CN103194470B - Swine transmissible gastroenteritis virus antigen fusion gene and recombinant bacillus megaterium, and their use - Google Patents

Abstract

The invention discloses a swine transmissible gastroenteritis virus antigen fusion gene and recombinant bacillus megaterium, and their use. A Sad sequence of the swine transmissible gastroenteritis virus is connected to an anchor sequence of a streptococcus pyogenes cell wall so that the swine transmissible gastroenteritis virus antigen fusion gene is obtained. The swine transmissible gastroenteritis virus antigen fusion gene has a nucleotide sequence shown in the SEQ ID No.1. The invention further discloses a recombinant expression vector containing the swine transmissible gastroenteritis virus antigen fusion gene and the recombinant bacillus megaterium containing the recombinant expression vector. The recombinant bacillus megaterium is induced by xylose so that the swine transmissible gastroenteritis virus antigen fusion gene can be expressed on the streptococcus pyogenes cell wall surface. A result of a western blot experiment shows that the expressed recombinant protein can react with TGEV immune serum so that it is proved that the expressed recombinant protein has the antigenicity the same as antigenicity of the TGEV natural antigen and thus the expressed recombinant protein can be prepared into a safe and effective mucosal immune live bacterium vaccine for preventing and treating swine transmissible gastroenteritis.

Description

Transmissible gastro-enteritis virus antigen fusion gene and restructuring bacillus megaterium bacterial strain and application

Technical field

The present invention relates to antigen fusion gene and contain the recombinant bacterial strain of this antigen fusion gene, the expression vector that relates in particular to transmissible gastro-enteritis virus antigen fusion gene and contain this antigen fusion gene, the invention further relates to restructuring bacillus megaterium (Bacillus megaterium) bacterial strain and their purposes in preparation control transmissible gastroenteritis of swine vaccine that contain this expression vector, belong to the prevention and control field of transmissible gastroenteritis of swine.

Background technology

Transmissible gastroenteritis of swine is by the caused height contagious disease taking severe diarrhea, vomiting, dehydration and high mortality as principal character of Transmissible gastroenteritis virus (Transmissible gastroenteritis virus of swine, TGEV).TGEV is mainly present in jejunum and duodenum, the equal susceptible of pig of various ages in days.Because piglet self resistibility is poor, be subject to the impact of extraneous various stimuluss and the invasion and attack of pathogenic micro-organism, often can there is death because of serious dehydration, and the highest with interior piglet mortality ratio with 2 week age, can reach 100%.With the increase of age in days, although its mortality ratio declines gradually, infect this sick pig production performance and decline, price of deed rate is low, all brings serious financial loss to worldwide pig industry.Transmissible gastroenteritis virus, mainly by intestinal tract infections pig, has the feature of obvious intestinal tissue preferendum, and in anti-TGEV infection immunity process, except humoral immunization and cellular immunization, local intestinal mucosa immunity system is being brought into play irreplaceable effect.

Conventional inactivated vaccine and attenuated vaccine have played active effect in this disease of control, obtain good effect, but still have some problems, for example: inactivated vaccine immunogenicity is poor, can not effectively induce slgA, and opposing is infected; It is strong etc. that the loose virus of the postvaccinal animal body of attenuated vaccine row, virus virulence may return, in addition also must be by injecting pathway immunity.

TGEV has three kinds of major structural proteins; be respectively Nucleocapsid protein, membranin M and the glycosylated spike protein S of phosphorylation; wherein S glycoprotein carries main bone-marrow-derived lymphocyte epiope; and the process such as absorption, the generation of neutralizing antibody that can mediated cell, can provide effective immanoprotection action.S albumen contains A, B, C, tetra-major antigen sites of D, and wherein A, D site can produce neutrality antibody.

TGEV infects to have and significantly has a liking for intestines, the spike protein (S albumen) on virus particle surface is to infect the most important condition occurring with the combination of the aminopeptidase (APN) that is present in intestinal epithelial cells teleblem, mucosal immunity is the principal character of this disease-specific immunne response, and the height of intestinal mucosa surface SIgA content directly determines generation and the disease severity of clinical disease.

For several features of transmissible gastroenteritis of swine morbidity, adopting oral immunity is comparatively desirable prevention approach.The outstanding advantage of oral immunity is effectively to stimulate enteron aisle local immunity cell to produce secretory IgA, and this is especially adapted to intestinal mucosa transmissible disease, but oral immunity need to overcome, immunogen was degraded before arriving mucous membrane of small intestine or the possibility of deactivation.Transmit intact antigenic component with live vectors such as bacteriophagees and solved this problem, have at present and use the report of attenuated bacteria as the carrier of vaccine antigen, as Salmonellas, weak malicious listeria bacteria etc., but Salmonellas may exist virulence to return strong danger as carrier transfer DNA vaccination, plasmid DNA also may be incorporated into host cell gene group, causes the series of problems such as the expression of genetic disorder, proto-oncogene and cancer suppressor gene of regulating cell growth is out of control, somatocyte canceration, cell transition.

