. The recombinant plasmid transfers competent Escherichia coli DH5 alpha into engineering bacteria pVAX1-CpG-Loop to prepare the vaccine pVAX1-CpG-Loop. As the antigen gene Loop coding neutralizes antibody determinant gene, the in vivo expression level of the antigen protein is higher and the humoral immunity is enhanced to prevent canine hepatitis infection. The DNA vaccine of the invention has simple preparation process and low cost, and the Loop antigen can be expressed in eukaryotic cells and the lymphocytes can be activated.
Description
Technical field:
The present invention relates to the medical bioengineering technical field, is a kind of dna vaccination pVAX1-CpG-Loop that is used to prevent infectious canine hepatitis
Background technology:
Infectious canine hepatitis is that (prevention is based on inactivated vaccine and attenuation Seedling at present for Canine adenovirus-1, the acute septic disease that CAV-1) causes by hepatitis infectiosa canis virus one type.Dna vaccination is the new generation vaccine that rises in recent years, has antibody titer and holds time long and advantage such as cross protection is effective.Dna vaccination also has following outstanding advantage in addition: (1) can bring out body fluid and the comprehensive immunne response of cell, plays preventive effect; (2) the immunoprotection time is long; (3) simple, with low cost, good stability of production technology and storing are convenient.
Summary of the invention:
The invention provides a kind of dna vaccination pVAX1-CpG-Loop that prevents infectious canine hepatitis, can be used for preventing the infection of infectious canine hepatitis.Its mechanism of action is: hepatitis infectiosa canis virus one type antigen gene Loop is inserted carrier for expression of eukaryon, it is injected in muscular tissue, make it at myocyte's invading the exterior da virus antigen,, can activate intravital immunity system and cell immune system through the angtigen presentation process.Activated immunity system can produce special antibody, eliminates the virus that is free in the blood, the invasion of prevention canine hepatitis virus;
Hepatitis infectiosa canis virus (Canine adenovirus, CAV), belong to Adenoviridae mastadenovirus member, all kinds of adenoviruss have identical structure, profile is nonencapsulated spherical structure, and capsid is the three-dimensional symmetry of icosahedron, is made up of 252 capsomeres, wherein 240 non-vertex capsomers are six adjacent bodies (hexon), are main envelope protein; The capsomere of 12 drift angles is called penton (penton); The fiber that also has trimer protein.Wherein penton substrate one end links to each other with the trimer fiber by non-covalent bond, and the other end is adsorbed onto on the cell membrane.At present, the 26S Proteasome Structure and Function of hexon has been carried out extensive studies.Each six adjacent body is homotrimers of hexon, is the complicated albumen greater than 900 residues.Trimerical