CN103194472A - Porcine epizootic diarrhea virus S1 protein fusion gene and recombinant bacillus megaterium, and their use - Google Patents
Porcine epizootic diarrhea virus S1 protein fusion gene and recombinant bacillus megaterium, and their use Download PDFInfo
- Publication number
- CN103194472A CN103194472A CN2012105236524A CN201210523652A CN103194472A CN 103194472 A CN103194472 A CN 103194472A CN 2012105236524 A CN2012105236524 A CN 2012105236524A CN 201210523652 A CN201210523652 A CN 201210523652A CN 103194472 A CN103194472 A CN 103194472A
- Authority
- CN
- China
- Prior art keywords
- ala
- leu
- gly
- bacillus megaterium
- thr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a porcine epizootic diarrhea virus S1 protein fusion gene and recombinant bacillus megaterium, and their use. An S1 antigen site of an S glycoprotein of the porcine epizootic diarrhea virus is connected to an anchor sequence of a cell wall so that the porcine epizootic diarrhea virus S1 protein fusion gene shown in the formula of SEQ ID No.1 is obtained. The invention further discloses a secrete expression vector containing the porcine epizootic diarrhea virus S1 protein fusion gene. The secrete expression vector containing the porcine epizootic diarrhea virus S1 protein fusion gene is transferred into the bacillus megaterium and a recombinant protein is expressed on the cell wall or the surface of the bacillus megaterium. A result of a western blot experiment shows that the expressed recombinant protein can react with PEDV immune serum so that it is proved that the expressed recombinant protein has the antigenicity the same as antigenicity of the PEDV natural antigen. A post-inducible expression living bacterium immuno-fluorescence test proves that the expressed recombinant protein is positioned on the surface of the recombinant bacillus megaterium. An experiment result shows that the recombinant protein provided by the invention can be prepared into a safe and effective mucosal immune live bacterium vaccine for preventing and treating porcine epizootic diarrhea.
Description
Technical field
The recombinant bacterial strain that the present invention relates to antigen fusion gene and contain this antigen fusion gene relates in particular to porcine epizootic diarrhea S
1Protein fusion gene and the expression vector that contains this fusion gene, the invention further relates to the reorganization bacillus megaterium bacterial strain and their application in preparation control porcine epizootic diarrhea vaccine that contain this expression vector, belong to the prevention and control field of porcine epizootic diarrhea.
Background technology
Porcine epizootic diarrhea (PEDV) is a kind of acute height contagious disease that is caused pig by coronavirus, is feature with watery diarrhea, vomiting and dehydration, and this disease worldwide extensively distributes, and harm is serious, brings heavy economic losses to pig industry.Virus is main to have the characteristics of tangible intestinal tissue preferendum by the intestinal tract infections pig, and except humoral immunization and cellular immunization, local intestinal mucosa immunity system is being brought into play irreplaceable effect in anti-PEDV infection immunity process.
PEDV has typical coronavirus structure; formed by 4 kinds of primary structure albumen; nucleocapsid protein (N), membranin (M), glycosylated spike protein (S) and the little envelope protein (E) that is respectively phosphorylation wherein S glycoprotein carries main bone-marrow-derived lymphocyte antigenic determinant and can induce the important structure albumen that produces neutralizing antibody and immanoprotection action is provided; therefore, S albumen to virus infection, bring into play that it is pathogenic and determine host cell parent preferendum aspect to play a crucial role.PEDV infects to have and significantly has a liking for intestines, and secretory IgA antibody is the key factor that protection pig body is not subjected to PEDV to infect and avoid falling ill, and behind the oral immunity, all can detect sIgA antibody in intestinal juice and serum, but not the oral route inoculation then detects less than sIgA.Piglet can obtain source of parents sIgA by colostrum, produces the passive immunization protection of popularity diarrhoea.
Conventional inactivated vaccine and attenuated vaccine have played active effect in these two kinds of diseases of control, obtain good effect, but still have some problems, and be poor as the inactivated vaccine immunogenicity, can not effectively induce slgA, and opposing is infected; The postvaccinal animal body of attenuated vaccine row loose virus, virus virulence may return strong etc., in addition must be by the injecting pathway immunity.At the characteristics of porcine epizootic diarrhea, adopting oral immunity is comparatively desirable prevention approach, but how to avoid gi tract that the destruction of antigen and effective induce immune response are become key.
Summary of the invention
One of purpose of the present invention provides a kind of porcine epizootic diarrhea S
1Proteantigen fusion gene and encoded protein thereof;
Two of purpose of the present invention provides and contains above-mentioned porcine epizootic diarrhea S
1The expression vector of proteantigen fusion gene;
Three of purpose of the present invention provides the recombinant host that contains above-mentioned expression vector bacterial strain.
To achieve these goals, one aspect of the present invention provides a kind of S by PEDV glycoprotein S
1Antigen site and streptococcus pyogenes cell walls anchor series (CWA
M6) connecting the fusion gene that obtains, its polynucleotide sequence is shown in the SEQID No.1.
The present invention finds out the 22-505aa section sequence of coding S glycoprotein, by the Linker ((GGGGS) of flexibility according to the PEDV complete genome sequence AF353511 of Genbank login
3) with the S of PEDV
1Antigen site gene and cell walls anchor series (CWA
M6) couple together, with this sequence called after MLS
1(SEQ ID No.1).That considers the bacillus megaterium codon has a liking for situation partially, the present invention is in order to improve the expression of heterologous gene in the host bacterium, and guarantee under the constant situation of amino acid after the translation rare codon Threonine (ACG), Histidine (CAC), arginine (CGG, CGA), L-Ala (GCG) and leucine (CTC, CTG) etc. to be changed.In addition, at MLS
1Upstream and downstream introduce Bgl II restriction enzyme site and SphI restriction enzyme site respectively.
Another aspect of the present invention provides by fusion gene encoded protein shown in the SEQ ID No.1, and its aminoacid sequence is shown in the SEQ ID No.2.。
Another aspect of the present invention provides and contains described porcine epizootic diarrhea S
1The expression vector of protein fusion gene; For example, the antigen fusion gene shown in the SEQ ID No.1 of the present invention is carried out being connected of operability with expression vector pHIS1525, obtaining can be at the outside surface of bacillus megaterium or the secretion expression carrier of its cell walls expression fusion gene.
Infect and sIgA has the characteristics of vital role in resist the disease at the PEDV per mucous membrane, the present invention has made up expression PEDV S
1The reorganization bacillus megaterium expression system of albumen as a kind of oral vaccine, by the specificity sIgA that stimulates the Intestinal Mucosal Immunity system to produce, reaches the purpose that stops pathogen infection.
Thus, the reorganization bacillus megaterium bacterial strain that provides strain expression porcine epizootic diarrhea S1 protein fusion gene more on the one hand of the present invention can be prepared into the safe and effective mucosal immunity live bacterial vaccines of control porcine epizootic diarrhea by enough its.
The present invention carries out the fusion gene shown in the SEQ ID No.1 double digestion with secretion expression carrier pHIS1525, is connected and changes host bacterium bacillus megaterium WH320 cell over to through protoplast transformation, obtains to contain reorganization bacillus megaterium (Bacillus megaterium) bacterial strain (WH320-pHIS1525-MLS of recombinant plasmid
1); Its microbial preservation number is: CCTCC No:M2011445; The classification name is: bacillus megaterium WH320-pHIS1525-MLS
1(Bacillus megaterium WH320-pHIS1525-MLS
1); The preservation time is on December 5th, 2011; Depositary institution is: Chinese typical culture collection center; The preservation address is: Chinese Wuhan Wuhan University.