Summary of the invention

One of object of the present invention is to provide the fusion gene in a kind of transmissible gastro-enteritis virus major antigen site and the albumen of coding thereof;

Two of object of the present invention is to provide the recombinant expression vector of the fusion gene that contains above-mentioned transmissible gastro-enteritis virus major antigen site;

Three of object of the present invention provides the recombinant host that contains above-mentioned recombinant expression vector bacterial strain.

To achieve these goals, one aspect of the present invention provides a kind of by pig infectious gastroenteritis virus S ad sequence and streptococcus pyogenes cell walls anchor series (CWA _m6) antigen fusion gene that obtains after linking together, its polynucleotide sequence is shown in SEQ ID No.1.

The present invention is by A, D antigen site (Sad) and streptococcus pyogenes cell walls anchor series (CWA in TGEV S albumen _m6) (taking last 140 amino acid of streptococcus pyogenes M6 albumen as cell walls anchor series) couple together, that considers that bacillus megaterium accesses to your password son has a liking for situation partially, in order to improve the expression of heterologous gene in Host Strains, and ensure in the constant situation of amino acid after translation, rare codon Threonine (ACC) and Isoleucine (ATA), arginine (AGG, CGA) etc. are changed, but do not change its coded amino acid.Point mutation is carried out in 3 sites that methylate (AAC-AAT, ATC-ATT, ACA-ACT) on TGEV S albumin A antigen site.By two flexible Linker ((GGGGS) ₃) by the A of TGEV, D antigen site gene and cell walls anchor series (CWA _m6) couple together that (order is for D-Linker-A-Linker-CWA _m6), the present invention is this sequence called after MLS (SEQ ID No.1).Wherein, introduce respectively Bgl II restriction enzyme site and SphI restriction enzyme site at the upstream and downstream of MLS.

Another aspect of the present invention is to provide the albumen by the coding of fusion gene shown in SEQ ID No.1, and its aminoacid sequence is shown in SEQ ID No.2.

Another aspect of the present invention is to provide the recombinant expression vector that contains described antigen fusion gene, for example, antigen fusion gene shown in SEQ ID No.1 of the present invention is connected with expression vector pHIS1525, and obtaining can be at the secretion expression carrier of the outside surface antigen expressed fusion gene of bacillus megaterium bacterium.

Thus, the restructuring bacillus megaterium that is to provide on the one hand again a strain expression pig infectious gastroenteritis virus S protein of the present invention, can be prepared into the safe and effective mucosal immunity live bacterial vaccines of preventing and treating transmissible gastroenteritis of swine with it.

The present invention carries out fusion gene shown in SEQ ID No.1 double digestion with secretion expression carrier pHIS1525, is connected and proceeds to bacillus megaterium (Bacillus megaterium) WH320 cell through protoplast transformation, the bacillus megaterium called after WH320-pHIS1525-MLS that acquisition contains recombinant plasmid, its microbial preservation number is: CCTCC No:M2011429; Classification And Nomenclature is: bacillus megaterium WH320-pHIS1525-MLS (Bacillus megaterium WH320-pHIS1525-MLS); The preservation time is: on November 27th, 2011; Depositary institution is: Chinese Typical Representative culture collection center; Preservation address is: Wuhan, China Wuhan University.

Further, the present invention induces restructuring bacillus megaterium WH320-pHIS1525-MLS with wood sugar, makes recombinant protein express (recombinant protein of expressing about 26KDa) on bacillus megaterium cell walls surface; Immunoblot experiment shows, expressed recombinant protein can react with TGEV immune serum, showing that recombinant protein is the same with TGEV natural antigen has an identical antigenicity, can be used in the safe and effective mucosal immunity live bacterial vaccines that is prepared into control transmissible gastroenteritis of swine.

The present invention has built WH320-pHIS1525-MLS expression vector system, has expressed and has contained TGEV albumin A/D site and streptococcus pyogenes cell walls anchor series CWAM6 catenation sequence MLS, the about 26kDa of target protein; Western blot test shows, expressed recombinant protein can react with TGEV immune serum, shows that recombinant protein is the same with TGEV natural antigen to have an identical antigenicity.Indirect immunofluorescene assay also confirms that expressing protein is present on thalline, viable bacteria body immunofluorescent test after abduction delivering shows, expressed albumen Primary Location is in the surface of thalline, there is the target protein on thalline surface, for antigenic substance effective stimulus immunity system, improve antibody horizontal and established important basic substance.

The present invention is directed to TGEV occurs and immune several features, the first line of defence infecting taking blocking-up infectious intestinal disease disease pathogen in experimental design is as object, use the bacillus megaterium expression system of safety non-toxic, bacillus megaterium does not produce intracellular toxin, do not produce the outer Sumizyme MP of born of the same parents, be conducive to the stable accumulation of expressed albumen, plasmid is stable, can stability and high efficiency ground expressing protein, be relatively applicable to industrial fermentation and produce.Genus bacillus, after enteron aisle field planting, can consume a large amount of free oxygens simultaneously, causes anaerobic environment, can reduce the field planting of aerophil to enteron aisle.Also be conducive to the growth of the anerobe such as lactobacillus and bifidus bacillus, cause the probiotics in body to increase and pathogenic bacterium minimizing, keep intestinal microecology system balancing.

For check the present invention recombinate bacillus megaterium maybe the expressed fusion rotein MLS of this restructuring bacillus megaterium as the feasibility of control transmissible gastroenteritis of swine oral vaccine, the present invention is by the restructuring bacillus megaterium WH320-pHIS1525-MLS oral immunity mouse building, and different time is measured the level of specific antibody sIgA in enteron stool; Test-results discovery, restructuring bacillus megaterium inducing mouse after continuous 3 immunity has produced the secretion sIgA antibody response of obvious anti-TGEV-S albumen.Recombinant bacterium group later stage sampling antibody rises always, each time point sampling antibody horizontal is all apparently higher than at the beginning of immunity and contrast bacterium (immune empty carrier transformed bacteria WH320-pHIS1525) and PBS group (p<0.05), when recombinant bacterium group 38d, antibody horizontal reaches peak (p<0.05) and declines afterwards, and during to 60d, antibody horizontal is still apparently higher than control group (p<0.05).Test-results shows, the restructuring bacillus megaterium that the present invention is constructed or expressed fusion rotein MLS can effectively stimulate mouse intestinal immunity system to produce specific immune response, can be prepared into the oral vaccine of control transmissible gastroenteritis of swine.

The term definition arriving involved in the present invention

Unless otherwise defined, otherwise all technology used herein and scientific terminology all have with those skilled in the art and conventionally understand identical implication.Although can use any method, device and the material similar or equivalent with person described herein in practice of the present invention or test, describe now preferred method, device and material.

Term " recombinant host bacterial strain " or " host cell " mean the cell that comprises polynucleotide of the present invention, and no matter use which kind of method to insert to produce recombinant host cell, for example, directly absorb, other known method in transduction, f pairing or affiliated field.Exogenous polynucleotide can remain the nonconformity carrier of for example plasmid or can be integrated in host genome.

Term " polynucleotide " or " Nucleotide " mean deoxyribonucleotide, dezyribonucleoside, ribonucleoside or ribonucleotide and the polymkeric substance thereof of sub-thread or bifilar form.Unless specific limited, otherwise the nucleic acid of the known analogue that contains natural nucleotide contained in described term, described analogue has and is similar to the binding characteristic of reference nucleic acid and carries out metabolism in the mode of the Nucleotide that is similar to natural generation.Unless in addition specific limited, otherwise described term also means oligonucleotide analogs, it comprises PNA(peptide nucleic acid(PNA)), in antisense technology DNA analogue (thiophosphatephosphorothioate, phosphamide acid esters etc.) used.Unless otherwise, otherwise specific nucleic acid sequence is also impliedly contained its conservative varient of modifying (including, but is not limited to degenerate codon replaces) and complementary sequence and the clear and definite sequence of appointment.Specific; can realize degenerate codon and replace (people such as Batzer, Nucleic Acid Res.19:5081 (1991) through mixing sequence that base and/or Hypoxanthine deoxyriboside residue replace by producing the 3rd of one of them or one above selected (or all) codon; The people such as Ohtsuka, J.Biol.Chem.260:2605-2608 (1985); With the people such as Cassol, (1992); The people such as Rossolini, Mol Cell.Probes8:91-98 (1994)).

Term " polypeptide ", " peptide " and " albumen " exchange in this article and use to mean the polymkeric substance of amino-acid residue., be equally applicable to describe peptide and describe albumen and vice versa for the description of polypeptide.Described term is applicable to natural generation aminoacid polymers and one of them or aminoacid polymers that more than one amino-acid residue is non-naturally encoded amino acids.As used herein, the amino acid chain of any length contained in described term, and it comprises full-length proteins (being antigen), and wherein amino-acid residue connects via covalency peptide bond.

Brief description of the drawings

Fig. 1 PCR product electrophoresis result.

The enzyme of Fig. 2 expression plasmid pHIS1525 is cut qualification result.

The enzyme of Fig. 3 recombinant plasmid pHIS1525-MLS is cut the qualification result with PCR.

The SDS-PAGE of Fig. 4 expression product analyzes; M: protein molecular weight standard; Protein after 1-3, restructuring bacillus megaterium WH320-pHIS1525-MLS induction; 4, the protein after restructuring bacillus megaterium WH320-pHIS1525 induction.

The indirect immunofluorescene assay (× 40) of Fig. 5 expression product; The IFA test-results of A:WH320-pHIS1525-MLS recombinant bacterium, somatic cells has distributed strong yellow-green fluorescence; The IFA test-results of B:WH320-pHIS1525 recombinant bacterium, does not have fluorescence, and thalline takes on a red color.

Recombinate different time points after bacillus megaterium immune mouse of Fig. 6 is measured the result of antibody sIgA in mouse intestinal ight soil.

Recombinate different time points after bacillus megaterium immune mouse of Fig. 7 is measured the result of antibody sIgA in mouse intestinal ight soil.

Embodiment

Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.But these embodiment are only exemplary, scope of the present invention are not formed to any restriction.It will be understood by those skilled in the art that lower without departing from the spirit and scope of the present invention and can the details of technical solution of the present invention and form be modified or be replaced, but these amendments and replacement all fall within the scope of protection of the present invention.

Structure and the qualification of embodiment 1MLS gene bacillus megaterium secretion expression carrier

1. the design of sequence is with synthetic

Pig infectious gastroenteritis virus S protein contains A, B, C, D totally 4 antigen sites, wherein A(536-593 residue district) and residue district, D(376-392) antigen site produces in neutralizing antibody and play an important role in induction, and Staphylococal Protein A site is a main B cell antigen epi-position, and taking last 140 amino acid of streptococcus pyogenes M6 albumen as cell walls anchor series (CWA _m6), by Sad and CWA _m6connect, Sad can be expressed at bacillus megaterium WH320 cell walls.

By two flexible Linker ((GGGGS) ₃) by the A of TGEV, D antigen site gene and cell walls anchor series (CWA _m6) couple together that (order is for D-Linker-A-Linker-CWA _m6), and this sequence called after MLS.Rare codon Threonine (ACC) and Isoleucine (ATA), arginine (AGG, CGA) etc. are changed, but do not change its coded amino acid.Point mutation is carried out in 3 sites that methylate (AAC-AAT, ATC-ATT, ACA-ACT) on Staphylococal Protein A site, but do not change its coded amino acid, concrete sequence is shown in SEQ ID No.2.Introduce respectively Bgl II restriction enzyme site and SphI restriction enzyme site at the upstream and downstream of MLS.The MLS sequence designing (SEQ ID No.1) is carried out to synthetic, built recombinant plasmid pMD18-MLS; PMDl8-T Simple Vector is purchased from TaKaRa (Dalian) company, and the concrete building process of pMD18-MLS is as follows:

Pcr amplification goal gene

In PCR reaction tubes, add following reagent and solution:

The PCR reaction system of table 1MLS

P1：5'-GA AGA TCT ATGTCTGTAAGTGATTCAAGCT3'；

P2：5'-ACAT GCA TGC GTTTTCTTCTTTGCGTTTTAC3'

Mix and centrifugal after be positioned in PCR instrument, after 94 DEG C of denaturation 5min, circulate as follows: 94 DEG C, 30s; 54 DEG C, 30s; 72 DEG C, 30s.30 rear 72 DEG C of extension 10min of circulation.After pcr amplification completes, get 5 μ L products l% agarose gel electrophoresis and observe.And reclaim test kit specification sheets recovery enzyme with reference to DNA gel and cut product, reclaiming test kit specification sheets with reference to DNA gel and reclaim PCR reaction product, operation steps is as follows:

By 100 μ L PCR products electrophoresis in 1% sepharose, under UV-lamp, cut the sepharose that contains target DNA, add the DE-A solution (for DNA gel reclaims the reagent in test kit) of 3 gel volumes, after mixing in 75 DEG C of heating and melting.The DE-B solution (for DNA gel reclaims the reagent in test kit) that adds 0.5 DE-A volume, mixes.Get above mixed solution, be transferred to DNA and prepare and centrifugally in pipe abandon filtrate.Put back centrifuge tube by preparing pipe, add 0.5ml Wl solution (for DNA gel reclaims the reagent in test kit), the centrifugal 30s of 12000rpm, abandons filtrate.Put back centrifuge tube by preparing pipe, add 0.7ml W2 solution (for DNA gel reclaims the reagent in test kit), the centrifugal 30s of 12000rpm, abandons filtrate, repeats this step once.Put back in centrifuge tube the centrifugal 1min of 12000rpm by preparing pipe.Be placed in clean 1.5ml centrifuge tube by preparing pipe, add in right amount (20 μ L) water or elutriant room temperature and leave standstill 1min, the centrifugal 1min eluted dna of 12000rpm preparing film centre.Fetch to receive in product 1 μ L1% sepharose and carry out electrophoresis, detect and reclaim result.And save backup in-20 DEG C.

PCR product is connected and conversion with cloning vector

Pressing pMDl8-T Simple Vector specification sheets is connected the PCR product reclaiming with pMDl8-T Vector.Linked system is in table 2:

Table 2 ligation system

Mix rear centrifugally, be placed in 16 DEG C of water-baths and connect 4h, 4 DEG C are spent the night.After connection, the plasmid called after pMD18-MLS that contains MLS sequence.

The structure of 2 recombinant expression vectors

The vector plasmid pHIS1525(plasmid pHIS1525 of pMD18-MLS plasmid and secreting, expressing is purchased to MoBiTec company) respectively with reclaiming after Bgl II+SphI double digestion, use T ₄dNA ligase couples together and is built into recombinant plasmid pHIS1525-MLS.

The enzyme of 2.1MLS sequence is cut and is reclaimed

Endonuclease reaction system is in table 3.

Table 3Bgl II, SphI double digestion reaction system

100 μ L enzymes are cut to product electrophoresis in 1% sepharose, and reclaim test kit specification sheets recovery enzyme with reference to DNA gel and cut product, reclaim test kit specification sheets reclaim PCR reaction product with reference to DNA gel, operation steps is as follows:

By 100 μ L PCR products electrophoresis in 1% sepharose, under UV-lamp, cut the sepharose that contains target DNA, add the DE-A solution of 3 gel volumes, after mixing in 75 DEG C of heating and melting.The DE-B solution that adds 0.5 DE-A volume, mixes.Get above mixed solution, be transferred to DNA and prepare and centrifugally in pipe abandon filtrate.Put back centrifuge tube by preparing pipe, add 0.5ml Wl solution, the centrifugal 30s of 12000rpm, abandons filtrate.Put back centrifuge tube by preparing pipe, add 0.7ml W2 solution, the centrifugal 30s of 12000rpm, abandons filtrate, repeats this step once.Put back in centrifuge tube the centrifugal 1min of 12000rpm by preparing pipe.Be placed in clean 1.5ml centrifuge tube by preparing pipe, add in right amount (20 μ L) water or elutriant room temperature and leave standstill 1min, the centrifugal 1min eluted dna of 12000rpm preparing film centre.Fetch to receive in product 1 μ L1% sepharose and carry out electrophoresis, detect and reclaim result.And save backup in-20 DEG C.

100 μ L enzymes are cut to product electrophoresis in 1% sepharose, reclaim enzyme and cut product, fetch to receive in product 1 μ L1% sepharose and carry out electrophoresis, detect and reclaim result, the big or small about 780bp(Fig. 1 that conforms to expected results of nucleotide fragments).

The enzyme of the carrier pHIS1525 of 2.2 bacillus megaterium secreting, expressings is cut and is reclaimed

A large amount of enzymes of the carrier pHIS1525 of bacillus megaterium secreting, expressing are cut, and endonuclease reaction system is in table 4.

Table 4Bgl II, SphI double digestion reaction system

100 μ L enzymes are cut to product electrophoresis in 1% sepharose, and reclaim test kit specification sheets recovery enzyme with reference to DNA gel and cut product, more than concrete steps reference, fetch to receive in product 1 μ L1% sepharose and carry out electrophoresis, electrophoresis result is shown in Fig. 2.

The structure of 2.3MLS gene bacillus megaterium secretion expression carrier

Enzyme prepared by above step is cut purified product and is connected, and linked system is in table 5.

The carrier pHIS1525 ligation system of table 5MLS gene secreting, expressing

16 DEG C of water-baths connect after 4h, and 4 DEG C are spent the night.

Connect the purifying of product: connection product is transferred in 1.5ml centrifuge tube, add the 3mol/L sodium-acetate (pH5.2) of 2.0 μ L and the dehydrated alcohol of 50 μ L to mix gently, be placed in after-20 DEG C, 1h, 4 DEG C, the centrifugal 30min of 12000rpm, carefully remove supernatant, add 70% ethanol of 500 μ L, 4 DEG C, the centrifugal 5min of 12000rpm, carefully remove supernatant, air-dry extremely without ethanol smell, add 4 μ L sterilizing deionized water dissolving precipitations ,-20 DEG C save backup.

2.4pHIS1525-MLS the double digestion of plasmid, PCR qualification:

(1), by above-mentioned reclaimed plasmid, with Bgl II, SphI double digestion, endonuclease reaction system is in table 6:

The double digestion reaction system of table 6pHIS1525-MLS plasmid

Mix gently above component, 37 DEG C of water-bath 4h, get 5 μ L enzymes and cut product 1% agarose gel electrophoresis and observe.Can cut out object fragment and pHIS1525 carrier plasmid identification of the same size is positive.

(2) by 100 times of sterile purified water dilutions for above extracted plasmid, get 2 μ L as template, carry out PCR qualification, can amplify the plasmid identification conforming to object clip size positive.

Fetch to receive in product 1 μ L1% sepharose and carry out electrophoresis, detect and reclaim result, big or small about 780bp(Fig. 3 that conforms to expected results of nucleotide fragments), oneself is inserted between the restriction enzyme site Bgl II, SphI of expression vector pHIS1525 to show MLS gene, by the positive recombinant plasmid called after pHIS1525-MLS obtaining.By the positive recombinant bacterial strain called after WH320-pHIS1525-MLS bacterial strain obtaining.

The recombinate Expression and Identification of bacillus megaterium MLS gene of embodiment 2

1 bacillus megaterium protoplastis preparation

Picking one encircles bacillus megaterium (Bacillus megaterium) WH320(and is purchased from MoBiTec company) at the flat lining out of LB, 37 DEG C of incubated overnight, from the single colony inoculation of above-mentioned dull and stereotyped picking one to 1*AB3 liquid nutrient medium, 200r/min37 DEG C of incubated overnight; Get above-mentioned seed liquor 1ml and proceed to the 250ml triangular flask that 50ml1*AB3 substratum is housed, 200r/min37 DEG C is cultured to the centrifugal collection thalline of OD600 ≈ 1.0, adds 5ml SMMP solution suspension thalline; Bacterium liquid is proceeded in 100ml triangular flask, and adding final concentration is the N,O-Diacetylmuramidase of 0.1mg/ml, puts 37 DEG C of water bath heat preservation 30min, uses the formation of microscopic examination protoplastis therebetween, is advisable in the half left and right that is formed on of protoplastis; Centrifugal 10min collects protoplastis, with appropriate SMMP buffer solution elution once, finally use 5ml SMMP solution suspension thalline.

2 Bacillus megaterium protoplast transformation

Get 100 μ L protoplastiss in 1.5ml EP pipe, add successively approximately 1 μ g recombinant expression vector plasmid, 300 μ L pEG-P, under room temperature, be incubated 2min; Add 1ml SMMP solution slowly to mix; Under room temperature, the centrifugal 10min of 3000r/min, removes supernatant liquor gently, now generally can't see any precipitation; Add 500 μ L SMMP solution in EP pipe, put 37 DEG C and cultivate 90min; 2.5mlCR5-top top-layer agar is placed in to 60 DEG C of water-baths (this agar 5ml centrifuge tube dress) for subsequent use; After 90min, get the CR5-top top-layer agar that bacterium liquid in 200 μ L above-mentioned steps is added to preheating in advance, after mixing, be poured into (containing 10 μ g/ml tsiklomitsins) on LB flat board, with glass rod coating evenly, 37 DEG C of overnight incubation.Meanwhile, transform as positive control by above step using the empty carrier (WH320-pHIS1525) that does not contain goal gene.

Abduction delivering and the qualification of 3 restructuring bacillus megaterium MLS genes

WH320-pHIS1525 and WH320-pHIS1525-MLS inoculation 10ml LB liquid nutrient medium, 37 DEG C of thermal agitation overnight incubation, be inoculated in 50ml LB liquid and carry out amplification cultivation with 5% inoculum size respectively again, after cultivating 4h, take out one bottle of WH320-pHIS1525-MLS as the sample before inducing, all the other add final concentration is 0.2% wood sugar induction 6-9h, get respectively before engineering bacteria WH320-pHIS1525-MLS induction, 6-9h supernatant liquor and positive control bacterial strain (WH320-pHIS1525) supernatant liquor 6ml after induction, after the acetone precipitation of 4 times of volumes, obtain supernatant liquor albumen, after adding 40 μ L2 × loading buffer to mix, boil after 5min, centrifuging and taking 20 μ L supernatant liquors carry out SDS-PAGE electrophoresis detection.

Result shows, restructuring bacillus megaterium WH320-pHIS1525-MLS has the band of expression at about 26kDa place, goal gene has obtained effectively expressing (Fig. 4 in engineering bacteria, 2nd～3 bands), along with the increase of induction time, in supernatant liquor, the content of target protein also progressively increases, and does not contain target protein in positive control bacterium supernatant liquor.

The immune marking (western-blot) of 4 expression products is analyzed

Gel after above-mentioned electrophoresis is finished through transfer device by protein delivery to the nitrocellulose filter through transfer printing damping fluid balance, switch on power, 0.5-1mA/cm ²transfer printing 1h.After transfer printing finishes, the anti-TGEV serum of rabbit is as first antibody, and using horseradish peroxidase-labeled goat anti-rabbit igg as second antibody, the 20min that develops the color in the chloro-1-naphthols of 4-substrate chromophoric solution, detects the antigenic activity of expression product.

Detect and show that recombinant protein has the ability that the antiserum(antisera) prepared with TGEV totivirus reacts by Western-blot, and there is good specificity, i.e. reactionogenicity (Fig. 4, the 4th band).

5 indirect immunofluorescences

Get positive recombinant bacterium and centrifugal the going after supernatant of empty carrier contrast bacteria liquid culture 0.5mL that 12h cultivates, wash 3 times with PBS low-speed centrifugal respectively, add the anti-TGEV antiserum(antisera) in rabbit source, suspend and mix rear 37 DEG C of effect 30min, the centrifugal supernatant that goes, PBS is centrifugal washes thalline 3 times, add the anti-rabbit fluorescent mark that contains Evans Blue two of dilution anti-, suspend and mix rear 37 DEG C of effect 30min, the centrifugal supernatant that goes, PBS is centrifugal washes thalline 3 times, bacterial sediment thing is suspended in 200 μ L PBS, get appropriate smear, seasoning, cold acetone is fixed 30min, fluorescence microscope after dry.

Contrast with WH320-pHIS1525-MLS recombinant bacterium and WH320-pHIS1525 the indirect immunofluorescence experiment that bacterium was carried out.Result shows that the visible significantly yellow-green fluorescence (Fig. 5) of recombinant bacterium WH320-pHIS1525-MLS fluorescence microscopy also shows, the expressed foreign protein of recombinant bacterium is present in the surface location of thalline thus; WH320-pHIS1525 does not find green fluorescence, and thalline is dyed to redness.

The immune protection effectiveness test of test example 1 transmissible gastroenteritis of swine restructuring bacillus megaterium

1, test method

1.1 strains tested

The recombinant bacterium WH320-pHIS1525-MLS that embodiment 1 obtains;

1.2 laboratory animal grouping and immunity

30 of laboratory animal: body weight 18-20g, 6-8 clean level BALB/c mouse in age in week, purchased from Animal Experimental Study center, Hubei Province.

Immunity group: laboratory animal is divided into 3 groups at random, 10 every group, i.e. recombinant bacterium group (WH320-pHIS1525-MLS), contrast bacterium (WH320-pHIS1525) group and PBS control group, recombinant bacterium group and every mouse of contrast bacterium group are with 2 × 10 ¹⁰individual/mL bacterium oral vaccination 0.1mL, the PBS liquid of the oral same volume of PBS control group.

Immune programme for children: immunity 3 times, every immunity in 2 weeks once, each continuous immunity 3d, every day 1 time.

1.3 sample collectings and processing

Collect immune mouse fresh excreta sample respectively at 18d, 32d, 38d, 46d, 60d.-70 DEG C frozen for subsequent use.

Faecal samples processing: before detection, every 0.1g ight soil adds 1mL ight soil extracting solution, is placed on vibrator, vibration 30min, and 4 DEG C of infiltrations are spent the night.The centrifugal 5min of 10000r/min, collects supernatant as detecting sample.

1.4 immune mouse ight soil specificity sIgA measure

Employing indirect ELISA method carries out.With 37 DEG C of reaction 2h of the antigen coated 96 hole polystyrene micro plate of TGEV totivirus, 0.01mol/L PBST liquid is washed 3 times.With 37 DEG C of sealing 4h of the 0.01mol/L PBS liquid that contains 0.5% polyvinyl alcohol, 0.01mol/L PBST liquid is washed 3 times.Add respectively the ight soil supernatant of handling well, 37 DEG C of reaction 1h, 0.01mol/L PBST washes 3 times.The HRP mark sheep anti mouse IgA(that adds 1:2000 dilution is purchased from magnificent biotechnology company limited), 37 DEG C of reaction 1h, 0.01mol/LPBST liquid is washed 3 times.Add OPD-H ₂o ₂substrate nitrite ion lucifuge colour developing 15min.Add after stop buffer, enzyme mark determinator is measured the photoabsorption (OD in every hole at wavelength 492nm place automatically ₄₉₂) value.

2 test-results

Test-results is shown in Fig. 6, Fig. 7 and table 7.Restructuring bacillus megaterium WH320-pHIS1525-MLS inducing mouse after continuous 3 immunity has produced the secretion sIgA antibody response of obvious anti-TGEV-S albumen.Recombinant bacterium group later stage sampling antibody rises always, each time point sampling antibody horizontal is all apparently higher than at the beginning of immunity and contrast bacterium group and PBS group (p<0.05), when recombinant bacterium group 38d, antibody horizontal reaches peak (p<0.05), decline afterwards, during to 60d, antibody horizontal is still apparently higher than control group (p<0.05).There is not significant difference in the mouse of immunity empty carrier transformed bacteria WH320-pHIS1525 and negative control group mouse secretion property sIgA antibody horizontal before and after immunity.

From test-results, the present invention bacillus megaterium of recombinating can effectively stimulate mouse intestinal immunity system to produce specific immune response, has proved the feasibility of bacillus megaterium as oral vaccine of recombinating using the present invention.

The table 7 bacillus megaterium immune mouse specificity sIgA measurement result of recombinating

Note: * represents the sampling of recombinant bacterium group later stage and relatively (P<0.05) of sampling in 0 day; # represents recombinant bacterium group and contrasts bacterium and relatively (P<0.05) of PBS group.

<110> transmissible gastro-enteritis virus antigen fusion gene and restructuring bacillus megaterium bacterial strain and application

<120> Wuhan Huayang Animal Pharmaceutical Co., Ltd.

<130> DQXL-0012

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 768

<212> DNA

<213> artifical sequence

<220>

<221> CDS

<222> (1)..(768)

<400> 1

aug tct gta agt gat tca agc ttt ttt agt tac ggt gaa att ccg ttc 48

Met Ser Val Ser Asp Ser Ser Phe Phe Ser Tyr Gly Glu Ile Pro Phe

1 5 10 15

ggc gta act gat gga cca cgt tac tgt tac ggt ggc ggt ggc tct ggc 96

Gly Val Thr Asp Gly Pro Arg Tyr Cys Tyr Gly Gly Gly Gly Ser Gly

20 25 30

gga ggt ggg agc ggc ggt ggt ggc agc ggt atg aag cgt agt ggt tat 144

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Met Lys Arg Ser Gly Tyr

35 40 45

ggt caa cct ata gcc tca aca tta agt aat att act cta cca atg cag 192

Gly Gln Pro Ile Ala Ser Thr Leu Ser Asn Ile Thr Leu Pro Met Gln

50 55 60

gat cac aac acc aca gat gta tac tgt att cgt tct gac caa ttt tca 240

Asp His Asn Thr Thr Asp Val Tyr Cys Ile Arg Ser Asp Gln Phe Ser

65 70 75 80

gtt tat gtt cat tct act tgc aaa agt gct tta tgg gac aat att ttt 288

Val Tyr Val His Ser Thr Cys Lys Ser Ala Leu Trp Asp Asn Ile Phe

85 90 95

aag cga aac tgc acg ggt ggc ggt ggc tct ggc gga ggt ggg agc ggc 336

Lys Arg Asn Cys Thr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

100 105 110

ggt ggt ggc agc aaa gct tta gaa gaa gca aac agc aaa tta gct gct 384

Gly Gly Gly Ser Lys Ala Leu Glu Glu Ala Asn Ser Lys Leu Ala Ala

115 120 125

ctt gaa aaa ctt aac aaa gag ctt gaa gaa agc aag aaa tta aca gaa 432

Leu Glu Lys Leu Asn Lys Glu Leu Glu Glu Ser Lys Lys Leu Thr Glu

130 135 140

aaa gaa aaa gct gag cta caa gca aaa ctt gaa gca gaa gca aaa gca 480

Lys Glu Lys Ala Glu Leu Gln Ala Lys Leu Glu Ala Glu Ala Lys Ala

145 150 155 160

ctc aaa gaa caa tta gcg aaa caa gct gaa gaa ctt gca aaa cta aga 528

Leu Lys Glu Gln Leu Ala Lys Gln Ala Glu Glu Leu Ala Lys Leu Arg

165 170 175

gct gga aaa gca tca gac tca caa acc cct gat gca aaa cca gga aac 576

Ala Gly Lys Ala Ser Asp Ser Gln Thr Pro Asp Ala Lys Pro Gly Asn

180 185 190

aaa gtt gtt cca ggt aaa ggt caa gca cca caa gca ggt aca aaa cct 624

Lys Val Val Pro Gly Lys Gly Gln Ala Pro Gln Ala Gly Thr Lys Pro

195 200 205

aac caa aac aaa gca cca atg aag gaa act aag aga cag tta cca tca 672

Asn Gln Asn Lys Ala Pro Met Lys Glu Thr Lys Arg Gln Leu Pro Ser

210 215 220

aca ggt gaa aca gct aac cca ttc ttc aca gcg gca gcc ctt act gtt 720

Thr Gly Glu Thr Ala Asn Pro Phe Phe Thr Ala Ala Ala Leu Thr Val

225 230 235 240

atg gca aca gct gga gta gca gca gtt gta aaa cgc aaa gaa gaa aac 768

Met Ala Thr Ala Gly Val Ala Ala Val Val Lys Arg Lys Glu Glu Asn

245 250 255

<210> 2

<211> 256

<212> PRT

<213> artifical sequence

<400> 2

Met Ser Val Ser Asp Ser Ser Phe Phe Ser Tyr Gly Glu Ile Pro Phe

1 5 10 15

Gly Val Thr Asp Gly Pro Arg Tyr Cys Tyr Gly Gly Gly Gly Ser Gly

20 25 30

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Met Lys Arg Ser Gly Tyr

35 40 45

Gly Gln Pro Ile Ala Ser Thr Leu Ser Asn Ile Thr Leu Pro Met Gln

50 55 60

Asp His Asn Thr Thr Asp Val Tyr Cys Ile Arg Ser Asp Gln Phe Ser

65 70 75 80

Val Tyr Val His Ser Thr Cys Lys Ser Ala Leu Trp Asp Asn Ile Phe

85 90 95

Lys Arg Asn Cys Thr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

100 105 110

Gly Gly Gly Ser Lys Ala Leu Glu Glu Ala Asn Ser Lys Leu Ala Ala

115 120 125

Leu Glu Lys Leu Asn Lys Glu Leu Glu Glu Ser Lys Lys Leu Thr Glu

130 135 140

Lys Glu Lys Ala Glu Leu Gln Ala Lys Leu Glu Ala Glu Ala Lys Ala

145 150 155 160

Leu Lys Glu Gln Leu Ala Lys Gln Ala Glu Glu Leu Ala Lys Leu Arg

165 170 175

Ala Gly Lys Ala Ser Asp Ser Gln Thr Pro Asp Ala Lys Pro Gly Asn

180 185 190

Lys Val Val Pro Gly Lys Gly Gln Ala Pro Gln Ala Gly Thr Lys Pro

195 200 205

Asn Gln Asn Lys Ala Pro Met Lys Glu Thr Lys Arg Gln Leu Pro Ser

210 215 220

Thr Gly Glu Thr Ala Asn Pro Phe Phe Thr Ala Ala Ala Leu Thr Val

225 230 235 240

Met Ala Thr Ala Gly Val Ala Ala Val Val Lys Arg Lys Glu Glu Asn

245 250 255

Claims (3)

1. strain restructuring bacillus megaterium (Bacillus megaterium) bacterial strain, is characterized in that, its microbial preservation number is: CCTCC No:M2011429.

2. the purposes of restructuring bacillus megaterium bacterial strain claimed in claim 1 in preparation control transmissible gastroenteritis of swine vaccine.

3. according to purposes claimed in claim 2, it is characterized in that: described vaccine is mucosal immunity live bacterial vaccines.