six adjacent body molecules have a pentahedral substrate and leg-of-mutton pinnacle of a pagoda, and substrate comprises two regional P1, P2 district, and it is Loop1, Loop2, Loop3, Loop4 that the tower district is made of 4 rings.Loop1 is long, the most complicated ring, and self folds manyfold, interacts with surrounding.The hexon that detects veriform purification by one group of monoclonal antibody shows many antigenic determinants are arranged on these several rings in six adjacent surfaces.Sequence to the hexon of 15 veriform adenoviruss studies show that basal area P1, P2 guard, and variation zone mainly concentrates on Loop1, the Loop2.Loop1, Loop2 have 7 uniquenesses hypervariable region (Hypervariable Region, HVR), in these 7 HVRs, HVR1-HVR6 appears among the Loop1, HVR7 appears at the pinnacle of a pagoda of Loop2.In wherein all containing among HVR1, HVR2, HVR4, HVR5, the HVR7 and antigenic determinant, and antigenic determinant comprises two or more HVRs at least.Confirm that at present hexon can cause extremely strong neutralization reaction, in and antigenic determinant mainly exist on the six adjacent bodies, and the major antigen determinant concentrates on Loop1 district and Loop2 district in the six adjacent bodies.The present invention is according to the hexon gene order and the aminoacid sequence of hepatitis infectiosa canis virus I type among the GeneBank and adenovirus hominis 2 types, Loop1 and Loop2 gene have been designed and synthesized, connecting two unnamed genes is Loop, Loop is cloned into plasmid vector pVAX1-CpG, makes up vaccines pVAX 1-CpG-Loop;
Synthetic Loop pyrenoids nucleotide sequence is:
Loop1
AACTGCCTATTTAATGGATCAGGTGCCAACATTAACACTTTAGCCCAAGTGCCATTTGCGGGCGCCATT
ACCGTTAATGGTCAAGCCGCAGTCACAGACAACACCTACCAGCCAGAGCCCCAGCTGGGCCCTGAAAGT
TGGGTGGATGGCACCTTGGCAGACCTAGGAGATGCGTCTGGCCGCGCCCTGAAAGCATCGACCCCACGC
ATGCCTTGCTACGGTTCTTATGCTCCCCCCACCAATGAAAACGGAGGTCAAGCAACTGGGGCCGTGGAA
CGAAGATTCTATAAAGTGACCACCAACAATAATAATGAAGCTGATGCCCTACTATATACAGAAGATGTG
AACCTCCAAACCCCAGACACCCACTTGGTGCATCAGGTGTCAGACGATCAGGTTACAGGTGTACAGGGA
CTGGGGCAACAA
Loop2
AACTATTGCTTCCCACTGAGCGGCATGGGACCATTAACTAACATGACAGCTATGAAGGTCAATAATCAA
AACTTTCAAACGGACAACACTAACGTGGGTCCCATTCAAAAGATTGGTTTCGGAAATGTTGAGGCCATG
GAGATAAATCTCAATGCTAACCTCTTTAAAGGTTTTCTCTACTCCAATGTGGCCCTATACCTACCTGAT
GCCTATAAATACACACCTGATAACATTGTAGCTCCTGCTAATGCAAATACCTATGCTTACATGAATGTG
AGATTGCCCGCTGCTAACCTTATAGACACATTTGTAAATATTGGCGCCAGATGGTCACCTGATGTAATG
GACTCTGTTAATCCTTTTAACCACCACAGAAATGCAGGACTCCGCTACCGATCACAGCTGCTTGGCAAT
GGCCGC
The preparation method of canine hepatitis virus dna vaccination pVAX1-CpG-Loop of the present invention is as follows:
1. synthetic canine hepatitis virus Loop (Loop1+Loop2) protein coding gene:
Length: 860bp
Type: nucleic acid
Chain number: two strands
Geometry: linearity
B) molecule type: DNA
C) source: synthetic
D) sequence description: Loop protein coding gene:
5’-CGGGATCCATGAACTGCCTATTTAATGGATCAGGTGCCAACATTAACACTTTAGCCCAAGTGCCAT