Further, the present invention bacillus megaterium bacterial strain (WH320-pHIS1525-MLS that will recombinate
1) be that 0.2% wood sugar is induced with the adding final concentration, fusion gene is expressed on the thalline surface; Immunoblot experiment shows, expressed recombinant protein can react with the TGEV immune serum, showing that recombinant protein is the same with the TGEV natural antigen has an identical antigenicity, can be used in the safe and effective mucosal immunity live bacterial vaccines that is prepared into the control porcine epizootic diarrhea.Indirect immunofluorescence detects and confirms that also expressing protein is present on the thalline, viable bacteria body immunofluorescent test behind the abduction delivering shows, expressed albumen Primary Location is in the surface of thalline, the target protein that has the thalline surface, be antigenic substance effective stimulus immunity system, improve antibody horizontal and established important basic substance.
The present invention is purpose with the first line of defence that blocking-up infectious intestinal disease disease pathogen infects in experimental design, use the bacillus megaterium expression system of safety non-toxic, bacillus megaterium does not produce intracellular toxin, do not produce the outer Sumizyme MP of born of the same parents, be conducive to the stable accumulation of expressed albumen, plasmid is stable, can stability and high efficiency ground expressing protein, and relatively more suitable industrial fermentation production.Genus bacillus can consume a large amount of free oxygens after the enteron aisle field planting simultaneously, causes anaerobic environment, can reduce aerophil to the field planting of enteron aisle.Also be conducive to the growth of anerobes such as lactobacillus and bifidus bacillus, cause the probiotics in the body to increase and the pathogenic bacterium minimizing, keep the intestinal microecology system balancing.
In order to check the present invention maybe this reorganization bacillus megaterium expressed fusion protein MLS of bacillus megaterium that recombinates
1As the feasibility of control transmissible gastroenteritis of swine oral vaccine, the reorganization bacillus megaterium WH320-pHIS1525-MLS that the present invention will make up
1The oral immunity mouse, different time is measured the level of specific antibody sIgA in the enteron stool; Test-results is found, reorganization bacillus megaterium WH320-pHIS1525-MLS
1Produced the secretion sIgA antibody response of tangible anti-PEDV-S albumen at continuous 3 immunity back inducing mouses.Reorganization bacterium group later stage sampling antibody rises always, each time point sampling antibody horizontal all reaches contrast bacterium (immune empty carrier transformed bacteria WH320-pHIS1525) group and PBS group (p＜0.05) at the beginning of immunity, antibody horizontal reaches peak (p＜0.05) during reorganization bacterium group 38d, descend afterwards, antibody horizontal is still apparently higher than control group (p＜0.05) during to 60d.
Test-results shows, the reorganization bacillus megaterium that the present invention is constructed or expressed fusion protein MLS
1Can effectively stimulate the mouse intestinal immunity system to produce specific immune response, it can be prepared into the oral vaccine of control transmissible gastroenteritis of swine.
The term definition that arrives involved in the present invention
Unless otherwise defined, otherwise all technology used herein and scientific terminology all have with those skilled in the art and usually understand identical implication.Though in practice of the present invention or test, can use any method, device and the material similar or equivalent with person described herein, describe preferred method, device and material now.
Term " recombinant host bacterial strain " or " host cell " mean the cell that comprises polynucleotide of the present invention, and no matter use which kind of method to insert to produce recombinant host cell, for example directly absorb, other known method in transduction, f pairing or the affiliated field.Exogenous polynucleotide can remain the nonconformity carrier of plasmid for example or can be integrated in the host genome.
Term " polynucleotide " means deoxyribonucleotide, dezyribonucleoside, ribonucleoside or ribonucleotide and the polymkeric substance thereof of sub-thread or bifilar form.Unless specific limited, otherwise the nucleic acid of the known analogue that contains natural nucleotide contained in described term, described analogue have the binding characteristic that is similar to reference nucleic acid and carry out metabolism in the mode of the Nucleotide that is similar to natural generation.Unless other specific limited, otherwise described term also means oligonucleotide analogs, it comprises the PNA(peptide nucleic acid(PNA)), in antisense technology used DNA analogue (thiophosphatephosphorothioate, phosphamide acid esters etc.).Unless otherwise, otherwise specific nucleic acid sequence is also impliedly contained its conservative varient of modifying (including, but is not limited to degenerate codon replaces) and complementary sequence and the clear and definite sequence of appointment.Specific, can realize that through mixing the sequence that base and/or Hypoxanthine deoxyriboside residue replace degenerate codon replaces (Batzer et al., Nucleic Acid Res.19:5081 (1991) by producing one of them or selected more than one (or all) codon the 3rd; Ohtsuka et al., J.Biol.Chem.260:2605-2608 (1985); Rossolini et al., Mol Cell.Probes 8:91-98 (1994)).
Term " expression " is foreign gene transcribing or/and translate in the host.
Term " polypeptide ", " peptide " and " albumen " exchange in this article and use to mean the polymkeric substance of amino-acid residue.That is, be equally applicable to describe peptide at the description of polypeptide and describe albumen and vice versa.Described term is applicable to natural generation aminoacid polymers and one of them or the aminoacid polymers that above amino-acid residue is non-naturally encoded amino acids.As used herein, the amino acid chain of any length contained in described term, and it comprises full-length proteins (being antigen), and wherein amino-acid residue connects via the covalency peptide bond.
Description of drawings
Fig. 1 PCR product electrophoresis result; 1-3, MLS
1The PCR product; M, DL2000.
The enzyme of Fig. 2 expression plasmid pHIS1525 is cut detection; 1-2, plasmid pHIS1525 enzyme are cut product; M, DL2000.
Fig. 3 PCR product electrophoresis result; 1-3:BglII and SphI double digestion, the fragment that obtains is about 7500bp, 1920bp respectively; M1:DL2000; M2:DL15000.
The SDS-PAGE of Fig. 4 expression product and Western-blot analyze; M: protein molecular weight standard; 1: the protein after reorganization bacillus megaterium WH320-pHIS1525 induces; 2-4, reorganization bacillus megaterium WH320-pHIS1525-MLS
1Protein after inducing; 5: reorganization bacillus megaterium WH320-pHIS1525-MLS
1The immunoblotting of the protein after inducing.
The indirect immunofluorescence of Fig. 5 expression product detects (* 40); A:WH320-pHIS1525-MLS
1The IFA test-results of reorganization bacterium, somatic cells has distributed strong yellow-green fluorescence; The IFA test-results of B:WH320-pHIS1525 reorganization bacterium does not have fluorescence, and thalline takes on a red color.
Fig. 6 different time points stool in mice specificity sIgA measurement result behind the bacillus megaterium immune mouse of recombinating.
Fig. 7 different time points stool in mice specificity sIgA measurement result behind the bacillus megaterium immune mouse of recombinating.
Embodiment
Further describe the present invention below in conjunction with specific embodiment, advantage of the present invention and characteristics will be more clear along with description.But these embodiment only are exemplary, scope of the present invention are not constituted any restriction.It will be understood by those skilled in the art that and down can make amendment or replace the details of technical solution of the present invention and form without departing from the spirit and scope of the present invention, but these modifications and replacing all fall within the scope of protection of the present invention.
1 epitope sequence MLS
1Design with synthetic
According to the PEDV complete genome sequence AF353511 of Genbank login, find out the 22-505aa section sequence of coding S glycoprotein, by the Linker ((GGGGS) of flexibility
3) with the S of PEDV
1Antigen site gene and cell walls anchor series (CWA
M6) couple together this sequence called after MLS
1(SEQ ID No.1).Rare codon Threonine (ACG), Histidine (CAC), arginine (CGG, CGA), L-Ala (GCG) and leucine (CTC, CTG) etc. are changed, but do not change its coded amino acid.At MLS
1Upstream and downstream introduce Bgl II restriction enzyme site and SphI restriction enzyme site respectively.With the MLS that designs
1Sequence is carried out synthetic, has made up recombinant plasmid pMD18-MLS
1
PMDl8-T Simple Vector is available from TaKaRa (Dalian) company, pMD18-MLS
1Concrete building process as follows:
The pcr amplification goal gene, in the PCR reaction tubes according to adding reagent and solution shown in the table 1.
Table 1MLS
1The PCR reaction system
P1：5'-GA AGA TCT ATGGATGTCACTAGGTGCCAGT 3'
P2：5'-ACAT GCA TGC GTTTTCTTCTTTGCGTTTTACA 3'
Mixing and centrifugal after be positioned in the PCR instrument, behind 94 ℃ of pre-sex change 5min, carry out following circulation: 94 ℃, 30s; 54 ℃, 30s; 72 ℃, 30s.30 circulations are extended 10min for back 72 ℃.After pcr amplification is finished, get 5 μ L products and observe with the l% agarose gel electrophoresis.And reclaim test kit specification sheets recovery enzyme with reference to dna gel and cut product, reclaiming the test kit specification sheets with reference to dna gel and reclaim the PCR reaction product, operation steps is as follows:
With 100 μ L PCR products electrophoresis in 1% sepharose, under UV-lamp, downcut the sepharose that contains target DNA, the DE-A(that adds 3 gel volumes is that dna gel reclaims the reagent in the test kit) solution, mix the back in 75 ℃ of heating and melting.The DE-B(that adds 0.5 DE-A volume is that dna gel reclaims the reagent in the test kit) solution, mix.Get above mixed solution, be transferred to DNA and prepare and centrifugally in the pipe abandon filtrate.To prepare pipe and put back centrifuge tube, adding 0.5ml W1(is that dna gel reclaims the reagent in the test kit) solution, the centrifugal 30s of 12000rpm abandons filtrate.To prepare pipe and put back centrifuge tube, adding 0.7ml W2(is that dna gel reclaims the reagent in the test kit) solution, the centrifugal 30s of 12000rpm abandons filtrate, repeats this step once.To prepare pipe and put back in the centrifuge tube, the centrifugal 1min of 12000rpm.The preparation pipe is placed clean 1.5ml centrifuge tube, add in right amount (20 μ L) water or the elutriant room temperature leaves standstill 1min, the centrifugal 1min eluted dna of 12000rpm in preparation film centre.Fetch to receive in product 1 μ L 1% sepharose and carry out electrophoresis, detect and reclaim the result.And it is standby in-20 ℃ of preservations.
The PCR product is connected and conversion with cloning vector
Pressing pMDl8-T Simple Vector specification sheets is connected the PCR product that reclaims with pMDl8-T Simple Vector.Linked system sees Table 2:
Table 2 ligation system
Centrifugal behind the mixing, place 16 ℃ of water-baths to connect 4h, 4 ℃ are spent the night.After the connection, contain MLS
1The plasmid called after pMD18-MLS of sequence
1
The structure of 2 recombinant expression vectors
With pMD18-MLS
1The vector plasmid pHIS1525(plasmid pHIS1525 of plasmid and secreting, expressing purchases the company in MoBiTec) respectively with reclaiming behind Bgl II+SphI double digestion, couple together with T4DNA ligase and to be built into recombinant plasmid pHIS1525-MLS
1
2.1MLS
1The enzyme of sequence is cut and is reclaimed
The endonuclease reaction system sees Table 3.
Table 3 Bgl II, SphI double digestion reaction system
100 μ L enzymes are cut product electrophoresis in 1% sepharose, and reclaim test kit specification sheets recovery enzyme with reference to dna gel and cut product, reclaim the test kit specification sheets with reference to dna gel and reclaim the PCR reaction product, operation steps is as follows:
With 100 μ L PCR products electrophoresis in 1% sepharose, under UV-lamp, downcut the sepharose that contains target DNA, add the DE-A solution of 3 gel volumes, mix the back in 75 ℃ of heating and melting.Add the DE-B solution of 0.5 DEA volume, mix.Get above mixed solution, be transferred to DNA and prepare and centrifugally in the pipe abandon filtrate.To prepare pipe and put back centrifuge tube, and add 0.5ml Wl solution, the centrifugal 30s of 12000rpm abandons filtrate.To prepare pipe and put back centrifuge tube, and add 0.7ml W2 solution, the centrifugal 30s of 12000rpm abandons filtrate, repeats this step once.To prepare pipe and put back in the centrifuge tube, the centrifugal 1min of 12000rpm.The preparation pipe is placed clean 1.5ml centrifuge tube, add in right amount (20 μ L) water or the elutriant room temperature leaves standstill 1min, the centrifugal 1min eluted dna of 12000rpm in preparation film centre.Fetch to receive in product 1 μ L 1% sepharose and carry out electrophoresis, detect and reclaim the result, the big or small about 1920bp(Fig. 1 that conforms to expected results of nucleotide fragments).
2.2 the enzyme of the carrier pHIS1525 of bacillus megaterium secreting, expressing is cut and is reclaimed
A large amount of enzymes of the carrier pHIS1525 of bacillus megaterium secreting, expressing are cut, and the endonuclease reaction system sees Table 4.
Table 4Bgl II, SphI double digestion reaction system
100 μ L enzymes are cut product electrophoresis in 1% sepharose, and reclaim test kit specification sheets recovery enzyme with reference to dna gel and cut product, more than the concrete steps reference, fetch to receive in product 1 μ L 1% sepharose and carry out electrophoresis (Fig. 2), detect and reclaim the result.And it is standby in-20 ℃ of preservations.
2.3MLS
1The structure of gene bacillus megaterium secretion expression carrier
The enzyme of above step preparation is cut purified product connect, linked system sees Table 5.
Table 5 MLS
1The carrier pHIS1525 ligation system of gene secreting, expressing
After 16 ℃ of water-baths connected 4h, 4 ℃ were spent the night.
The purifying that connects product: will connect product and be transferred in the 1.5ml centrifuge tube, the dehydrated alcohol that adds the 3mol/L sodium-acetate (pH5.2) of 2.0 μ L and 50 μ L is mixing gently, after placing-20 ℃, 1h, 4 ℃, the centrifugal 30min of 12000rpm carefully remove supernatant, 70% ethanol that adds 500 μ L, 4 ℃, the centrifugal 5min of 12000rpm carefully remove supernatant, and be air-dry to there not being the ethanol smell, add 4 μ L sterilization deionized water dissolving precipitation ,-20 ℃ of preservations are standby.
2.4pHIS1525-MLS
1The double digestion of plasmid, PCR identify
(1) with the above-mentioned plasmid that reclaims, with Bgl II, SphI double digestion, the endonuclease reaction system sees Table 6.
Table 6 pHIS1525-MLS
1The double digestion reaction system of plasmid
The above component of mixing gently, 37 ℃ of water-bath 4h get 5 μ L enzymes and cut product and observe with 1% agarose gel electrophoresis.Can cut out the purpose fragment and pHIS1525 carrier plasmid of the same size is accredited as the positive.
(2) above extracted plasmid is diluted 100 times with sterile purified water, get 2 μ L as template, carry out PCR and identify, fetch to receive in product 1 μ L 1% sepharose and carry out electrophoresis, detect and reclaim the result, the big or small about 1920bp(Fig. 3 that conforms to expected results of nucleotide fragments), show MLS
1Oneself is inserted into gene between the restriction enzyme site Bgl II, SphI of expression vector pHIS1525, with the positive recombinant plasmid called after pHIS1525-MLS that obtains
1With the positive recombinant bacterial strain called after WH320-pHIS1525-MLS that obtains
1Bacterial strain.
Embodiment 2MLS
1The conversion of gene bacillus megaterium and expression are identified
The preparation of 1 bacillus megaterium protoplastis
Picking one ring bacillus megaterium (Bacillus megaterium) WH320(purchases the company in MoBiTec) rule at the LB flat board, 37 ℃ of incubated overnight, from above-mentioned dull and stereotyped picking one single colony inoculation to 1 * AB3 liquid nutrient medium, 37 ℃ of incubated overnight of 200r/min; Get above-mentioned seed liquor 1ml and change the 250ml triangular flask that 50ml 1 * AB3 substratum is housed over to, 200r/min37 ℃ is cultured to OD600 ≈ 1.0 centrifugal collection thalline, adds 5ml SMMP solution suspension thalline; Bacterium liquid is changed in the 100ml triangular flask, and adding final concentration is the N,O-Diacetylmuramidase of 0.1mg/ml, puts 37 ℃ of water bath heat preservation 30min, uses the formation of microscopic examination protoplastis therebetween, and being formed on about half of protoplastis is advisable; Centrifugal 10min collects protoplastis, with an amount of SMMP buffer solution elution once, uses 5ml SMMP solution suspension thalline at last.
2 huge bud pole bacterium protoplast transformation
Get 100 μ L protoplastiss in 1.5ml EP pipe, add about 1 μ g recombinant expression vector plasmid, 300 μ LpEG-P successively, be incubated 2min under the room temperature; Adding 1ml SMMP solution slowly mixes; The centrifugal 10min of 3000r/min removes supernatant liquor gently under the room temperature, generally can't see any precipitation this moment; Add 500 μ L SMMP solution in the EP pipe, it is put 37 ℃ cultivate 90min; 2.5ml CR5-top top-layer agar is placed 60 ℃ of water-baths standby (this agar is adorned with the 5ml centrifuge tube); Get the CR5-top top-layer agar that 200 μ L bacterium liquid are added to preheating in advance behind the 90min, be poured into after mixing on the LB flat board and (contain 10 μ g/ml tsiklomitsins), with the glass rod coating evenly, 37 ℃ of overnight incubation.Simultaneously, transform as positive control by above step with the empty carrier that does not contain goal gene.
3 reorganization bacillus megaterium MLS
1The abduction delivering of gene and evaluation
WH320-pHIS1525 and WH320-pHIS1525-MLS
1Inoculation 10ml LB liquid nutrient medium, 37 ℃ of thermal agitation overnight incubation are inoculated in the 50ml LB liquid with 5% inoculum size respectively and carry out amplification cultivation, take out one bottle of WH320-pHIS1525-MLS behind the cultivation 4h
1As the sample before inducing, all the other add final concentration is that 0.2% wood sugar is induced 6-9h, gets engineering bacteria WH320-pHIS1525-MLS respectively
1Induce preceding, induce back 6-9h supernatant liquor and positive control bacterial strain (WH320-pHIS1525) supernatant liquor 6ml, behind the acetone precipitation of 4 times of volumes, obtain supernatant liquor albumen, add boil 5min behind 40 μ L2 * the go up sample buffer mixing after, centrifuging and taking 20 μ L supernatant liquors carry out the SDS-PAGE electrophoresis detection.
The immune marking (western-blot) of 4 expression products is analyzed
Gel after the above-mentioned electrophoresis end is transferred to albumen on the nitrocellulose filter of transfer printing damping fluid balance through transfer device, connected power supply, 0.5-1mA/cm
2Transfer printing 1h.After transfer printing finished, the anti-PEDV serum of rabbit was as first antibody, and as second antibody, the 20min that develops the color in the 4-chloro-1-naphthols substrate chromophoric solution detects the antigenic activity of expression product with the horseradish peroxidase-labeled goat anti-rabbit igg.
The result shows, reorganization bacillus megaterium WH320-pHIS1525-MLS
1The band of expression is arranged at about 64kDa place, goal gene has obtained effectively expressing (as shown by arrows) (Fig. 4) in engineering bacteria, along with the increase of induction time, the content of target protein also progressively increases in the supernatant liquor, and does not contain target protein in the positive control bacterium supernatant liquor.Detect by Western-blot and to show that recombinant protein has the ability that the antiserum(antisera) with the preparation of PEDV totivirus reacts, and have good specificity, i.e. reactionogenicity.
5 indirect immunofluorescences
Get the positive reorganization bacterium that 12h cultivates and empty carrier contrast bacteria liquid culture 0.5mL is centrifugal remove supernatant after, wash 3 times with the PBS low-speed centrifugal respectively, add the anti-TGEV antiserum(antisera) in rabbit source, suspend and mix back 37 ℃ of effect 30min, the centrifugal supernatant that goes, PBS is centrifugal to wash thalline 3 times, the anti-rabbit fluorescent mark that contains Evans Blue two that adds dilution is anti-, suspends to mix back 37 ℃ of effect 30min, the centrifugal supernatant that goes, PBS is centrifugal to wash thalline 3 times, the bacterial sediment thing is suspended in 200 μ L PBS, gets an amount of smear, seasoning, cold acetone is 30min fixedly, dry back fluorescence microscope.
With WH320-pHIS1525-MLS
1The indirect immunofluorescence experiment result that reorganization bacterium and WH320-pHIS1525 contrast bacterium carry out shows, reorganization bacterium WH320-pHIS1525-MLS
1The visible significantly yellow-green fluorescence of fluorescence microscopy shows also that thus the expressed foreign protein of reorganization bacterium is the surface location that is present in thalline; WH320-pHIS1525 does not find green fluorescence, and thalline is dyed redness (Fig. 5).
The immune protection effectiveness test of test example 1 reorganization bacillus megaterium
1. test method
1.1 strains tested: the reorganization bacterium WH320-pHIS1525-MLS that the embodiment of the invention 1 is constructed
1
1.2 laboratory animal grouping and immunity
Laboratory animal: 30 of body weight 18-20g 6-8 cleaning level in age in week BALB/c mouse, available from Animal Experimental Study center, Hubei Province.
The immunity group: laboratory animal is divided into 3 groups at random, 10 every group, the bacterium of namely recombinating group (WH320-pHIS1525-MLS
1), contrast bacterium (WH320-pHIS1525) group and PBS control group, reorganization bacterium group and contrast bacterium are organized every mouse with 2 * 10
10Individual/mL bacterium oral vaccination 0.1mL, the oral PBS liquid with volume of PBS control group.
Immune programme for children: immunity 3 times, every 2 all immunity once, each continuous immunity 3d, every day 1 time.
1.3 sample collecting and processing
Collect immune mouse fresh excreta sample respectively at 18d, 32d, 38d, 46d, 60d.-70 ℃ frozen standby.
Faecal samples is handled: before the detection, every 0.1g ight soil adds 1mL ight soil extracting solution, place on the vibrator, and vibration 30min, 4 ℃ of infiltrations are spent the night.The centrifugal 5min of 10000r/min collects supernatant as test sample.
1.4 immune mouse ight soil specificity sIgA measures
The employing indirect ELISA method carries out.With 37 ℃ of reactions of the antigen coated 96 hole polystyrene micro plates of PEDV totivirus 2h, 0.01mol/L PBST liquid is washed 3 times.With 37 ℃ of sealings of the 0.01mol/L PBS liquid that contains 0.5% polyvinyl alcohol 4h, 0.01mol/L PBST liquid is washed 3 times.Add the ight soil supernatant of handling well respectively, 37 ℃ of reaction 1h, 0.01mol/L PBST washes 3 times.The HRP mark sheep anti mouse IgA(that adds the 1:2000 dilution is available from magnificent biotechnology company limited), 37 ℃ of reaction 1h, 0.01mol/L PBST liquid is washed 3 times.Add OPD-H
2O
2Substrate colour developing liquid lucifuge colour developing 15min.After adding stop buffer, enzyme mark determinator is measured the photoabsorption (OD in every hole at wavelength 492nm place automatically
490) value.
2 test-results
Test-results is seen Fig. 6, Fig. 7 and table 7.Reorganization bacillus megaterium WH320-pHIS1525-MLS
1Produced the secretion sIgA antibody response of tangible anti-PEDV-S albumen at continuous 3 immunity back inducing mouses.Reorganization bacterium group later stage sampling antibody rises always, each time point sampling antibody horizontal all reaches contrast bacterium group and PBS group (p＜0.05) at the beginning of immunity, antibody horizontal reaches peak (p＜0.05) during reorganization bacterium group 38d, descend afterwards, antibody horizontal is still apparently higher than control group (p＜0.05) during to 60d.Significant difference does not appear in the mouse of immunity empty carrier transformed bacteria WH320-pHIS1525 and negative control group mouse secretion property sIgA antibody horizontal before and after immunity.
Test-results shows, the present invention recombinate bacillus megaterium or its expressed fusion protein MLS
1Can effectively stimulate the mouse intestinal immunity system to produce specific immune response, prove to recombinate bacillus megaterium or its expressed fusion protein MLS
1Feasibility as control transmissible gastroenteritis of swine oral vaccine.
Table 7 reorganization bacillus megaterium immune mouse specificity sIgA measures
Notes: * represents to recombinate, and the bacterium group later stage samples and (P＜0.05) is compared in sampling in 0 day; # represents to recombinate, and bacterium is organized and contrasted to bacterium and the PBS group compares (P＜0.05).
＜110〉Wuhan Huayang Animal Pharmaceutical Co., Ltd.
＜120〉porcine epizootic diarrhea S1 protein fusion gene and reorganization bacillus megaterium and application
<130> DQXL-0018
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 1920
<212> DNA
<213> Artifical sequence
<220>
<221> CDS
<222> (1)..(1920)
<400> 1
aug gat gtc act agg tgc cag tct act act aac ttt agg cgt ttc ttt 48
Met Asp Val Thr Arg Cys Gln Ser Thr Thr Asn Phe Arg Arg Phe Phe
1 5 10 15
tca aaa ttt aat gtt cag gca cct gcc gtc gtc gtt ttg ggt ggt tac 96
Ser Lys Phe Asn Val Gln Ala Pro Ala Val Val Val Leu Gly Gly Tyr
20 25 30
cta cct agt atg aac tct tct agc tgg tac tgt ggc aca ggc att gaa 144
Leu Pro Ser Met Asn Ser Ser Ser Trp Tyr Cys Gly Thr Gly Ile Glu
35 40 45
act gct agt ggc gtt cat ggt att ttt ctc agc tac atc gat tct ggt 192
Thr Ala Ser Gly Val His Gly Ile Phe Leu Ser Tyr Ile Asp Ser Gly
50 55 60
cag ggc ttt gag att ggc att tct caa gag cct ttt gat cct agt ggt 240
Gln Gly Phe Glu Ile Gly Ile Ser Gln Glu Pro Phe Asp Pro Ser Gly
65 70 75 80
tac cag ctt tat tta cat aag gcc act aat ggt aac act aat gct att 288
Tyr Gln Leu Tyr Leu His Lys Ala Thr Asn Gly Asn Thr Asn Ala Ile
85 90 95
gca cgt ctg cgc att tgc cag ttt ccc gat aat aaa aca ttg ggc cct 336
Ala Arg Leu Arg Ile Cys Gln Phe Pro Asp Asn Lys Thr Leu Gly Pro
100 105 110
act gtt aat gat gtt aca aca ggt cgt aac tgc cta ttc aac aaa gcc 384
Thr Val Asn Asp Val Thr Thr Gly Arg Asn Cys Leu Phe Asn Lys Ala
115 120 125
att cca gct tat atg cgt gat gga aaa gat att gtt gtc ggc ata aca 432
Ile Pro Ala Tyr Met Arg Asp Gly Lys Asp Ile Val Val Gly Ile Thr
130 135 140
tgg gat aat gat cgt gtc act gtt ttt gct gac aag atc tat cat ttt 480
Trp Asp Asn Asp Arg Val Thr Val Phe Ala Asp Lys Ile Tyr His Phe
145 150 155 160
tat ctt aaa aat gat tgg tcc cgc gtt gct aca aga tgt tac aat cgc 528
Tyr Leu Lys Asn Asp Trp Ser Arg Val Ala Thr Arg Cys Tyr Asn Arg
165 170 175
aga agt tgt gct atg caa tat gtt tat aca cct acc tac tac atg ctt 576
Arg Ser Cys Ala Met Gln Tyr Val Tyr Thr Pro Thr Tyr Tyr Met Leu
180 185 190
aat gtt act agt gca ggt gag gat ggc att tat tat gaa ccc tgt aca 624
Asn Val Thr Ser Ala Gly Glu Asp Gly Ile Tyr Tyr Glu Pro Cys Thr
195 200 205
gct aat tgc act ggt tac gct gcc aat gtt ttt gcc act gat tcc aat 672
Ala Asn Cys Thr Gly Tyr Ala Ala Asn Val Phe Ala Thr Asp Ser Asn
210 215 220
ggc cat ata cca gaa ggt ttt agt ttt aat aat tgg ttt ctt tta tcc 720
Gly His Ile Pro Glu Gly Phe Ser Phe Asn Asn Trp Phe Leu Leu Ser
225 230 235 240
aat gac tcc act ttg ttg cat ggt aaa gtt gtt tcc aac caa ccc ttg 768
Asn Asp Ser Thr Leu Leu His Gly Lys Val Val Ser Asn Gln Pro Leu
245 250 255
ttg gtc aat tgt ctt ttg gcc att cct aag att tat gga cta ggc caa 816
Leu Val Asn Cys Leu Leu Ala Ile Pro Lys Ile Tyr Gly Leu Gly Gln
260 265 270
ttt ttc tca ttc aat cac act atg gat ggc gtt tgt aat gga gct gct 864
Phe Phe Ser Phe Asn His Thr Met Asp Gly Val Cys Asn Gly Ala Ala
275 280 285
gtt gat cgt gcc cca gag gct ctg agg ttt aat att aat gac acc tcc 912
Val Asp Arg Ala Pro Glu Ala Leu Arg Phe Asn Ile Asn Asp Thr Ser
290 295 300
gtc att ctt gct gaa ggc tca att gtt ctt cat act gct tta gga aca 960
Val Ile Leu Ala Glu Gly Ser Ile Val Leu His Thr Ala Leu Gly Thr
305 310 315 320
aat ctt tct ttt gtt tgc agt aat tcc tca gat cct cat tta gcc atc 1008
Asn Leu Ser Phe Val Cys Ser Asn Ser Ser Asp Pro His Leu Ala Ile
325 330 335
ttt gcc ata cct ctg ggt gct act gaa gtt ccc tac tat tgc ttt ctt 1056
Phe Ala Ile Pro Leu Gly Ala Thr Glu Val Pro Tyr Tyr Cys Phe Leu
340 345 350
aaa gtt gat act tac aac tcc act gtt tat aaa ttc ttg gct gtt tta 1104
Lys Val Asp Thr Tyr Asn Ser Thr Val Tyr Lys Phe Leu Ala Val Leu
355 360 365
cct cct act gtc agg gaa att gtc atc acc aag tat ggt gat gtt tat 1152
Pro Pro Thr Val Arg Glu Ile Val Ile Thr Lys Tyr Gly Asp Val Tyr
370 375 380
gtc aat ggt ttt ggc tat ttg cat ctc ggt ttg ttg gat gct gtc aca 1200
Val Asn Gly Phe Gly Tyr Leu His Leu Gly Leu Leu Asp Ala Val Thr
385 390 395 400
att aat ttc act ggt cat ggc act gac gat gac gtt tca ggt ttc tgg 1248
Ile Asn Phe Thr Gly His Gly Thr Asp Asp Asp Val Ser Gly Phe Trp
405 410 415
acc ata gca tct act aat ttt gtt gat gca ctc atc gag gtt caa gga 1296
Thr Ile Ala Ser Thr Asn Phe Val Asp Ala Leu Ile Glu Val Gln Gly
420 425 430
act tcc att cag cgt att ctt tat tgt gat gat cct gtt agc caa ctc 1344
Thr Ser Ile Gln Arg Ile Leu Tyr Cys Asp Asp Pro Val Ser Gln Leu
435 440 445
aag tgt tct cag gtt gct ttt gac ctt gac gat ggt ttt tac ccc atc 1392
Lys Cys Ser Gln Val Ala Phe Asp Leu Asp Asp Gly Phe Tyr Pro Ile
450 455 460
tct tct aga aac ctt ctg agt cat gaa cag cca att tct ttt gtt act 1440
Ser Ser Arg Asn Leu Leu Ser His Glu Gln Pro Ile Ser Phe Val Thr
465 470 475 480
ttg cca tca ttt aat ggt ggc ggt ggc tct ggc gga ggt ggg agc ggc 1488
Leu Pro Ser Phe Asn Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
485 490 495
ggt ggt ggc agc aaa gct tta gaa gaa gca aac agc aaa tta gct gct 1536
Gly Gly Gly Ser Lys Ala Leu Glu Glu Ala Asn Ser Lys Leu Ala Ala
500 505 510
ctt gaa aaa ctt aac aaa gag ctt gaa gaa agc aag aaa tta aca gaa 1584
Leu Glu Lys Leu Asn Lys Glu Leu Glu Glu Ser Lys Lys Leu Thr Glu
515 520 525
aaa gaa aaa gct gag cta caa gca aaa ctt gaa gca gaa gca aaa gca 1632
Lys Glu Lys Ala Glu Leu Gln Ala Lys Leu Glu Ala Glu Ala Lys Ala
530 535 540
ctc aaa gaa caa tta gcg aaa caa gct gaa gaa ctt gca aaa cta aga 1680
Leu Lys Glu Gln Leu Ala Lys Gln Ala Glu Glu Leu Ala Lys Leu Arg
545 550 555 560
gct gga aaa gca tca gac tca caa acc cct gat gca aaa cca gga aac 1728
Ala Gly Lys Ala Ser Asp Ser Gln Thr Pro Asp Ala Lys Pro Gly Asn
565 570 575
aaa gtt gtt cca ggt aaa ggt caa gca cca caa gca ggt aca aaa cct 1776
Lys Val Val Pro Gly Lys Gly Gln Ala Pro Gln Ala Gly Thr Lys Pro
580 585 590
aac caa aac aaa gca cca atg aag gaa act aag aga cag tta cca tca 1824
Asn Gln Asn Lys Ala Pro Met Lys Glu Thr Lys Arg Gln Leu Pro Ser
595 600 605
aca ggt gaa aca gct aac cca ttc ttc aca gcg gca gcc ctt act gtt 1872
Thr Gly Glu Thr Ala Asn Pro Phe Phe Thr Ala Ala Ala Leu Thr Val
610 615 620
atg gca aca gct gga gta gca gca gtt gta aaa cgc aaa gaa gaa aac 1920
Met Ala Thr Ala Gly Val Ala Ala Val Val Lys Arg Lys Glu Glu Asn
625 630 635 640
<210> 2
<211> 640
<212> PRT
<213> Artifical sequence
<400> 2
Met Asp Val Thr Arg Cys Gln Ser Thr Thr Asn Phe Arg Arg Phe Phe
1 5 10 15
Ser Lys Phe Asn Val Gln Ala Pro Ala Val Val Val Leu Gly Gly Tyr
20 25 30
Leu Pro Ser Met Asn Ser Ser Ser Trp Tyr Cys Gly Thr Gly Ile Glu
35 40 45
Thr Ala Ser Gly Val His Gly Ile Phe Leu Ser Tyr Ile Asp Ser Gly
50 55 60
Gln Gly Phe Glu Ile Gly Ile Ser Gln Glu Pro Phe Asp Pro Ser Gly
65 70 75 80
Tyr Gln Leu Tyr Leu His Lys Ala Thr Asn Gly Asn Thr Asn Ala Ile
85 90 95
Ala Arg Leu Arg Ile Cys Gln Phe Pro Asp Asn Lys Thr Leu Gly Pro
100 105 110
Thr Val Asn Asp Val Thr Thr Gly Arg Asn Cys Leu Phe Asn Lys Ala
115 120 125
Ile Pro Ala Tyr Met Arg Asp Gly Lys Asp Ile Val Val Gly Ile Thr
130 135 140
Trp Asp Asn Asp Arg Val Thr Val Phe Ala Asp Lys Ile Tyr His Phe
145 150 155 160
Tyr Leu Lys Asn Asp Trp Ser Arg Val Ala Thr Arg Cys Tyr Asn Arg
165 170 175
Arg Ser Cys Ala Met Gln Tyr Val Tyr Thr Pro Thr Tyr Tyr Met Leu
180 185 190
Asn Val Thr Ser Ala Gly Glu Asp Gly Ile Tyr Tyr Glu Pro Cys Thr
195 200 205
Ala Asn Cys Thr Gly Tyr Ala Ala Asn Val Phe Ala Thr Asp Ser Asn
210 215 220
Gly His Ile Pro Glu Gly Phe Ser Phe Asn Asn Trp Phe Leu Leu Ser
225 230 235 240
Asn Asp Ser Thr Leu Leu His Gly Lys Val Val Ser Asn Gln Pro Leu
245 250 255
Leu Val Asn Cys Leu Leu Ala Ile Pro Lys Ile Tyr Gly Leu Gly Gln
260 265 270
Phe Phe Ser Phe Asn His Thr Met Asp Gly Val Cys Asn Gly Ala Ala
275 280 285
Val Asp Arg Ala Pro Glu Ala Leu Arg Phe Asn Ile Asn Asp Thr Ser
290 295 300
Val Ile Leu Ala Glu Gly Ser Ile Val Leu His Thr Ala Leu Gly Thr
305 310 315 320
Asn Leu Ser Phe Val Cys Ser Asn Ser Ser Asp Pro His Leu Ala Ile
325 330 335
Phe Ala Ile Pro Leu Gly Ala Thr Glu Val Pro Tyr Tyr Cys Phe Leu
340 345 350
Lys Val Asp Thr Tyr Asn Ser Thr Val Tyr Lys Phe Leu Ala Val Leu
355 360 365
Pro Pro Thr Val Arg Glu Ile Val Ile Thr Lys Tyr Gly Asp Val Tyr
370 375 380
Val Asn Gly Phe Gly Tyr Leu His Leu Gly Leu Leu Asp Ala Val Thr
385 390 395 400
Ile Asn Phe Thr Gly His Gly Thr Asp Asp Asp Val Ser Gly Phe Trp
405 410 415
Thr Ile Ala Ser Thr Asn Phe Val Asp Ala Leu Ile Glu Val Gln Gly
420 425 430
Thr Ser Ile Gln Arg Ile Leu Tyr Cys Asp Asp Pro Val Ser Gln Leu
435 440 445
Lys Cys Ser Gln Val Ala Phe Asp Leu Asp Asp Gly Phe Tyr Pro Ile
450 455 460
Ser Ser Arg Asn Leu Leu Ser His Glu Gln Pro Ile Ser Phe Val Thr
465 470 475 480
Leu Pro Ser Phe Asn Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
485 490 495
Gly Gly Gly Ser Lys Ala Leu Glu Glu Ala Asn Ser Lys Leu Ala Ala
500 505 510
Leu Glu Lys Leu Asn Lys Glu Leu Glu Glu Ser Lys Lys Leu Thr Glu
515 520 525
Lys Glu Lys Ala Glu Leu Gln Ala Lys Leu Glu Ala Glu Ala Lys Ala
530 535 540
Leu Lys Glu Gln Leu Ala Lys Gln Ala Glu Glu Leu Ala Lys Leu Arg
545 550 555 560
Ala Gly Lys Ala Ser Asp Ser Gln Thr Pro Asp Ala Lys Pro Gly Asn
565 570 575
Lys Val Val Pro Gly Lys Gly Gln Ala Pro Gln Ala Gly Thr Lys Pro
580 585 590
Asn Gln Asn Lys Ala Pro Met Lys Glu Thr Lys Arg Gln Leu Pro Ser
595 600 605
Thr Gly Glu Thr Ala Asn Pro Phe Phe Thr Ala Ala Ala Leu Thr Val
610 615 620
Met Ala Thr Ala Gly Val Ala Ala Val Val Lys Arg Lys Glu Glu Asn
625 630 635 640
Claims (10)
1. porcine epizootic diarrhea S
1The proteantigen fusion gene is characterized in that: its polynucleotide sequence is shown in the SEQ IDNo.1.
2. by the described fusion gene encoded protein of claim 1, it is characterized in that: its aminoacid sequence is shown in the SEQ IDNo.2.
3. the recombinant expression vector that contains the described fusion gene of claim 1.
4. contain the recombinant host strain of the described recombinant expression vector of claim 3.
5. according to the described recombinant host strain of claim 4, it is characterized in that: described recombinant host strain is reorganization bacillus megaterium (Bacillus megaterium) bacterial strain, and its microbial preservation number is: CCTCC No:M2011445.
6. the described porcine epizootic diarrhea S1 of claim 1 proteantigen fusion gene is preparing the purposes of preventing and treating in the porcine epizootic diarrhea vaccine.
7. the described albumen of claim 2 is preparing the purposes of preventing and treating in the porcine epizootic diarrhea vaccine.
8. the described expression vector of claim 3 is preparing the purposes of preventing and treating in the porcine epizootic diarrhea vaccine.
9. claim 4 or 5 described recombinant host strains are preparing the purposes of preventing and treating in the porcine epizootic diarrhea vaccine.
10. according to the described purposes of claim 6-9, it is characterized in that: described vaccine is the mucosal immunity live bacterial vaccines.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210523652.4A CN103194472B (en) | 2011-12-16 | 2012-12-06 | Porcine epizootic diarrhea virus S1 protein fusion gene and recombinant bacillus megaterium, and their use |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104247048 | 2011-12-16 | ||
| CN201110424704.8 | 2011-12-16 | ||
| CN2011104247048A CN102399806A (en) | 2011-12-16 | 2011-12-16 | Porcine epidemic diarrhea S1 protein fusion gene, recombinant bacillus megaterium strain and application |
| CN201210523652.4A CN103194472B (en) | 2011-12-16 | 2012-12-06 | Porcine epizootic diarrhea virus S1 protein fusion gene and recombinant bacillus megaterium, and their use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103194472A true CN103194472A (en) | 2013-07-10 |
| CN103194472B CN103194472B (en) | 2015-06-03 |
Family
ID=45882453
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011104247048A Pending CN102399806A (en) | 2011-12-16 | 2011-12-16 | Porcine epidemic diarrhea S1 protein fusion gene, recombinant bacillus megaterium strain and application |
| CN201210523652.4A Active CN103194472B (en) | 2011-12-16 | 2012-12-06 | Porcine epizootic diarrhea virus S1 protein fusion gene and recombinant bacillus megaterium, and their use |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011104247048A Pending CN102399806A (en) | 2011-12-16 | 2011-12-16 | Porcine epidemic diarrhea S1 protein fusion gene, recombinant bacillus megaterium strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN102399806A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104946686A (en) * | 2015-05-29 | 2015-09-30 | 广东大华农动物保健品股份有限公司 | Recombinant plasmid for expressing M protein, N protein and S1 protein in porcine epidemic diarrhea proteins, and construction method and application thereof |
| CN106188307A (en) * | 2016-07-06 | 2016-12-07 | 长沙爱科博生物科技有限公司 | A kind of fusion protein, its preparation method and boar oral vaccine or a medicine |
| CN106554944A (en) * | 2015-09-28 | 2017-04-05 | 普莱柯生物工程股份有限公司 | The vaccine combination and application of pig epidemic diarrhea virus attenuated strain and its preparation |
| US9950061B2 (en) | 2014-04-03 | 2018-04-24 | Boehringer Ingelheim Vetmedica, Inc. | Porcine epidemic diarrhea virus vaccine |
| CN108611325A (en) * | 2018-04-25 | 2018-10-02 | 南方医科大学 | A kind of preparation method of porcine epidemic diarrhea resisting virus S1 protein hybridoma cell strains |
| CN113318223A (en) * | 2021-04-22 | 2021-08-31 | 湖南兀邦生物科技有限公司 | Classical swine fever virus and porcine epidemic diarrhea virus subunit combined vaccine and preparation method thereof |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104513827B (en) * | 2013-09-30 | 2018-02-13 | 普莱柯生物工程股份有限公司 | A kind of Porcine epidemic diarrhea virus strain, its attenuated vaccine strain and application |
| CN103585625B (en) * | 2013-11-29 | 2015-12-02 | 华南农业大学 | A kind of porcine epizootic diarrhea recombinant baculovirus genetic engineering subunit vaccine and preparation method thereof and application |
| ES2702325T3 (en) | 2014-03-11 | 2019-02-28 | Univ Minnesota | Vaccines against swine epidemic diarrhea virus and methods of using them |
| CN104046637B (en) * | 2014-07-03 | 2017-04-12 | 南京农业大学 | Recombinant S1 protein of novel mutant strain of porcine epidemic diarrhea virus and subunit vaccine of recombinant S1 protein |
| CN106188249B (en) * | 2016-07-13 | 2019-10-01 | 北京农学院 | For detecting the antigen and method and kit of PEDV variation strain antibody |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892189A (en) * | 2010-07-05 | 2010-11-24 | 浙江大学 | Transformant for blocking effect of porcine somatostatin by oral immunization and application thereof |
-
2011
- 2011-12-16 CN CN2011104247048A patent/CN102399806A/en active Pending
-
2012
- 2012-12-06 CN CN201210523652.4A patent/CN103194472B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892189A (en) * | 2010-07-05 | 2010-11-24 | 浙江大学 | Transformant for blocking effect of porcine somatostatin by oral immunization and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| DENISE KNOBLOCH等: "Production, Secretion, and Cell Surface Display of Recombinant Sporosarcina ureae S-Layer Fusion Proteins in Bacillus megaterium", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 * |
| LIU DI-QIU等: "High-level mucosal and systemic immune responses induced by oral administration with Lactobacillus-expressed porcine epidemic diarrhea virus (PEDV) S1 region combined with Lactobacillus-expressed N protein", 《APPLIED MICROBIOLOGY AND BIOTECHNOLOGY》 * |
| 刘深基 等: "菌体表面表达与活菌疫苗", 《微生物学免疫学进展》 * |
| 陈惠 等: "内切葡聚糖酶基因在巨大芽孢杆菌中的表达及其酶学性质研究", 《遗传》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9950061B2 (en) | 2014-04-03 | 2018-04-24 | Boehringer Ingelheim Vetmedica, Inc. | Porcine epidemic diarrhea virus vaccine |
| US10702601B2 (en) | 2014-04-03 | 2020-07-07 | Boehringer Ingelheim Animal Health USA Inc. | Porcine epidemic diarrhea virus vaccine |
| CN104946686A (en) * | 2015-05-29 | 2015-09-30 | 广东大华农动物保健品股份有限公司 | Recombinant plasmid for expressing M protein, N protein and S1 protein in porcine epidemic diarrhea proteins, and construction method and application thereof |
| CN106554944A (en) * | 2015-09-28 | 2017-04-05 | 普莱柯生物工程股份有限公司 | The vaccine combination and application of pig epidemic diarrhea virus attenuated strain and its preparation |
| CN106554944B (en) * | 2015-09-28 | 2020-04-14 | 普莱柯生物工程股份有限公司 | Porcine epidemic diarrhea virus low-virulent strain, vaccine composition prepared from porcine epidemic diarrhea virus low-virulent strain and application of vaccine composition |
| CN106188307A (en) * | 2016-07-06 | 2016-12-07 | 长沙爱科博生物科技有限公司 | A kind of fusion protein, its preparation method and boar oral vaccine or a medicine |
| CN106188307B (en) * | 2016-07-06 | 2019-01-04 | 长沙爱科博生物科技有限公司 | A kind of fusion protein, preparation method and a boar oral vaccine or drug |
| CN108611325A (en) * | 2018-04-25 | 2018-10-02 | 南方医科大学 | A kind of preparation method of porcine epidemic diarrhea resisting virus S1 protein hybridoma cell strains |
| CN113318223A (en) * | 2021-04-22 | 2021-08-31 | 湖南兀邦生物科技有限公司 | Classical swine fever virus and porcine epidemic diarrhea virus subunit combined vaccine and preparation method thereof |
| CN113318223B (en) * | 2021-04-22 | 2021-12-31 | 湖南兀邦生物科技有限公司 | Classical swine fever virus and porcine epidemic diarrhea virus subunit combined vaccine and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103194472B (en) | 2015-06-03 |
| CN102399806A (en) | 2012-04-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103194472B (en) | Porcine epizootic diarrhea virus S1 protein fusion gene and recombinant bacillus megaterium, and their use | |
| EP2271663B1 (en) | Novel avian astrovirus | |
| CN104248762B (en) | A kind of pig epidemic diarrhea vaccine combination and its preparation method and application | |
| CN103314103A (en) | Porcine circovirus type 2, immune composition containing the same, assay kit, and use thereof | |
| Huang et al. | Construction and immunogenicity analysis of Lactobacillus plantarum expressing a porcine epidemic diarrhea virus S gene fused to a DC-targeting peptide | |
| CN107529534B (en) | Protective antigen of avibacterium paragallinarum, expression and application thereof | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| CN107099496A (en) | Recombinant strains of lactic acid bacteria of amalgamation and expression infections chicken cloacal bursa virus VP2 albumen and Salmonella outer membrane protein and application thereof | |
| CN100537749C (en) | Express the reorganization bacterium of enterotoxin colibacillus adhesin gene and the application in Yolk antibody feed thereof | |
| CN109303916A (en) | Coke dies GAP-associated protein GAP GSDMD and is preparing the application in ghost vaccine | |
| CN105907766B (en) | The recombinant yeast pichia pastoris and its construction method of expression goat alpha interferon and application | |
| CN104894045B (en) | A kind of recombinant Lactobacillus and its preparation method and application of coexpression VP 1 Gene of Foot-and-Mouth Disease virus and immunologic adjuvant ox IL-6 genes | |
| CN101838658A (en) | O type foot-and-mouth disease virus variant as well as coding gene and application thereof | |
| CN100567477C (en) | Express the recombination lactic acid galactococcus and the method for making of pig infectious gastroenteritis virus S protein | |
| CN103614387B (en) | The carrying Cap gene of porcine circovirus type 2 gene optimized and recombinant plasmid and application | |
| CN103194471B (en) | Transmissible gastroenteritis of swine S/N protein fusion gene and Recombinant Lactococcus lactis and application | |
| CN107446872A (en) | A kind of recombinant lactic acid bacteria vaccine strain of constitutive expression rabbit hemorrhagic disease virus VP60 albumen and its production and use | |
| CN109776657A (en) | Recombinate norovirus VLP particle and preparation method and its usage | |
| CN103409455A (en) | Egg yolk antibody anti-human enterotoxigenic escherichia coli adhesion protein and application thereof | |
| CN103194470B (en) | Swine transmissible gastroenteritis virus antigen fusion gene and recombinant bacillus megaterium, and their use | |
| Shonyela et al. | Recombinant Lactobacillus plantarum NC8 strain expressing porcine rotavirus VP7 induces specific antibodies in BALB/c mice | |
| CN103421729B (en) | Gene recombined swine cholera salmonella choleraesuis vaccine for blue-ear disease and application thereof | |
| CN108517309A (en) | A kind of recombinant lactobacilli and preparation method of expression PRRSV-GP5 albumen | |
| Wan et al. | Immunogenic analysis of two DNA vaccines of avian reovirus mediated by attenuated Salmonella typhimurium in chickens | |
| CN107312736A (en) | Amalgamation and expression IBDV VP2 albumen and Salmonella outer membrane protein RCK recombinant strains of lactic acid bacteria and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |