CN1449831A - DNA vaccine pVPS2 for SARS virus - Google Patents

Abstract

The present invention relates to the field of medicinal biological engineering technology, and is a DNA vaccine pVPS2 for preventing SARS virus. It is composed of SARS virus S protein antigenic determinant code sequence and signal peptide code sequence of plasminogen activator TPA to form secreted S protein antigenic determinant code sequence S2-P and inserting it into the eukaryotic expression vector. Said recombinant plasmid transformed competence colibacillus DH5 alpha is the pVPS2 engineering bacterium which can be used for preparing vaccine pVPS2. Because its expressed antigenic protein can be secreted to the exterior of cell, so that it can raise immunity of body fluid, and can have better action for preventing infection of SARS virus.

Description

A kind of SARS virus dna vaccination pVPS2

Technical field:

The present invention relates to the medical bioengineering technical field, is a kind of dna vaccination pVPS2 that is used to prevent the Serious Atypica Respiratory Syndrome SARS virus.

Background technology:

World Health Organization (WHO) is with Serious Atypica Respiratory Syndrome (Severe Acute Respiratory Syndrome; SARS) be called for short the Sa Si disease, and be confirmed to be the infectious disease that a kind of SARS virus (SARS coronavirus) causes.Still needleless is to the specific drug of SARS virus at present, and it is imperative to develop effective preventative vaccine.Dna vaccination is the new generation vaccine that rises in recent years, has antibody titer and holds time long and advantage such as cross protection is effective.Dna vaccination also has following outstanding advantage in addition: (1) can bring out body fluid and the comprehensive immunne response of cell, plays preventive effect; (2) the immunoprotection time is long; (3) simple, with low cost, good stability of production technology and storing are convenient.

Summary of the invention:

The invention provides a kind of SARS virus dna vaccination pVPS2, can be used for preventing people's Serious Atypica Respiratory Syndrome.Its mechanism of action is: SARS virus surface antigen S 2 antigen encoding sequences are inserted carrier for expression of eukaryon, it is injected in muscular tissue, make it at myocyte's invading the exterior da virus surface antigen,, can activate intravital immunity system and cell immune system through the angtigen presentation process.Activated immunity system can produce special antibody, eliminates the virus that is free in the blood, the invasion of prevention SARS virus; And activated cell immune system can produce cellulotoxic lymphocyte (CTL), attacks infected cells, eliminates the SARS virus of hiding.

Known at present, S albumen is the glycoprotein that is present in the SARS virus surface, and receptors bind, cell fusion when participating in the poisoning intrusion cell are the major antigens of virus.Gene in known SARS virus CUHK-W1 (GENEBANKnumber:AY278554), HKU-39849 (GENEBANK number:AY278491), BJ01 (GENEBANKnumber:AY278488), BJ02 (GENEBANK number:AY278487), BJ03 (GENEBANK number:AY278490), BJ04 (GENEBANK number:AY279354), the GZ01 strains such as (GENEBANK number:AY278489) has high homology.Their S gene basic structure is: total length 3768bp, 1255 the amino acid whose maturation proteins of encoding.

SS2DNA,：TCTACTGAATGTGCTAATTTGCTTCTCCAATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCTCAGGTATTGCTGCTGAACAGGATCGCAACACACGTGAAGTGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAAAGCCAACTAAGAGGTCTTTTATTGAGGACTTGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTCATGAAGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAAGTTCAATGGACTTACAGTGTTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACACTGCTGCTCTAGTTAGTGGTACTGCCACTGCTGGATGGACATTTGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATGCAAATGGCATATAGGTTCAATGGCATTGGAGTTACCCAAAATGTTCTCTATGAGAACCAAAAACAAATCGCCAACCAATTTAACAAGGCGATTAGTCAAATTCAAGAATCACTTACAACAACATCAACTGCATTGGGCAAGCTGCAAGACGTTGTTAACCAGAATGCTCAAGCATTAAACACACTTGTTAAACAACTTAGCTCTAATTTTGGTGCAATTTCAAGTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGAGGCGGAGGTACAAATTGACAGGTTAATTACAGGCAGACTTCAAAGCCTTCAAACCTATGTAACACAACAACTAATCAGGGCTGCTGAAATCAGGGCTTCTGCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTCTTGGACAATCAAAAAGAGTTGACTTTTGTGGAAAGGGCTACCACCTTATGTCCTTCCCACAAGCAGCCCCGCATGGTGTTGTCTTCCTACATGTCACGTATGTGCCATCCCAGGAGAGGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATACTTCCCTCGTGAAGGTGTTTTTGTGTTTAATGGCACTTCTTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAATAATTACTACAGACAATACATTTGTCTCAGGAAATTGTGATGTCGTTATTGGCATCATTAACAACACAGTTTATGATCCTCTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGGACAAGTACTTCAAAAATCATACATCACCAGATGTTGATCTTGGCGACATTTCAGGCATTAACGCTTCTGTCGTCAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTCGCTAAAAATTTAAATGAATCACTCATTGACCTTCAAGAATTGGGAAAATAA

In view of the signal peptide of people TPA (plasminogen activator) has protein precursor is transported to cell membrane, signal peptide is cut afterwards, maturation protein just is secreted into extracellular function, so it is connected on S2 coded sequence front end, the SARS virus secreting type S proteantigen determinant coded sequence of being formed abbreviates S2-P as, thereby the antigen protein of its expression can be secreted into the extracellular improves humoral immunization greatly, plays the effect of better prophylaxis of viral infections.

The preparation method of SARS virus dna vaccination pVPS2 of the present invention is as follows:

1. synthetic SARS virus secreting type S2 proteantigen determinant coded sequence S2-P:(sees nucleotide

Sequence table 1)

A) sequence signature

Length: 1509bp

Type: nucleic acid

Chain number: two strands

Geometry: linearity

B) molecule type: DNA

C) source: synthetic

D) sequence description: secreting type S proteantigen determinant coded sequence S2-P: ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTT CGTTTCGCCCAGCCAGGAAATCCATGCCCGATTCAGAAGAGGAGCCAGATCTGAAT TCTCTACTGAATGTGCTAATTTGCTTCTCCAATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCTCAGGTATTGCTGCTGAACAGGATCGCAACACACGTGAAGTGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAAAGCCAACTAAGAGGTCTTTTATTGAGGACTTGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTCATGAAGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAAGTTCAATGGACTTACAGTGTTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACACTGCTGCTCTAGTTAGTGGTACTGCCACTGCTGGATGGACATTTGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATGCAAATGGCATATAGGTTCAATGGCATTGGAGTTACCCAAAATGTTCTCTATGAGAACCAAAAACAAATCGCCAACCAATTTAACAAGGCGATTAGTCAAATTCAAGAATCACTTACAACAACATCAACTGCATTGGGCAAGCTGCAAGACGTTGTTAACCAGAATGCTCAAGCATTAAACACACTTGTTAAACAACTTAGCTCTAATTTTGGTGCAATTTCAAGTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGAGGCGGAGGTACAAATTGACAGGTTAATTACAGGCAGACTTCAAAGCCTTCAAACCTATGTAACACAACAACTAATCAGGGCTGCTGAAATCAGGGCTTCTGCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTCTTGGACAATCAAAAAGAGTTGACTTTTGTGGAAAGGGCTACCACCTTATGTCCTTCCCACAAGCAGCCCCGCATGGTGTTGTCTTCCTACATGTCACGTATGTGCCATCCCAGGAGAGGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATACTTCCCTCGTGAAGGTGTTTTTGTGTTTAATGGCACTTCTTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAATAATTACTACAGACAATACATTTGTCTCAGGAAATTGTGATGTCGTTATTGGCATCATTAACAACACAGTTTATGATCCTCTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGGACAAGTACTTCAAAAATCATACATCACCAGATGTTGATCTTGGCGACATTTCAGGCATTAACGCTTCTGTCGTCAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTCGCTAAAAATTTAAATGAATCACTCATTGACCTTCAAGAATTGGGAAAATAA

Wherein, underlined sequence is people's signal coding sequence of TPA, altogether 114bp; 5 ' end Be Hind III restriction enzyme site; 3 ' end It is Xho I restriction enzyme site.

2. prepare dna vaccination pVPS2:

With restricted enzyme Hind III and Xho I respectively to above-mentioned synthetic dna fragmentation S2-P and carrier for expression of eukaryon pVAX1 (available from Invitrogen company, sequence and physical map are seen the catalogue of the said firm) carry out double digestion, endonuclease bamhi reclaims through the agarose gel electrophoresis purification respectively.Then above-mentioned pVAX1 carrier endonuclease bamhi is mixed by a certain percentage with the S2-P endonuclease bamhi, connect by ligase, with CaCl ₂Method is converted into it in competence bacillus coli DH 5 alpha (available from GIBLCO company), obtains transformant on the kanamycin flat board, screens.The positive transformant that screens is the engineering bacteria of reorganization pVPS2, and this project bacterium can be used for preparing dna vaccination pVPS2.

Dna vaccination of the present invention is the recombiant plasmid of carrier for expression of eukaryon pVAX1 and S2-P dna fragmentation.This recombiant plasmid contains cytomegalovirus promoter PCMV, the SARS virus secreting type S proteantigen determinant coded sequence S2-P of pUC ori plasmid replication initiation site, kalamycin resistance gene Kanamycin, a complete eukaryotic transcription translation unit and the polyadenylic acid BGH pA of 3 ' end.

Dna vaccination preparation technology of the present invention is simple, with low cost, but can express S2-P antigen and activated lymphocyte in eukaryotic cell.The antigen protein of its expression can be secreted into the extracellular, thereby improves humoral immunization greatly, and the effect of prophylaxis of viral infections is stronger.

Description of drawings

Fig. 1: be the structural representation of SARS virus dna vaccination pVPS2 of the present invention

Fig. 2: be the structure flow chart of SARS virus dna vaccination pVPS2 of the present invention

The specific embodiment:, preparation method of the present invention is described in detail below in conjunction with embodiment.

The preparation of embodiment 1:SARS virus DNA vaccine pVPS2

Dna vaccination pVPS2 structure is seen Fig. 1, makes up flow process and sees Fig. 2.

1. synthetic S2-P DNA sequence (structure as previously mentioned), its 5 ' end contains Hind III restriction enzyme site 3 ' end contains Xho I restriction enzyme site

2. make up the recombiant plasmid of pVPS2:

With restricted enzyme Hind III and Xho I the S2-P dna fragmentation is carried out double digestion.Reaction system is: S2-P dna fragmentation 5 μ l (200ng/ μ l); 10 * M Buffer (100mM Tris-Hcl pH7.5; 100mM MgCl ₂10mM Dithionthreitol; 500mM NaCl) 2 μ l; Hind III enzyme (10U/ μ l) 1 μ l; Xho I enzyme (12U/ μ l) 1 μ l; Mend H ₂O is to cumulative volume 20 μ l.37 ℃ of temperature are bathed digestion 2 hours.Afterwards sample digestion is carried out 1% LMP agarose gel electrophoresis, cut glue and reclaim the S-P endonuclease bamhi.Simultaneously, with Hind III and Xho I double digestion pVAX1 carrier.Reaction system is: pVAX1 carrier 2 μ l (200ng/ μ l); 10 * M Buffer (100mM Tris-Hc1 pH7.5; 100mM MgCl ₂10mM Dithionthreitol; 500mM NaCl) 2 μ l; Hind III enzyme (10U/ μ l) 1 μ l; Xho I enzyme (12U/ μ l) 1 μ l; Mend H ₂O is to cumulative volume 20 μ l.37 ℃ of temperature are bathed digestion 2 hours.Afterwards sample digestion is carried out 1% low melting-point agarose gel electrophoresis, cut glue and reclaim the pVAX1 endonuclease bamhi.

Above-mentioned pVAX1 endonuclease bamhi is mixed with the S2-P endonuclease bamhi, connect with ligase.The coupled reaction system is: pVAX1 endonuclease bamhi 0.5 μ l (200ng/ μ l); S2-P endonuclease bamhi 1 μ l (50ng/ μ l); Connect Buffer (660mM Tris-Hcl pH7.6; 66mM MgCl ₂100mM DTT; 1mM ATP) 1 μ l; T4 dna ligase 1 μ l (5U/ μ l) mends H2O to cumulative volume 10 μ l.The condition of coupled reaction is: 12 ℃ 10 hours.

3. make up the pVPS2 engineering bacteria:

With above-mentioned coupled reaction product with CaCl ₂Method is converted in the competence bacillus coli DH 5 alpha and (sees for details: molecular cloning experiment guide, the third edition, Science Press, 2002): connect product 10 μ l and DH5 α (1～2 * 10 ⁹The competent cell 200 μ l of antibacterial/ml) mix, and ice bath was placed 30 minutes, 42 ℃ 2 minutes, ice bath 10 minutes adds 0.6ml 2YT fluid medium (16g peptone/L; 10g yeast extract/L; 5g NaCl/L), 37 ℃ of cultivations were laid on the agar plate that contains kanamycin after 45 minutes.Cultivate after 12 hours for 37 ℃ and transformant on agar plate, occurs.Select transformant and be seeded in 37 ℃ of overnight incubation in the 3ml 2YT culture medium that contains 100 μ g/ml kanamycin, 6,000rpm/ minute centrifugal collection thalline extracts plasmid DNA with plasmid a small amount of extraction agent box (Qiagen).Identify with Hind III and Xho I double digestion then.Reaction system is: recombiant plasmid 1 μ l (200ng/ μ l); 10 * M Buffer (100mM Tris-Hcl pH7.5; 100mM MgCl ₂10mM Dithionthreitol; 500mM NaCl) 2 μ l; Hind III enzyme (10U/ μ l) 1 μ l; Xho I enzyme (12U/ μ l) 1 μ l; Mend H ₂O is to cumulative volume 20 μ l.37 ℃ of temperature are bathed digestion 2 hours.Afterwards sample digestion is carried out 1% agarose gel electrophoresis, the big fragment of pVAX1 carrier of the S2-P fragment of the visible 1509bp of result and 2.9kb.Illustrate that this positive transformant that screens is the engineering bacteria of reorganization pVPS2.

4.SARS the preparation of virus DNA vaccine pVPS2

Dna vaccination of the present invention prepares with above-mentioned recombinant strain.Training method is a liquid culture.Adopt the capable high density suspension of bacterial fermentation jar aerobic culture.Select for use 2 * YT (to contain 1.6% tryptone, 1% yeast extract and 0.5% sodium chloride, PH7.0).Add the mineral wet goods during fermentation as defoamer.Cultivation temperature is 37 ℃, and incubation time is 14 hours.

Separation and purification plasmid DNA from the engineering bacteria after the amplification adopts conventional method (molecular cloning experiment guide, the third edition, Science Press, 2002).Concrete operations are as follows:

(50mM glucose, 25mM Tris-Cl pH8.0 10mMEDTA) split the vibration mixing by force to add the 800mL solution I in the wet bacterium of 100g.Add freshly prepared 1L solution II (0.2N NaOH, 1%SDS) vertical soft mixing, room temperature 5 minutes.The vertical soft mixing of 0.75L solution III (1M potassium acetate, 7M ammonium acetate pH4.8) that adds the ice pre-cooling again, ice bath 5 minutes.12000 rev/mins of 4 ℃ of centrifuging and taking supernatants of Continuous Flow.In supernatant, added 1.53L isopropyl alcohol room temperature 10 minutes, the centrifugal precipitation of staying of 12000 rev/mins of room temperatures of Continuous Flow.Adding 70% ethanol 450ml rinsing spends the night.10000 rev/mins 4 ℃ were stayed precipitation in centrifugal 10 minutes.Add 1L PBS (pH7.4) dissolving, add 65 ℃ of digestion of RNaseA (final concentration 0.1%, magnificent biological engineering company limited) 30 minutes.Add isopyknic PEG solution (PEG8000 13%, sodium chloride 1.6M) precipitation again, 12000 rev/mins 4 ℃ centrifugal 10 minutes, stay precipitation.200ml PBS dissolution precipitation adds 1% volume Triton X114 mixing, ice bath 5-10 minute, 37 ℃ 30 minutes, 37 ℃ 12000 rev/mins centrifugal 10 minutes, get the upper strata water.Use the double-deck filter membrane pressure filtration of 0.45 μ m and 0.22 μ m at last, be diluted to 1mg/ml, be SARS virus dna vaccination pVPS2, can be used for intramuscular injection with the PBS buffer.

Certainly, make up pVPS2 and also can adopt other carrier for expression of eukaryon, as pCDNA3.

1SARSSS2-P AAGCTTATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGC CCAGCCAGGAAATCCATGCCCGATTCAGAAGAGGAGCCAGATCTGAATTCTCTACTGAATGTGCTAATTTGC TTCTCCAATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCTCAGGTATTGCTGCTGAACAGGATCGCAACACACGT GAAGTGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATT ACCTGACCCTCTAAAGCCAACTAAGAGGTCTTTTATTGAGGACTTGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCT TCATGAAGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAAGTTCAATGGACTTACA GTGTTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACACTGCTGCTCTAGTTAGTGGTACTGCCACTGCTGGATG GACATTTGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATGCAAATGGCATATAGGTTCAATGGCATTGGAGTTACCC AAAATGTTCTCTATGAGAACCAAAAACAAATCGCCAACCAATTTAACAAGGCGATTAGTCAAATTCAAGAATCACTTACA ACAACATCAACTGCATTGGGCAAGCTGCAAGACGTTGTTAACCAGAATGCTCAAGCATTAAACACACTTGTTAAACAACT TAGCTCTAATTTTGGTGCAATTTCAAGTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGAGGCGGAGGTACAAA TTGACAGGTTAATTACAGGCAGACTTCAAAGCCTTCAAACCTATGTAACACAACAACTAATCAGGGCTGCTGAAATCAGG GCTTCTGCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTCTTGGACAATCAAAAAGAGTTGACTTTTGTGGAAAGGG CTACCACCTTATGTCCTTCCCACAAGCAGCCCCGCATGGTGTTGTCTTCCTACATGTCACGTATGTGCCATCCCAGGAGA GGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATACTTCCCTCGTGAAGGTGTTTTTGTGTTTAATGGC ACTTCTTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAATAATTACTACAGACAATACATTTGTCTCAGGAAATTG TGATGTCGTTATTGGCATCATTAACAACACAGTTTATGATCCTCTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGG ACAAGTACTTCAAAAATCATACATCACCAGATGTTGATCTTGGCGACATTTCAGGCATTAACGCTTCTGTCGTCAACATT CAAAAAGAAATTGACCGCCTCAATGAGGTCGCTAAAAATTTAAATGAATCACTCATTGACCTTCAAGAATTGGGAAAAT AACTCGAG

Claims (3)

1. SARS virus dna vaccination pVPS2; SS2-P,S2-P：AAGCTTATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCCAGGAAATCCATGCCCGATTCAGAAGAGGAGCCAGATCTGAATTCTCTACTGAATGTGCTAATTTGCTTCTCCAATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCTCAGGTATTGCTGCTGAACAGGATCGCAACACACGTGAAGTGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAAAGCCAACTAAGAGGTCTTTTATTGAGGACTTGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTCATGAAGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAAGTTCAATGGACTTACAGTGTTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACACTGCTGCTCTAGTTAGTGGTACTGCCACTGCTGGATGGACATTTGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATGCAAATGGCATATAGGTTCAATGGCATTGGAGTTACCCAAAATGTTCTCTATGAGAACCAAAAACAAATCGCCAACCAATTTAACAAGGCGATTAGTCAAATTCAAGAATCACTTACAACAACATCAACTGCATTGGGCAAGCTGCAAGACGTTGTTAACCAGAATGCTCAAGCATTAAACACACTTGTTAAACAACTTAGCTCTAATTTTGGTGCAATTTCAAGTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGAGGCGGAGGTACAAATTGACAGGTTAATTACAGGCAGACTTCAAAGCCTTCAAACCTATGTAACACAACAACTAATCAGGGCTGCTGAAATCAGGGCTTCTGCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTCTTGGACAATCAAAAAGAGTTGACTTTTGTGGAAAGGGCTACCACCTTATGTCCTTCCCACAAGCAGCCCCGCATGGTGTTGTCTTCCTACATGTCACGTATGTGCCATCCCAGGAGAGGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATACTTCCCTCGTGAAGGTGTTTTTGTGTTTAATGGCACTTCTTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAATAATTACTACAGACAATACATTTGTCTCAGGAAATTGTGATGTCGTTATTGGCATCATTAACAACACAGTTTATGATCCTCTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGGACAAGTACTTCAAAAATCATACATCACCAGATGTTGATCTTGGCGACATTTCAGGCATTAACGCTTCTGTCGTCAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTCGCTAAAAATTTAAATGAATCACTCATTGACCTTCAAGAATTGGGAAAATAACTCGAG。

2. by the described SARS virus dna vaccination of claim 1 pVPS2, it is characterized in that said carrier for expression of eukaryon is pVAX1.

3. claim 1 or the 2 described SARS virus dna vaccination pVPS2 purposes that is used to prevent Serious Atypica Respiratory Syndrome.

Images