TTGCGGGCGCCATTACCGTTAATGGTCAAGCCGCAGTCACAGACAACACCTACCAGCCAGAGCCCCAGC
TGGGCCCTGAAAGTTGGGTGGATGGCACCTTGGCAGACCTAGGAGATGCGTCTGGCCGCGCCCTGAAAG
CATCGACCCCACGCATGCCTTGCTACGGTTCTTATGCTCCCCCCACCAATGAAAACGGAGGTCAAGCAA
CTGGGGCCGTGGAACGAAGATTCTATAAAGTGACCACCAACAATAATAATGAAGCTGATGCCCTACTAT
ATACAGAAGATGTGAACCTCCAAACCCCAGACACCCACTTGGTGCATCAGGTGTCAGACGATCAGGTTA
CAGGTGTACAGGGACTGGGGCAACAACCCGGGTCCCCCGGGAACTATTGCTTCCCACTGAGCGGCATGG
GACCATTAACTAACATGACAGCTATGAAGGTCAATAATCAAAACTTTCAAACGGACAACACTAACGTGG
GTCCCATTCAAAAGATTGGTTTCGGAAATGTTGAGGCCATGGAGATAAATCTCAATGCTAACCTCTTTA
AAGGTTTTCTCTACTCCAATGTGGCCCTATACCTACCTGATGCCTATAAATACACACCTGATAACATTG
TAGCTCCTGCTAATGCAAATACCTATGCTTACATGAATGTGAGATTGCCCGCTGCTAACCTTATAGACA
CATTTGTAAATATTGGCGCCAGATGGTCACCTGATGTAATGGACTCTGTTAATCCTTTTAACCACCACA
GAAATGCAGGACTCCGCTACCGATCACAGCTGCTTGGCAATGGCCGCCTCGAG-3’
Wherein, 5 ' terminal GGATCC is a BamH I restriction enzyme site; CCCGGG is a Sma I restriction enzyme site; 3 ' terminal CTCGAG is an Xho I restriction enzyme site;
2. prepare dna vaccination pVAX1-CpG-Loop:
Use restricted enzyme BamH I and Sma I respectively, earlier synthetic Loop1 of Sma I and Xho I and Loop2 fragment, reuse BamH I is connected the synthetic Loop protein coding gene of Loop1 and Loop2 with Xho I.(pVAX1 is available from Invitrogen company for Loop protein coding gene and carrier for expression of eukaryon pVAX1-CpG, sequence and physical map are seen the catalogue of the said firm, adding the CpG motif modifies) carry out double digestion, endonuclease bamhi reclaims through the agarose gel electrophoresis purification respectively.Then above-mentioned pVAX1-CpG carrier endonuclease bamhi is mixed by a certain percentage with Loop gene endonuclease bamhi, connect by ligase.Then with CaCl
2Method is converted in the competence bacillus coli DH 5 alpha (available from GIBLCO company), obtains transformant on the kanamycin flat board, screens.The positive transformant that screens is the engineering bacteria of reorganization pVAX1-CpG-Loop, and this project bacterium can be used for preparing dna vaccination pVAX1-CpG-Loop;
Dna vaccination of the present invention is the recombiant plasmid of carrier for expression of eukaryon pVAX1-CpG and Loop protein coding gene.This recombiant plasmid contains cytomegalovirus promoter PCMV, the hepatitis infectiosa canis virus Loop gene of pUC ori plasmid replication initiation site, kalamycin resistance gene Kanamycin, a complete eukaryotic transcription translation unit.Dna vaccination preparation technology of the present invention is simple, with low cost, but it can express Loop antigen and activated lymphocyte in eukaryotic cell;
Description of drawings
Fig. 1: be the structural representation of canine adenovirus DNA vaccines pVAX 1-CpG-Loop of the present invention
Fig. 2: be the structure flow chart of canine adenovirus DNA vaccines pVAX 1-CpG-Loop of the present invention
The specific embodiment:, preparation method of the present invention is described in detail below in conjunction with embodiment.
Embodiment 1: the preparation of canine adenovirus DNA vaccines pVAX 1-CpG-Loop
Dna vaccination pVAX1-CpG-Loop structure is seen Fig. 1, makes up flow process and sees Fig. 2
1. synthetic Loop gene DNA (structure is as previously mentioned), 5 ' terminal GGATCC is a BamH I restriction enzyme site; 3 ' terminal CTCGAG is an Xho I restriction enzyme site;
3. make up the recombiant plasmid of pVAX1-CpG-Loop:
With restricted enzyme BamH I and Xho I the Loop gene DNA is carried out double digestion.Reaction system is: the Loop gene DNA 5 μ l of 200ng/ μ l; 10 * M Buffer is by pH7.5 100mM-150mMTris-HCl; 100mM MgCl
2The 1mM-10mM dithiothreitol, DTT; 100mM NaCl forms; BamH I enzyme (10U/ μ l) 1 μ l; Xho I enzyme (12U/ μ l) 1 μ l; Mend H
2O is to cumulative volume 20 μ l.37 ℃ of temperature are bathed digestion 2 hours.Afterwards sample digestion is carried out 1-2% LMP agarose gel electrophoresis, cut glue and reclaim the Loop endonuclease bamhi.Simultaneously, with BamH I and Xho I double digestion pVAX1-CpG carrier.Reaction system is: pVAX1-CpG carrier 2 μ l (200ng/ μ l); 10 * M Buffer, 2 μ l; BamH I enzyme (10U/ μ l) 1 μ l; XhoI enzyme (12U/ μ l) 1 μ l; Mend H
20 to cumulative volume 20 μ l.37 ℃ of incubations digested 2 hours.Afterwards sample digestion is carried out 1% low melting-point agarose gel electrophoresis, cut glue and reclaim the pVAX1-CpG endonuclease bamhi;
Above-mentioned pVAX1-CpG endonuclease bamhi is mixed with the Loop endonuclease bamhi, connect with ligase.The coupled reaction system is: the pVAX1-CpG endonuclease bamhi 0.5 μ l of 200ng/ μ l; The Loop endonuclease bamhi 1 μ l of 50ng/ μ l; By 600mM-660mM Tris-HCl pH7.6; 60mM-66mM MgCl
2The 100mM dithiothreitol, DTT; The connection Buffe 1 μ l that 1mM ATP forms; Mend H
2O is to cumulative volume 10 μ l.The condition of coupled reaction be decided to be 12 ℃ 10 hours;
4. make up the pVAX1-CpG-Loop engineering bacteria:
With above-mentioned coupled reaction product with CaCl
2Method is converted in the competence bacillus coli DH 5 alpha and (purchases the precious biotech firm in Dalian): connect product 10 μ l and DH5 α (1～2 * 10
9The competent cell 200 μ l of antibacterial/ml) mix, and ice bath was placed 30 minutes, 42 ℃ 2 minutes, ice bath 10 minutes, adding 0.6ml 2YT fluid medium is by 18g peptone/L; 10g yeast extract/L; 5g NaCl/L forms, and cultivates after 45 minutes for 37 ℃ and is laid on the agar plate that contains kanamycin.Cultivate after 12 hours for 37 ℃ and transformant on agar plate, occurs.Select transformant and be seeded in 37 ℃ of overnight incubation in the 3ml 2YT culture medium that contains 100 μ g/ml kanamycin, 6,000rpm/ minute centrifugal collection thalline extracts plasmid DNA with plasmid a small amount of extraction agent box (Qiagen).Identify with Hind III and Xho I double digestion then.Reaction system is: the recombiant plasmid 1 μ l of 200ng/ μ l; 10 * M Buffer, 2 μ l; 10U/ μ l Hind III enzyme 1 μ l; 12U/ μ l Xho I enzyme 1 μ l; Mend H
2O is to cumulative volume 20 μ l.37 ℃ of incubations digested 2 hours.Afterwards sample digestion is carried out 1% agarose gel electrophoresis, the Loop fragment of the visible 860bp of result and the pVAX1-CpG carrier segments of 2.99kb.Illustrate that this positive transformant that screens is the engineering bacteria of reorganization pVAX1-CpG-Loop;
5. the preparation of canine adenovirus DNA vaccines pVAX 1-CpG-Loop
Dna vaccination of the present invention prepares with above-mentioned recombinant strain.Training method is a liquid culture.Adopt antibacterial culturing.Select for use 2 * YT culture medium to contain 1.6-2% tryptone, 1% yeast extract and 0.5-1% sodium chloride, pH7.0.Cultivation temperature is 37 ℃, and incubation time is 24 hours;
Separation and purification plasmid DNA from the engineering bacteria after the amplification adopts conventional method (molecular cloning experiment guide, the third edition, Science Press, 2002).Concrete steps are as follows:
Add the 800mL solution I in the wet bacterium of 100g and contain the 50-60mM glucose, 25-30mM Tris-ClpH8.0, the 10mM EDTA mixing that vibrates strongly.Add freshly prepared 1L solution II and contain 0.2N NaOH, 1%SDS) vertical soft mixing, room temperature 5 minutes.The 0.75L solution III that adds the ice pre-cooling again contains the 1M potassium acetate, the vertical soft mixing of 7M ammonium acetate pH4.8, ice bath 5 minutes.12000 rev/mins of 4 ℃ of centrifuging and taking supernatants of Continuous Flow.In supernatant, added 1.53L isopropyl alcohol room temperature 10 minutes, the centrifugal precipitation of staying of 12000 rev/mins of room temperatures of Continuous Flow.Adding 70%7 pure 450ml rinsings spends the night.10000 rev/mins 4 ℃ were stayed precipitation in centrifugal 10 minutes.Add the PBS dissolving of 1L pH7.4, add 65 ℃ of digestion of final concentration 0.1%RNaseA (magnificent biological engineering company limited is produced) 30 minutes.Add isopyknic PEG solution again and contain PEG8000 13%, sodium chloride 1.6M, precipitation; 12000 rev/mins 4 ℃ centrifugal 10 minutes, stay precipitation.200ml PBS dissolution precipitation adds 1% volume TritonX X114 mixing, ice bath 5-10 minute, 37 ℃ 30 minutes, 37 ℃ 12000 rev/mins centrifugal 10 minutes, get the upper strata water.Use the double-deck filter membrane pressure filtration of 0.45 μ m and 0.22 μ m at last, be diluted to 1mg/ml with the PBS buffer, promptly canine adenovirus DNA vaccines pVAX 1-CpG-Loop is used for intramuscular injection.
Claims (3)
1. canine adenovirus DNA vaccines pVAX 1-CpG-Loop, it is characterized in that by in the hepatitis infectiosa canis virus hexon and the improved encoding gene of antigenic determinant and carrier for expression of eukaryon constitute, the nucleotide sequence of improved Loop protein coding gene is as follows:
CGGGATCCATGAACTGCCTATTTAATGGATCAGGTGCCAACATTAACACTTTAGCCCAAGTGCCATTTGC
GGGCGCCATTACCGTTAATGGTCAAGCCGCAGTCACAGACAACACCTACCAGCCAGAGCCCCAGCTGGGC
CCTGAAAGTTGGGTGGATGGCACCTTGGCAGACCTAGGAGATGCGTCTGGCCGCGCCCTGAAAGCATCGA
CCCCACGCATGCCTTGCTACGGTTCTTATGCTCCCCCCACCAATGAAAACGGAGGTCAAGCAACTGGGGC
CGTGGAACGAAGATTCTATAAAGTGACCACCAACAATAATAATGAAGCTGATGCCCTACTATATACAGAA
GATGTGAACCTCCAAACCCCAGACACCCACTTGGTGCATCAGGTGTCAGACGATCAGGTTACAGGTGTAC
AGGGACTGGGGCAACAACCCGGGTCCCCCGGGAACTATTGCTTCCCACTGAGCGGCATGGGACCATTAAC
TAACATGACAGCTATGAAGGTCAATAATCAAAACTTTCAAACGGACAACACTAACGTGGGTCCCATTCAA
AAGATTGGTTTCGGAAATGTTGAGGCCATGGAGATAAATCTCAATGCTAACCTCTTTAAAGGTTTTCTCT
ACTCCAATGTGGCCCTATACCTACCTGATGCCTATAAATACACACCTGATAACATTGTAGCTCCTGCTAA
TGCAAATACCTATGCTTACATGAATGTGAGATTGCCCGCTGCTAACCTTATAGACACATTTGTAAATATT
GGCGCCAGATGGTCACCTGATGTAATGGACTCTGTTAATCCTTTTAACCACCACAGAAATGCAGGACTCC
GCTACCGATCACAGCTGCTTGGCAATGGCCGCCTCGAG。
2. by the described canine adenovirus DNA vaccines pVAX 1-CpG-Loop of claim 1, it is characterized in that said carrier for expression of eukaryon is pVAX1-CpG.
3. by the described canine adenovirus DNA vaccines pVAX 1-CpG-Loop of claim 1, it is characterized in that said vaccine production method
1. make up the pVAX1-CpG-Loop recombiant plasmid:
With restricted enzyme BamHI and Xho I the Loop gene DNA is carried out double digestion.Reaction system is: Loop gene DNA 5 μ l (200ng/ μ l); 10 * M Buffer is by pH7.5 100mM-150mM Tris-HCl; 100mM MgCl
2The 1mM-10mM dithiothreitol, DTT; 100mM NaCl forms; BamHI enzyme (10U/ μ l) 1 μ l; Xho I enzyme (12U/ μ l) 1 μ l; Mend H
2O is to cumulative volume 20 μ l.37 ℃ of temperature are bathed digestion 2 hours.Afterwards sample digestion is carried out 1-2% LMP agarose gel electrophoresis, cut glue and reclaim the Loop endonuclease bamhi.Simultaneously, with BamHI and Xho I double digestion pVAX1-CpG carrier.Reaction system is: pVAX1-CpG carrier 2 μ l (200ng/ μ l); 10 * M Buffer, 2 μ l; The BamH I enzyme 1 μ l of 10U/ μ l; The Xho I enzyme 1 μ l of 12U/ μ l; Mend H
2O is to cumulative volume 20 μ l.37 ℃ of incubations digested 2 hours.Afterwards sample digestion is carried out 1% low melting-point agarose gel electrophoresis, cut glue and reclaim the pVAX1-CpG endonuclease bamhi;
Above-mentioned pVAX1-CpG endonuclease bamhi is mixed with the Loop endonuclease bamhi, connect with ligase.The coupled reaction system is: pVAX1-CpG endonuclease bamhi 0.5 μ l (200ng/ μ l); Loop endonuclease bamhi 1 μ l (50ng/ μ l); By 600mM-660mM Tris-HCl pH7.6; 60mM-66mM MgCl
2The 100mM dithiothreitol, DTT; The connection Buffe 1 μ l that 1mM ATP forms; Mend H
2O is to cumulative volume 10 μ l.The condition of coupled reaction be decided to be 12 ℃ 10 hours; Coupled reaction obtains connecting product;
2. make up the pVAX1-CpG-Loop engineering bacteria:
With above-mentioned connection product with CaCl
2Method is converted in the competence bacillus coli DH 5 alpha, operates as follows: connect product 10 μ l and 1～2 * 10
9The DH5 α of antibacterial/ml and competent cell 200 μ l mix, and ice bath was placed 30 minutes, 42 ℃ 2 minutes, ice bath 10 minutes adds 0.6ml by 18g peptone/L; 10g yeast extract/L; The 2YT fluid medium that 5g NaCl/L forms is cultivated after 45 minutes for 37 ℃ and is laid on the agar plate that contains kanamycin.Cultivate after 12 hours for 37 ℃ and transformant on agar plate, occurs.Select transformant and be seeded in 37 ℃ of overnight incubation in the 3ml 2YT culture medium that contains 100 μ g/ml kanamycin, 6,000rpm/ minute centrifugal collection thalline extracts recombinant plasmid dna with plasmid a small amount of extraction agent box (Qiagen).Identify with HindIII and Xho I double digestion then.Reaction system is: recombiant plasmid 1 μ l (200ng/ μ l); 10 * M Buffer, 2 μ l; HindIII enzyme (10U/ μ l) 1 μ l; XhoI enzyme (12U/ μ l) 1 μ l; Mend H
2O is to cumulative volume 20 μ l.37 ℃ of incubations digested 2 hours.Afterwards sample digestion is carried out 1% agarose gel electrophoresis, the Loop fragment of the visible 860bp of result and the pVAX1-CpG carrier segments of 2.99kb.Illustrate that this positive transformant that screens is the engineering bacteria of reorganization pVAX1-CpG-Loop;
3. the preparation of canine adenovirus DNA vaccines pVAX 1-CpG-Loop
Dna vaccination of the present invention prepares with above-mentioned recombinant strain.Training method is a liquid culture.Adopt antibacterial culturing.Select for use 2 * YT culture medium to contain 1.6-2% tryptone, 1% yeast extract and 0.5-1% sodium chloride, pH7.0.Cultivation temperature is 37 ℃, and incubation time is 24 hours;
Separation and purification plasmid DNA from the engineering bacteria after the amplification, adopt the conventional method concrete steps as follows:
Add the 800mL solution I in the wet bacterium of 100g and contain the 50-60mM glucose, 25-30mM Tris-Cl pH8.0, the 10mM EDTA mixing that vibrates strongly.Add freshly prepared 1L solution II and contain 0.2N NaOH, the vertical soft mixing of 1%SDS, room temperature 5 minutes.The 0.75L solution III that adds the ice pre-cooling again contains the 1M potassium acetate, the vertical soft mixing of 7M ammonium acetate pH4.8, ice bath 5 minutes.12000 rev/mins of 4 ℃ of centrifuging and taking supernatants of Continuous Flow.In supernatant, added 1.53L isopropyl alcohol room temperature 10 minutes, the centrifugal precipitation of staying of 12000 rev/mins of room temperatures of Continuous Flow.Adding 70% ethanol 450ml rinsing spends the night.10000 rev/mins 4 ℃ were stayed precipitation in centrifugal 10 minutes.Add the PBS dissolving of 1LpH7.4, add 65 ℃ of digestion of final concentration 0.1%RnaseA 30 minutes.Add isopyknic PEG solution again: contain PEG8000 13%, sodium chloride 1.6M, precipitation; 12 000 rev/mins 4 ℃ centrifugal 10 minutes, stay precipitation.200ml PBS dissolution precipitation adds 1% volume TritonX X114 mixing, ice bath 5-10 minute, 37 ℃ 30 minutes, 37 ℃ 12 000 rev/mins centrifugal 10 minutes, get the upper strata water.Use the double-deck filter membrane pressure filtration of 0.45 μ m and 0.22 μ m at last, be diluted to 1mg/ml, promptly get canine adenovirus DNA vaccines pVAX 1-CpG-Loop with the PBS buffer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710061856 CN101116750A (en) | 2007-05-10 | 2007-05-10 | Canine adenovirus DNA vaccines pVAX1-CpG-Loop |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710061856 CN101116750A (en) | 2007-05-10 | 2007-05-10 | Canine adenovirus DNA vaccines pVAX1-CpG-Loop |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101116750A true CN101116750A (en) | 2008-02-06 |
Family
ID=39053101
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200710061856 Pending CN101116750A (en) | 2007-05-10 | 2007-05-10 | Canine adenovirus DNA vaccines pVAX1-CpG-Loop |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101116750A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914502A (en) * | 2010-07-30 | 2010-12-15 | 中国农业科学院哈尔滨兽医研究所 | I-type canine adenovirus attenuated vaccine strain and application thereof |
| CN111499698A (en) * | 2020-03-19 | 2020-08-07 | 中国农业科学院特产研究所 | Canine type I adenovirus subunit vaccine and preparation method thereof |
| CN112592410A (en) * | 2021-03-04 | 2021-04-02 | 苏州世诺生物技术有限公司 | Canine adenovirus gene engineering subunit vaccine, preparation method and application thereof |
| CN115873079A (en) * | 2023-02-21 | 2023-03-31 | 北京纳百生物科技有限公司 | Canine infectious hepatitis virus hexon protein antigen, truncation and application thereof |
-
2007
- 2007-05-10 CN CN 200710061856 patent/CN101116750A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914502A (en) * | 2010-07-30 | 2010-12-15 | 中国农业科学院哈尔滨兽医研究所 | I-type canine adenovirus attenuated vaccine strain and application thereof |
| CN111499698A (en) * | 2020-03-19 | 2020-08-07 | 中国农业科学院特产研究所 | Canine type I adenovirus subunit vaccine and preparation method thereof |
| CN111499698B (en) * | 2020-03-19 | 2023-05-16 | 中国农业科学院特产研究所 | Canine I type adenovirus subunit vaccine and preparation method thereof |
| CN112592410A (en) * | 2021-03-04 | 2021-04-02 | 苏州世诺生物技术有限公司 | Canine adenovirus gene engineering subunit vaccine, preparation method and application thereof |
| CN112592410B (en) * | 2021-03-04 | 2021-05-11 | 苏州世诺生物技术有限公司 | Canine adenovirus gene engineering subunit vaccine, preparation method and application thereof |
| CN115873079A (en) * | 2023-02-21 | 2023-03-31 | 北京纳百生物科技有限公司 | Canine infectious hepatitis virus hexon protein antigen, truncation and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101820903A (en) | Prophylactic and therapeutic influenza vaccines, antigens, compositions, and methods | |
| CN104404074A (en) | Foot-and-mouth disease virus capsid protein tandem coexpressions and virus-like particle preparation method | |
| KR102640722B1 (en) | Methods and compositions for inducing an immune response against Clostridium difficile | |
| CN103194472A (en) | Porcine epizootic diarrhea virus S1 protein fusion gene and recombinant bacillus megaterium, and their use | |
| US20230190923A1 (en) | Compositions comprising ltb and pathogenic antigens, and use thereof | |
| CA2527346A1 (en) | Cell surface expression vector of sars virus antigen and microorganisms transformed thereby | |
| KR101919002B1 (en) | Soluble Multi-Epitope Antigen of Foot-and-Mouth Disease Virus and Uses Thereof | |
| CN100579578C (en) | Pyloric spiral bacillus antigen recombinant vaccine | |
| CN101116750A (en) | Canine adenovirus DNA vaccines pVAX1-CpG-Loop | |
| CN102816246A (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| US11136354B2 (en) | Protective anti-ZIKV vaccine without inducing cross-reactions with dengue | |
| CN117431200A (en) | Recombinant bacillus subtilis for displaying Newcastle disease virus HN protein on spore surface, construction method and application | |
| CN106554965A (en) | For preparing the nucleic acid construct and method of EV71 virus-like particles | |
| CN110257428B (en) | Recombinant adenovirus expressing porcine circovirus type 3 ORF2 gene and preparation method and application thereof | |
| CN107446872A (en) | A kind of recombinant lactic acid bacteria vaccine strain of constitutive expression rabbit hemorrhagic disease virus VP60 albumen and its production and use | |
| CN103194471B (en) | Transmissible gastroenteritis of swine S/N protein fusion gene and Recombinant Lactococcus lactis and application | |
| CN1864746B (en) | Gene engineered poly-valence subunit vaccine of pylorus Hp AhpC-NapA and preparation method thereof | |
| CN113336858B (en) | Rabbit hemorrhagic disease virus VP60 recombinant antigen with single site chimeric Pasteurella PlpE epitope, preparation and application thereof | |
| CN103421731B (en) | A kind of haemophilus parasuis attenuation salmonella seedling | |
| CN103421733B (en) | A kind of haemophilus parasuis-Salmonella choleraesuls bigeminy gene engineering vaccine | |
| CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine | |
| TWI776048B (en) | Recombinant protein for preventing swine fever virus infection and composition and cell comprising the same. | |
| CN114891121B (en) | Bivalent virus-like particle vaccine for resisting PEDV and PRV and preparation method thereof | |
| CN1185011C (en) | DNA vaccine pVPS for SARS virus | |
| CN1449831A (en) | DNA vaccine pVPS2 for SARS virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |