CN101014698A - Conserved inner core lipopolysaccharide epitopes as multi-species vaccine candidates - Google Patents

Abstract

A conserved inner-core oligosaccharide epitope expressed on the lipopolysaccharide (LPS) of a range of disease causing pathogenic bacterial isolates, including Actinobacillus pleuropneumoniae (Ap), Mannheimia haemolytica (Mh) and Pasteurella multocida (Pm), is disclosed. Construction of a mutant bacterial strain exclusively expressing the conserved inner core OS epitope as a terminally exposed structure has allowed the identification, production and isolation of an inner core LPS which is common to all three organisms. Further provided are associated vaccines, antibodies raised against the conserved LPS inner core and glycoconjugates comprising the LPS inner core linked to an immunogenic carrier.

Description

Conservative property kernel lipopolysaccharide epitopes as multiple vaccine candidate object

Technical field

The present invention relates to beasts bacterial pathogen lipopolysaccharides (LPS), it comprises one or more epi-positions of the kernel oligosaccharides part of described LPS.The present invention identifies the conservative property epi-position of expressing on the LPS of some pathogenic strain isolateds of beasts bacterial pathogen, described pathogenic strain isolated includes but not limited to actinobacillus pleuropneumoniae (Actinobacillus pleuropneumoniae, Ap), hemolytic Man bacillus (Mannheimia haemolytica, Mh) and pasteurella multocida (Pasteurellamultocida, Pm).

Background technology

Bacterial pathogen is the very big reason of financial loss in the commercial farm running, also is the very big reason of health problem of the animal population (comprising the mankind) of very big scope.The three kind modal bacterial pathogens relevant with veterinary disease be hemolytic Man bacillus (pasteurella haemolytica, Mh), actinobacillus pleuropneumoniae (Ap) and pasteurella multocida (Pm).Mh mainly is the pathogenic agent of ox and sheep, and Ap is a porcine pathogen, and Pm is the pathogenic agent that a plurality of species comprise poultry, domestic animal and pig, simultaneously also is that dog and the cat mankind that bite cause the virulence factor that infects.In a word, they can be diseases induced, causes the very big financial loss of animal breeding.

Current measure comprises uses vaccine or the simple live strain of modifying as vaccine.Because effect is good inadequately, and the undesirable action occurrence probability is higher, these methods are not entirely satisfactory.

Do not have any vaccine can provide at present at these three bacterial classifications---infection that Mh, Ap and Pm cause stride the bacterial classification protection.Vaccine at these pathogenic bacterium is extremely useful.The vaccine method that tackles the disease that is caused by Mh still mainly is based on vaccine and the attenuated strain that lives.The Mh antigen of having introduced secretion in the nearest living vaccine or having extracted is as neuraminidase, leukotoxin, sialoglycoprotein enzyme, adventitia and Unidentified albumen.Leukotoxin conventionally is being main subunit vaccine material standed for always, but the mutant strain of use expressing non-toxicity leukotoxin carries out immunization excites calf that still part is poisonous in the model (calf challenge model), and leukotoxin can not produce the protective immunne response when uniting use with capsular polysaccharide.Comparatively speaking, but LPS has demonstrated the stabilized leukocyte lytic activity, so can bring hope [Li, J., and K.D.Clinkenbeard.1999.Infect.Immun.67:2920-2927] based on the combined vaccine of LPS and detoxification leukotoxin.

The vaccine method that tackles the disease that is caused by Ap at present is based on attenuated strain alive, contains highly unsettled Apx toxin in them, and this toxin can be induced the required neutralizing antibody of protection.As if these Apx toxin have formed the basis at the main subunit vaccine of Ap, but can only induce the clinical protection of part.Someone proposes adhesin (core os that comprises LPS) as the vaccine candidate object [VanOverbeke I., et al.2003.J.Vet.Med.B.Infect.Dis.Vet.PublicHealth.50:289-2 93] that improves.At present the vaccine of prevention pig Pm disease is made up of toxoid and somatic antigen such as pod membrane and outer membrane protein.Pasteur (Pasteur) shows that at first Pm can cause the fowl cholera of chicken, is to utilize the Pm attenuated strain to this sick preventive means at present.Yet in general,, can not provide cross protection, so this means are subjected to very big restriction to other serotypes because this immunne response remains the serotype restriction.Yet the LPS that has shown Pm plays partial action in the immunity of infecting.

Accumulated suitable evidence and shown from the LPS of each in these biologies it all may is the good candidate of subunit vaccine design.Shown that LPS is visible and a main antigenic determinant on the Mh surface, helped phagolysis by A1 LPS inductive mAb and be helpless to external the killing and wounding [Wilson, C.F., et al.1992.Vet.Microbiol.31:161-168] of complement-mediated.

For Pm, the fowl cholera that rrna-LPS vaccine protection chicken class is avoided being caused by homology Pm bacterial strain infects [Phillips, M., and R.B.Rimler.1984.Am.J.Vet.Res.45:1785-1789].In addition, use the LPS-albumen composition that mouse is carried out immunization, this immunization can provide 100% protection when using homologous strain to attack mouse, yet when separately using, the one-component of this mixture can't provide protection.LPS inductive MAb from Pm can only provide the part protection in mouse model, although they have conditioning phagocytosis, do not have germicidal action in the presence of complement.Yet in another experiment, can protect mouse to avoid homology fully at the mAb of PmLPS and attack, and have germicidal action [Wijewardana, T.G., et al.1990.J.Med.Microbiol.33:217-222].A kind of simulation can play a protective role when it is subjected to the homology biological attack in mouse model from the antiidiotype vaccine of the LPS of A type.

In Ap, LPS, the nuclear district of the LPS that more specifically says so is relevant with the adhesive capacity of this bacterium.The combined vaccine that BSA is connected with Ap serotype 1 LPS can be attacked and can not attack the back in allos and protect mouse in homology; show the sugar moieties of the Ap cell walls [Fenwick that in the pig immunne response, plays an important role from the combined vaccine of the smooth type of serotype 5 and 1 and rough type Ap LPS; B., and B.I.Osburn.1986.Infect.Immun.54:583-586].

Under this background, the biology on the interested animal doctor comprise the sugar moieties that the surface exposes, and can be considered as vaccine candidate object.These sugar moieties comprise LPS and capsular polysaccharide.Capsular polysaccharide is the repeating unit of several carbohydrate residues, and directly is connected with bacterium surface, and LPS is made of following three districts: the lipid A district, and it links to each other the LPS molecule by fatty acid residue with bacterium surface; Bao Shou nuclear oligosaccharides district relatively, it is that variable polysaccharide antigen (O-antigen) links to each other with lipid A district and the 3rd district.Heterogeneity can be got rid of them usually between the bacterial strain of pod membrane and O-o antigen polysaccharide o from economically viable vaccine candidate object, because they are only effective to homologous strain.Molecular genetics, analysis of the molecular structure and immunochemical latest developments provide strong tool, make us can discern the sugared structure that can be used as the material standed for vaccine antigen.

Lipopolysaccharides (LPS) is the important surface exposure antigen that characteristics are also arranged very much among Mh, Ap and the Pm.(as discussed above, term used herein " lipopolysaccharides " and " LPS " are contained short chain lipopolysaccharides and fat oligosaccharides (LOS)).The Pm bacterial strain is expressed the heterogeneous lower molecular weight LPS of many groups, and these LPS show antigen diversity widely on a plurality of oligosaccharides epi-positions, and Mh and Ap bacterial strain had both produced lower molecular weight LPS, also produced the conventional LPS that has O-antigen polymkeric substance.The LPS of applicant Mh described here, Ap and Pm sugar structure can provide a kind of source of protective antigen when being with suitable form (for example as protein conjugate) when passing host immune system.In applicant's research, LPS is proved and can be used as vaccine candidate object, this is because unexpectedly identify a kind of like this carbohydrate antigen of surface expression, the oligosaccharides epi-position that they have is being stablized in the heredity and on the physiology, conservative in the bacterial strain of this scope, in three bacterial classification Mh, Ap or Pm, can enter host's purge mechanism.

The sugar district of the LPS molecule of Mh, Ap and Pm discerns for host immune system target is provided.Determine that its structure is very crucial for the biology of the LPS that understands Mh, Ap and Pm and the effect in bacterial virulence thereof.The LPS of Mh, Ap and Pm comprises the heterogeneous mixture of molecule, and described molecule is by the lipid A part of variable oligosaccharides part, film grappling and also have polymeric O-antigen to constitute under the situation of some Mh and Ap bacterial strain.Based on experiment described herein, developed the structural models of the LPS of Mh, Ap and Pm, this structural models is made up of conservative four-heptose base-two-glucosyl kernel portion, this part is attached to the lipid A part by the sad residue of phosphorylation ketone deoxidation (Kdo), and finds that it all exists in each bacterial strain of being studied at present and guards.

Find out obviously that from structural analysis absolute conservative max architecture is shown in following structure I in these three bacterial classifications.

Structure I

Wherein Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid, and Hep is a heptose, and Glc is a glucose, and P is a phosphoric acid ester, and lipid A (Lipid A) is a toxicide.

For antigen is used as vaccine development, must satisfy four important criterion.Be candidate antigens the immunogenicity epi-position must:

I) stable in the heredity;

Ii) all conservative in all relevant clinically bacterial strains of these bacterial classifications;

Iii) can enter (external and body in) host immune mechanism; And

Iv) can induce protection antibody in vivo.

The present invention has identified and has shown the conservative property LPS sugar epi-position that satisfies most of these standards.

I) genetic stability: in the genome bacterial strain (two Pm strains, a Mh strain, two Ap strains) of three bacterial classifications, identified and relate to the biosynthetic gene of conservative property kernel oligosaccharides.The different related gene of outer core variation that these bacterial classifications show has been found to be the existence of variation ground, and these data have been used the structured data conclusive evidence of genome bacterial strain and other bacterial strains of each bacterial classification.Structurally guard yet structure and genetic analysis (seeing Table A) all show inner core, this is owing to always there is the biosynthetic gene of known responsible kernel.

Table A. the glycosyltransferase of the conservative property kernel LPS of beasts pathogenic agent

Ribosyltransferase in the conservative property in the beasts pathogen gene group bacterial strain

Gene	Pm-3480	Pm70	Ap_1	Ap_5	Mh
						kdtA	Contig49e -155*	PM1305e -155	Contig25e -129	ap93i1204e -128	Contig164e -126
opsX	contig49e -145	PM1320e -152	Contig24e -111	ap93i0300e -108	Contig165e -116
						rfaF	Contig68e -165	PM1844e -165	Contig25e -153	ap93i0451e -154	Contig81e -155
orfH	Contig28e -132	PM1294e -132	Contig24e -83	ap93i0686e -120	Contig109e -132
						lgtF	Contig49e -110	PM1306e -110	Contig24e -110	ap93i0684e -114	Contig109e -116
lbgB	Contig59e -inf	PM1144e -inf	Contig29e -98	ap93i1369e -98	Contig147e -89

* use from the kernel LPS glycosyltransferase of hemophilus influenzae (Haemophilus influenzae) bacterial strain WK-20 (Rd) beasts pathogen gene group is carried out the e value that obtains after the Blast computing, what wherein use except lbgB is from the genomic PM1144 of Pm70.

Genomic data is available from Baylor College of Medicine, Houston (Mh); Department of Microbiology and Immunology, Laboratory for Genomicsand Bioinformatics, Oklahoma University Health SciencesCenter (Pm-3480 and Ap1); Institute for Biological Sciences, National Research Council, Ottawa, Canada (Ap5); ComputationalBiology Centre, University of Minnesota (Pm70).

Ii) structure conservative property: in each bacterial strain that up to the present applicant studied, this four-heptose base-two-glucosyl part always is contained in the following structural element (structure I I):

Structure I I

Wherein :-R is H or phosphorylethanolamine (PEtn), P is a phosphoric acid ester, R ' and R " are that H or oligonucleotide chain extend; preferably do not comprise β-D-Galp-(1-7)-D-α-D-Hepp-(1-6); R  is an O-antigen variable among the Ap; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid, and lipid A (Lipid A) is a toxicide.

Table B: the structure of conserved regions and variable region in the nuclear oligosaccharides of the LPS of beasts pathogenic agent hemolytic Man bacillus (Mh), actinobacillus pleuropneumoniae (Ap) and pasteurella multocida (Pm).

Bacterial classification	Bacterial strain/serotype	R’	R”	R
					Mh	A1	H	β-D-Galp-(1-7)-D-α-D-Hep Vp-(1-	H
	A8	H	D-α-D-Hep Vp-(1-	H
						SH1217	H	β-D-Galp(1-7)-D-α-D-Hep Vp-(1-	H
					Ap	1	(1S)-GalaNAc-(1-4，6)-α-D-Gal -(1-3)-β-D-Gal-(1-	H	H
	2	β-D-Glc-(1-	D-α-D-Hep V-(1-	H
						5a	H	D-α-D-Hep V-(1-	H
	5b	H	D-α-D-Hep V-(1-	H
Pm	Pm70	β-D-Glc-(1-	α-D-GalpNAc-(1-3)-β-D-GalpNAc- (1-3)-α-D-Gal-(1-4)-β-D-Gal- (1-4)-β-D-Glc(1-	PEtn
						VP161	PCho-3-β-D-Gal-(1-	PCho-3-β-D-Gal(1-	H
	X73	(PEtn-6)-PCho-3-β-D-Gal-(1-	(PEtn-6)-PCho-3-β-D-Gal-(1-	H

For Pm, heptose residue Hep ^IVIt is L-α-D configuration.Equally in Pm, Hep ^I6 α-Pu Taotang residue in minority sugar type, lack, be attended by the structure difference of Kdo residue simultaneously,

On this moment 4 of Kdo is not P-R, but second Kdo residue.

First heptose residue (Hep ^I) be a unique heptose residue that demonstration is extended from this residue generation nuclear oligosaccharides in all three bacterial classification Ap, Mh and Pm.Outer core extends from Hep ^IVResidue further extends.In all bacterial classifications, all do not observe from Hep ^IIOr Hep ^IIIThe nuclear oligosaccharides extend.In Ap serotype 5, found from Hep ^IIIThe O-antigen that residue takes place extends [St.Michael, F.et.al.2004, Carbohydr.Res., 339:1973-1984], does not demonstrate the position that O-antigen among the Mh is attached to core os.Do not observe the antigen polymer repeat unit among the Pm.Shown that four genes relate to the antigenic biosynthesizing of O-in the Ap serotype 1, comprised rfbP and rfbU, their sudden change can produce does not have the antigenic Ap bacterial strain of O-[Labrie, J.et al.2002, J.Endotox.Res., 8:27-38].The kernel of all three bacterial classifications all can further be replaced by the phosphorylethanolamine residue, can be at the Hep of Pm bacterial strain Pm70 ^II3 of residue also can be at the Kdo-P residue among all bacterial classification AP, Mh and the Pm.In Pm, a few species LPS sugar type demonstrates has two Kdo residues rather than Kdo-P or Kdo-P-PEtn part, and the existence while of second Kdo residue is with the disappearance of kernel α-Glc residue.Between the inside of three bacterial classifications being studied and them, all observe the outer core variation.In Ap serotype 1, use NMR that outer core is extended into row structural characterization fully, show that the end of oligosaccharides extension (1S)-GalaNAc-(1-4,6)-α-Gal-(1-3)-p-Gal contains rare open chain N-acetylgalactosamine.This structure also can be known by inference from the mass spectrum of serotype 9 and 11.In Ap serotype 2, find Hep ^IVResidue is replaced by β-Glc residue two at 4,6 by D, D-α-Hep ^VResidue two replaces.In Ap serotype 5, has only D, D-α-Hep ^VResidue replaces Hep ^IVThe similar outer core of observing in Mh and being found in Ap serotype 5 extends, second D wherein, D-α-Hep ^VThis is replaced residue by β-Gal residue in 7.In Pm, the research of two serotypes, 1 bacterial strain VP 161 and X73 has been disclosed unusual outer core extended, wherein Hep ^IVResidue is replaced by β-Gal residue symmetry at 4 and 6, they itself replaced by the phosphorylcholine part is single at 3 again, perhaps except the phosphorylcholine residue, also have phosphorylethanolamine residue (X73) 6 of β-Gal residue.Another research to gene order-checking bacterial strain Pm70 shows Hep again ^IVResidue is replaced by two at 4 and 6.Replaced by β-glucosyl residue at 4, at 6 by uncommon pentasaccharide

α-GalNAc-(1-3)-β-GalNAc-(1-3)-α-Gal-(1-4)-β-Gal-(1-4)-β-Glc replaces.

Iii) accessibility: since this inner core is always expressed in these three bacterial classifications, so understand fully that following problem is extremely important, always promptly this inner core epi-position is come-at-able and guard on conformation, and no matter how outer core, O-antigen and other structure of cell surface make a variation.For realizing this purpose, this conservative property structure need be processed to end structure, and should end with the glycosyltransferase target, to expose this structure.Utilize the complete genome sequence of Pm bacterial strain Pm70 and to the understanding completely (seeing embodiment 3) of this bacterial strain LPS structure, the biosynthetic glycosyltransferase of Pm70 LPS structure is responsible in identification in can helping to test.Also comprise second Pm bacterial strain (P-3480), two Ap bacterial strains (serotype 1 and 5) and these other genome sequences of a Mh bacterial strain (serotype A 1), and utilize bioinformatics method identification that the target gene of mutagenesis takes place.Select Mh strains A 1 to carry out mutagenesis research, this is because the antigenic amount of O-that exists in this biology is compared lowly with Ap, thereby can not disturb subsequently immune Research.As follows, at a) Mh strains A 1 and b) all identify candidate's glycosyltransferase in the Ap serotype 1.

Homologue [the Tull ius of haemophilus ducreyi (H.ducreyi) lbgA galactotransferase gene, M.V.et al 2002, Infect.Immun.70:2853-2861] discern in Ap by mini-Tn10 transposon generation mutagenesis, it is relating to [Galarneau between biosynthetic two genes of nuclear oligosaccharides, C.et al 2000, Pathogenesis, 1:253-264].Adjacent gene lbgB demonstrates and sizable homology from the D-glycerine-D-sweet dew-heptose transferring enzyme of haemophilus ducreyi among the Ap.(Baylor College Houston) carries out Blast and analyzes the lbgB gene order of use Ap, discloses the homologue that two adjacent D-glycerine-D-sweet dew-heptose transferring enzymes are arranged in the Mh genome sequence to the Mh genome sequence.The best lbgB homologue of being discerned is by inference for being responsible at first L-glycerine-D-sweet dew-heptose residue (Hep ^I) extension on add first D-glycerine-D-sweet dew-heptose residue (Hep ^IV) D-glycerine-D-sweet dew-heptose transferring enzyme, so we infer that second homologue (we are called losB) is to be responsible for adding second D-glycerine-D-sweet dew-heptose residue (Hep ^V) D-glycerine-D-sweet dew-heptose transferring enzyme.

Utilize the Protocols in Molecular Biology of standard that this gene is undergone mutation, the LPS that mutant strain produces identifies through structure and shows, obtained the conservative property inner core (seeing embodiment 7) of institute's target.Induce mAb and pAb, with the conservative property of check this structure in the bacterial strain of the certain limit of these beasts pathogenic agent and the degree of accessibility at this kernel LPS structure.The polyclonal serum that is obtained can with each LPS and full cell generation cross reaction among these three bacterial classification Mh, Ap and the Pm.Obtained four kinds of mAb (G3, G8, E8 and D8) from a fusions, their specificitys are at the kernel conformation that is presented on the full cell of Mh.Three kinds of mAb (3-4,3-5 and 3-16) from another fusions, have been obtained, cross reaction can take place with the LPS of all bacterial strains of studying of Ap, Pm and Mh in them, thereby set up the possibility of conservative property cross reactivity LPS epi-position total between these the three kinds important beasts pathogenic agent.Produce ascites by four kinds among these mAb (G3, G8,3-5 and 3-16), use full cell ELISA to detect, demonstration is come-at-able by the LPS epi-position of these mAb identifications on full cell, thereby proves that this conservative property kernel epi-position is come-at-able on cell surface.And mAb G3 and G8 are helping passive protection, and showing in vivo can be near this inner core.

Iv) functional antibodies: contain can with the polyclonal serum of the antibody of the LPS cross reaction of the bacterial classification of being studied, and mAb G8 and G3 can help the dissolving of the Mh cell of complement-mediated.Carry out passive protection research in perfect Mh mice infected model, showing provides the specificity can preventing disease at the mAb (G3 and G8) of this conservative property kernel LPS structure among the Mh.At last, prepared, used this combined vaccine to carry out collecting mice serum after the immunization this conservative property sugar structure and the combined vaccine that carrier proteins HSA is connected, find this serum can with the LPS and the cell generation cross reaction entirely of these three bacterial classifications of being studied.

Summary of the invention

The invention provides the vaccine, vaccine component and the application thereof that are suitable for providing immunizing power, described immunizing power relates to the B cell activation molecule from beasts bacterial pathogen lipopolysaccharides (LPS), and described molecule comprises one or more epi-positions of the kernel oligosaccharides part of this lipopolysaccharides.The LPS of the content recognition disclosed herein and the pathogenic strain isolated of the certain limit that has characterized the beasts bacterial pathogens goes up the epi-position of expressing, and described pathogenic strain isolated is including but not necessarily limited to actinobacillus pleuropneumoniae (Ap), hemolytic Man bacillus (Mh) and pasteurella multocida (Pm).This paper has discerned the subunit antigen of determining that is applicable to the preparation vaccine.Antigen as vaccine candidate object preferably is presented in bacterium surface with its state of nature, but so that at the immunne response of this vaccine antigen target live organism subsequently.

We have found that and prepare the total kernel LPS of all three kinds of organisms.Shown that LPS has immunity to each of these beasts pathogenic agent, if LPS antigen is conservative on conformation, immunne response may be discerned homology and allos bacterial strain even bacterial classification so.

The structural analysis data show that all these beasts pathogenic agent all have a common conservative property kernel OS structure.Therefore the possibility based on the vaccine of LPS is explored in decision.

The first step of this process is to make up the mutant strain of only expressing conservative property kernel OS epi-position with the form of ends exposed structure.This research produces α-1 from Mh strains A 1, and the mutant of 6-D-glycerine-D-sweet dew-heptose transferase gene is so that present conservative property kernel epi-position with the form of ends exposed part.

Induce mAb and pAb, with the conservative property of check this structure in the bacterial strain of the certain limit of these beasts pathogenic agent and the degree of accessibility at this kernel LPS structure.Obtained three kinds of mAb, cross reaction can take place with the LPS of all bacterial strains of studying of Ap, Pm and Mh in them, thereby has set up the possibility of conservative property cross reactivity LPS epi-position total between these the three kinds important beasts pathogenic agent.

Full cell ELISA analysis shows that these LPS epi-positions can be discerned by mAb, thereby prove that this kernel epi-position is come-at-able on cell surface on full cell.The mAb of identification kernel oligosaccharides can help the bactericidal properties dissolving of the Mh cell of complement-mediated.Carry out passive protection research in perfect Mh mice infected model, showing provides the specificity can preventing disease at the mAb of this conservative property kernel LPS structure.At last, prepared, used this combined vaccine to carry out collecting mice serum after the immunization this conservative property sugar structure and the combined vaccine that carrier proteins HSA is connected, find this serum can with these three bacterial classification generation cross reactions of being studied.

On the one hand, the invention provides a kind of lipopolysaccharides part, comprise not containing conservative property two-glucosyl-four-heptose base kernel that variable outer core oligonucleotide chain extends.

On the other hand, the invention provides a kind of lipopolysaccharides part, comprise conservative property two-glucosyl-four-heptose base kernel portion with following structure I I.

Structure I I

Wherein :-R is H or phosphorylethanolamine (PEtn), P is a phosphoric acid ester, R ' and R " are that H or oligonucleotide chain extend; preferably do not comprise β-D-Galp-(1-7)-D-α-D-Hepp-(1-6); R  is an O-antigen variable among the Ap; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid, and lipid A (Lipid A) is a toxicide.

On the other hand, the invention provides a kind ofly, comprise a kind of in the above-mentioned lipopolysaccharides part for the animal host provides immunogenic composition at the protection of the disease that is caused by Mh, Ap or Pm.

On the other hand, the invention provides the application of at least a gene in the lipopolysaccharides of preparation Mh, Ap or Pm in the LPS biosynthetic pathway, in order to obtain to comprise a kind of mutant strain in the above-mentioned lipopolysaccharides part.

On the other hand, the invention provides at least a immunogenicity epi-position and inducing at the application in the functional cross-reacting antibody of Mh, Ap or Pm, wherein said epi-position comprises a kind of in the above-mentioned lipopolysaccharides part.

On the other hand, the invention provides a kind of functional antibodies, cross reaction can take place at Mh, Ap or Pm in this antibody, and this antibody is by a kind of inductive in the above-mentioned lipopolysaccharides part.

On the other hand, the invention provides the method for a kind of preparation at the functional cross-reacting antibody of Mh, Ap or Pm, this method comprises: (a) produce at a kind of antibody in the above-mentioned lipopolysaccharides part, (b) antibody is tested at multiple Mh, Ap and Pm bacterial strain, (c) selected cross-reactive antibody.

On the other hand, the invention provides and a kind ofly at infected the disease that causes by Mh, Ap or Pm the host is carried out the method for immunization, this method comprises that the above-mentioned immunogenic composition with immune significant quantity gives the host.

Following conservative property kernel LPS structure is discerned in Mh, Ap and Pm.This structure can be used as the effective vaccine candidate object of all bacterial strains.All three bacterial classifications all have this unexpected discovery of this identical structure unit, make it possible to prepare many Stock Vaccines based on this conservative property structure.

Wherein :-R is H or phosphorylethanolamine (PEtn), P is a phosphoric acid, R ' and R " are that H or oligonucleotide chain extend; preferably do not comprise β-D-Galp-(1-7)-D-α-D-Hepp-(1-6); R  is an O-antigen variable among the Ap; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid, and lipid A (Lipid A) is a toxicide.

The structural analysis of carrying out in order to characterize these conservative property structures in each bacterial classification is described in detail in embodiment 1 (Mh), embodiment 2 (Ap) and embodiment 3～5 (Pm).Embodiment 1 has described the structural analysis of serotype A 1 LPS of pasteurella haemolytica.Embodiment 2 has described the structural analysis from the LPS of several Ap serotypes, at first identifies the inner core molecule sibship structurally of Mh and Ap thus.Embodiment 3 has described the structural analysis from the LPS of the genome bacterial strain of Pm, has at first discerned the structure conservative property of the inner core molecule of all three bacterial classifications thus.Embodiment 4 has described the structural analysis of the LPS of Pm bacterial strain VP161.Embodiment 5 has described the structural analysis of the nuclear oligosaccharides of Pm strain X 73.Embodiment 6 has described the identification to Hep II heptose transferring enzyme of the orfH gene, Hep III of Pm.Embodiment 7 has described the generation of the conservative D-glycerine LPS structure, the hemolytic Man bacillus-D-sweet dew-heptose transferring enzyme mutant that demonstrates the beasts pathogen specific, and at the exploitation and the cross reactivity thereof of the antibody of this LPS structure.Embodiment 8 has described and has utilized generation and the research of this conservative property kernel LPS molecule as the sugared combined vaccine of sugar moieties.Embodiment 9 has described the sterilization experiment data of using kernel monoclonal antibody specific and polyclonal serum to obtain.Embodiment 10 has described the passive protection experimental data of using the kernel monoclonal antibody specific to obtain.Generally speaking, these embodiment show that these kernel lipopolysaccharide epitopes can be used as vaccine candidate object, in order to the disease of preventing to be caused by the bacterial classification that comprises this inner core in the LPS molecule.

The vaccine that is made of capsular polysaccharide can effectively prevent the human diseases that has capsular bacterium to cause by homologous.Because lacking T cell dependency replys, the immunogenicity of these carbohydrate antigen in human body is relatively poor usually.Yet by with specific polysaccharide antigen and the associating of suitable protein carrier, the immunogenicity of carbohydrate antigen can have very big raising with respect to polysaccharide itself.Based on the sugared combined vaccine of b type hemophilus influenzae (Hib) and c type meningococcus (Neisseria meningitidis) (for example: ProHiBit, MenC) verifiedly can successfully control invasive Hib and meningococcosis.

Common way is that conservative property kernel LPS molecule is united with the appropriate carriers molecule by rights, so that the immunne response of bringing out expectation after the host is carried out immunization.

Immunogenic carrier albumen preferably is selected from tetanus toxin/toxoid, diphtheria toxin/toxoid (CRM197), toxicide Pseudomonas aeruginosa (P.aeruginosa) toxin A, Toxins,exo-, cholera/toxoid, Toxins, pertussis/toxoid, clostridium perfringens (Clostridium perfringens) extracellular toxin/toxoid, hepatitis B surface antigen(HBsAg), hepatitis B core antibody, rotavirus vp 7 albumen, respiratory syncytial virus F and G albumen or other appropriate carriers.

Adjuvant preferably is selected from freund's adjuvant, alum and Ribi, perhaps acceptable adjuvant in other any pharmacy.

In one embodiment of the invention, provide a kind of method of inducing or strengthening the immunizing power of animal, fish or birds directed toward bacteria venereal disease substance, comprised giving conservative property kernel LPS molecule.In some cases, described bacterial pathogen is Man bacillus (Mannheimia), actinobacillus (Actinobacillus) or pasteurellosis bacillus (Pasteurella).In some instances, described bacterial pathogen is the organism among the interested animal doctor.Administration can be undertaken by any suitable approach, comprises injection, is applied to mucous membrane, applied dermally, oral (preferably suitably dressing) or the like.In some instances, kernel LPS molecule is connected or combination with the appropriate carriers molecule.In some instances, also use suitable adjuvant.In some instances, kernel LPS and antimicrobial drug or other immune stimulating thing co-administereds.In some instances, conservative property kernel LPS molecule is the kernel LPS of structure I.In some instances, conservative property kernel LPS molecule is the kernel LPS of structure I I, but does not have one or two R and R defined herein ¹In some instances, conservative property kernel LPS is for following at least a kind of:

Q P

6 4

a)Hep-(1-6)-β-Glc-(1-4)-L，D-α-Hep-1-5-α-Kdo

3

X

Q

6

b)Hep-(1-6)-β-Glc-(1-4)-L，D-α-Hep

3

X

Q P

6 4

c)Glc-(1-4)-L，D-α-Hep-1-5-α-Kdo

3

X

Q

6

d)Glc-(1-4)-L，D-α-Hep

3

X

d)Hep-(1-6)-β-Glc-(1，4)-L，D-α-Hep

3

X

P

4

f)Hep-(1-6)-β-Glc-(1，4)-L，D-α-Hep-1-5-α-Kdo

3

X

Wherein:

Q is:

X is:

P is a phosphoric acid ester.

In some instances, conservative property kernel LPS is that above-mentioned one or more molecule a-f or disclosed common structure (has or do not have R and R ¹) one of varient, wherein one or more terminal sugar are to occur with isomer or through the form of modifying to keep its specific isomer.

In one embodiment of the invention, provide the oligosaccharides in above-mentioned antigens LPS source, the covalent linkage that this oligosaccharides is not connected with other oligosaccharides.

In one embodiment of the invention, provide a kind of method for preparing vaccine, comprised conservative property kernel LPS molecule or its part and/or varient are linked to each other with immunogenic carrier albumen.In some instances, adjuvant can be provided with LPS molecule-carrier proteins.

Description of drawings

Fig. 1 shows that core oligosaccharide component from hemolytic Man bacillus serotype A 1 LPS is at D ₂The proton N MR spectrum of 600MHz among the O (300 K, pH 3).HOD resonance is at 4.756ppm.4.4ppm above resonance in anomer district marks with the resonance of Kdo methylene radical.It also is known being labeled as the structure of determining of A1 and the name of residue.The heterogeneity that causes owing to the part brachymemma of main chain oligosaccharides marks with empty arrow in connection site.In literal, owing to indicating with f ' of the heterogeneous f that causes than small component.Hep _I, Hep _IIAnd Hep _IIIIt is the D-D-heptose.Other residues have D-form.

Fig. 2 shows the 2D NMR experiment of A1, shows the HMQC spectrum (a) in anomer district, and the COSY (b) in He Huan district, anomer district and NOESY (c) spectrum.The observed position that is positioned near the b2 resonance of k5 of arrow indication.

Fig. 3 shows the heteronuclear from A1 ¹H- ¹³The figure that selects in the C 2D NMR spectrum.(a) in the HMQC spectrum in ring district, some ownership have been marked in possible place.(b) in HMQC-TOSCY spectrum, the dependency of C7-H7s-C6-H6, C4-H4-C5-H5 TOCSY and the dependency of b2 have been marked.(c) in HMBC spectrum, shown between the H1-C1-01-Cx glucosides of anomer proton resonance dependency in dependency and the residue.

Fig. 4 has shown that the 1D of non-heptose residue among the identification A1 selects experiment.(a)1D TOCSY(a1，180ms)；(b)1D TOCSY(h1，180ms)；(c)1D TOCSY(i1 k4，180ms)；(d)1D NOESY-TOCSY(i1 k4，400ms；k6 180ms)；(e)1D NOESY-TOCSY(del，400ms；g3 k7，180ms)；(f)1D TOCSY(c1，180ms)；(g)1D TOCSY j1，180ms)；(h)1D TOCSY-NOESY(j1，180ms；j4，400ms)。Because heterogeneous f that causes and the minor component of h are expressed as f ' and h ' respectively.But the time spent lines out below the resonance of the first selection step, and second selects the resonance of step to mark with double underline.The resonance in selected anomer district marks in the spectrum left side.

Fig. 5 shows that the 1D that detects dipolar interaction among the A1 selects experiment.(a)-(f) be respectively the 1D NOESY spectrum of anomer Q region resonance Q of the 200ms mixing time of b1, c1, de1, f1, g1 and i1/k4, (g) be j1 1D ROESY (f1,500ms).Selected anomer Q region resonance Q marks in the spectrographic left side.

Fig. 6 shows the proton spectrum of heptose monose.D ₂Under O, the 300K condition at the D-L-heptose spectrum (a) of the raising resolving power of 600MHz, and the enhanced spectrum of α (b) and beta form (c).D ₂Under O, the 300K condition at the D-D-heptose spectrum (d) of the raising resolving power of 600MHz, and the spin simulated spectra of α (e) and beta form (f).Anomer and H5-β resonance are unknown.Notice the tight coupling of H-3, H-4 resonance and virtual coupled in (b), can correctly reproduction of H-5 resonance.

Fig. 7 shows that the 1D of heptose residue among the identification A1 selects experiment.(a) 1D TOCSY-TOCSY (b1,75ms; B2 is 75ms) to detect b3, b4 and b5; (b) 1D TOCSY-NOESY (b2,150ms; B5 is 400ms) to detect b5-b6 and b5-b3 NOE.Be also noted that because the strong b5-d2 NOE that b (1-3) d key causes; (c) 1d TOCSY-TOCSY (de1,75ms; E2 is 75ms) to detect e3, e4 and e5; (d) 1D TOCSY-TOCSY (de1,75ms; D2 is 75ms) to detect d3, d4 and d5; (e) 1d TOCSY-TOCSY (g1,90ms; G2 is 150ms) to detect g3 to g5; (f) 1DTOCSY-NOESY (g2,150ms; G5,400ms) demonstration is according to g5-g6 and the g5-g3 NOE and the g5-i6 NOE of g (1-6) I key; (g) 1D NOESY-TOCSY (f1,400ms; G6 is 180ms) to detect the g7 resonance from NOE between the f1-g6 glucosides according to f (1-6) g key; (h) 1DTOCSY-TOCSY (f1,90ms; F2 is 150ms) to detect f and the f ' resonance up to H-6.Note the collection of illustrative plates of multiplet clearly of f5 and f ' 5; (i) (f6 is 40ms) to detect the f7 resonance that just causes owing to the short spin locking time for 1D TOCSY.But the time spent lines out below the resonance of the first selection step, and second selects the resonance of step to mark with double underline.Selected anomer Q region resonance Q marks in the spectrum left side.

Fig. 8 shows that the kernel heptose to A1 carries out the molecular model of conformer that MMC calculates the least energy of gained.Oxygen plots bigger ball, and has removed hydroxyl proton.Relevant proton is marked.Notice that having observed e-b branch is close to mutually with g-i branch, and the anomer proton of the outer loop chain of residue e and residue b is close to mutually consistent with long-range NOE.Notice the difference of outer shroud chain direction between L-D-heptose (residue d, b, e) and the D-D-heptose (residue g) simultaneously.

Fig. 9 shows by the kernel heptose to A1 and is undertaken between proton that MMC calculates apart from the variation of  and macroscopic motion (macro move) that wherein (a)-(g) distinguishes corresponding b1-e5, b1-e7, e1-i4, e1-g2, g1-b2, g1-b3.Distance appears in the 2-4  scope consistent with viewed long-range b-e, e-i and e-g NOE between proton.

Figure 10 shows the molecular model of the hemolytic Man bacillus LPS that uses the lipid A structure, and wherein said lipid A has the fatty acyl substitution pattern that can report hemophilus influenzae LPS.Lipid A part and Kdo mark grey, heptose is marked into redness or purple, and glucose is marked green, semi-lactosi mark au bleu.PO ₄Gene is yellow.Removed hydroxyl proton.

The anionic electrodeposition of Figure 11 .Ap serotype 5a core os sprays mass spectrum.

Figure 12 .Ap serotype is 5a a); B) 5b; C) 2; D) the 1H-NMR spectrographic anomer district of 1 core os.This spectrum is 25 ℃ of following records in the D2O of pH 7.0.

Figure 13 .Ap serotype 5 residues are Hep I a); B) Hep II; C) Hep III; D) HepIV; E) Hep V; F) Glc II; G) Glc I; H) the selectivity 1D-TOCSYNMR spectrographic ring district of the core os of Gal I.Each residue of letter representative is as shown in the table 2 of embodiment 2.This spectrum is 25 ℃ of following records in the D2O of pH 7.0, and the mixing time of heptose residue is 150ms, and the mixing time of hexose residue is 90ms.

Figure 14 .Ap serotype 5a residue is Hep III a); B) Hep II; C) Glc I; D) GlcII; E) Hep IV; F) the selectivity 1D-NOESY NMR spectrographic ring district of the core os of Hep V.Each residue of letter representative is as shown in the table 2 of embodiment 2.This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O, mixing time is 400ms.

Figure 15. determine the position of O-chain Gal I residue of the core os of Ap serotype 5a.A) anomer of GalI ¹The 1D-NOESY NMR spectrum of H-resonance; B) anomer of Gal I residue in the NOESY step ¹The H-7 of Hep III residue in H-resonance and the TOCSY step ¹The 1D-NOESY-TOCSY spectrum of H-resonance; C) anomer of Hep III residue in the TOCSY step ¹The H-4/H-5 of Hep III residue in H-resonance and the NOESY step ¹The 1D-TOCSY-NOESY spectrum of H-resonance.D) ¹³C- ¹H-HMBC NMR spectrographic zone, the anomer of demonstration Gal I and Glc I ¹The HMBC of H-resonance.E) ¹³C- ¹H-HSQC NMR spectrographic zone, the H-7 of demonstration Hep III ¹The H-2 of H-resonance, Hep V ¹The H-3 of H-resonance and Hep II ¹H-resonance ¹³C overlapping peak.This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O.

Positively charged ion capillary electrophoresis-electrospray the mass spectrum of the core os of Figure 16 .Ap serotype 1.The product ion spectrum is from m/z930 ²⁺

Figure 17. the open chain N-acetylgalactosamine residue of the core os of identification Ap serotype 1.A) 2D-of the core os of Ap serotype 1 ¹³C- ¹H-HSQC NMR spectrographic ring district.B) core os of Ap serotype 1 ¹H-NMR spectrographic ring district.C) H-1 of GalNAc residue ¹The 1-D NOESY spectrum of H-resonance.D) H-4 of GalNAc residue ¹The 1-D NOESY spectrum of H-resonance.E) H-2 of GalNAc residue ¹The 1-D NOESY spectrum of H-resonance.F) H-4 of HexNAc residue ¹The 1-D NOESY spectrum of H-resonance.This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O.The resonance of identification is (i, GalNAc shown in mark; J, Gal II).

The structural representation of an embodiment of the core oligosaccharide of Figure 18 . Ap serotype 1,2,5a and 5b.For serotype 1; R is α-GaloNAc-(1-4,6)-β-Gal II-(1-3)-β-GalI, and R ' is H, and wherein o represents the open chain configuration.For serotype 2; R is β-Glc III, and R ' is D-α-D-Hep V.For serotype 5a and 5b; R is H, and R ' is D-α-D-Hep V.

Figure 19. the anionic electrodeposition of pasteurella multocida bacterial strain Pm70 core os sprays mass spectrum.

Figure 20. pasteurella multocida bacterial strain Pm70 core os m/z 1246.5 ²⁺Positively charged ion capillary electrophoresis-electrospray mass spectrum of MS/MS.

Figure 21. pasteurella multocida bacterial strain Pm70 core os m/z 316 ⁺The positively charged ion capillary electrophoresis-electrospray mass spectrum of precursor ion scanning.

Figure 22. the complete deacylated tRNA LPS's of pasteurella multocida bacterial strain Pm70 ¹H-NMR spectrographic anomer district.This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O.Residue marks shown in embodiment 3 tables 2.

Figure 23. the part in the TOCSY spectrographic anomer district of pasteurella multocida bacterial strain Pm70 core os.This spectrum is at D ₂25 ℃ of following records among the O.

Figure 24. the part in the NOESY spectrographic anomer district of pasteurella multocida bacterial strain Pm70 core os.This spectrum is at D ₂25 ℃ of following records among the O.

Figure 25. pasteurella multocida bacterial strain Pm70 core os ¹H- ¹³C-HMBC NMR spectrographic anomer district.Insert (inset) is the spectral region that show the diagnostic signal of N-acetyl-aminosugar.This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O.

Figure 26. the structure of pasteurella multocida bacterial strain Pm70 core oligosaccharide shows the glycosyltransferase of inferring.

Negatively charged ion capillary electrophoresis-electrospray mass spectrum of the LPS-OH of Figure 27 .Pm bacterial strain VP161.A) m/z 992 ^3-Product ion spectrum, b) m/z 999 ^3-Product ion spectrum, c) m/z 1040 ^3-Product ion spectrum.

Positively charged ion capillary electrophoresis-electrospray the mass spectrum of the core os of Figure 28 .Pm bacterial strain VP161.A) m/z 903 ²⁺Product ion spectrum, b) m/z 984 ²⁺Product ion spectrum, c) utilize high mouthful of m/z 4242 that presses (oriffice voltage) ⁺Product ion spectrum.

The 2D-NOESY NMR SPECTRAL REGION of Figure 29 .Pm bacterial strain VP161 core os.Each residue of letter representative is as shown in the table 2 of embodiment 4.This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O, mixing time is 400ms.

The 2D-of Figure 30 .Pm bacterial strain VP161 core os ¹³C- ¹H-HMBC NMR SPECTRAL REGION shows anomer ¹H-resonance (lowercase) and ring ¹³The dependency of C-resonance (capitalization).This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O.

The 2D-of Figure 31 .Pm bacterial strain VP161 core os ³¹P- ¹H-HSQC-TOCSY NMR SPECTRAL REGION shows that be marked with galactose residue and the choline of g-1 to g-4 and h-1 to h-4 resonates ³¹P-resonance (X-axle) and ¹The dependency of H-resonance (Y-axle).This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O.

The complete deacylated tRNA LPS's of Figure 32 .Pm bacterial strain VP161 ¹H-NMR spectrum.A) contain the sugared type of a Kdo residue; B) contain the sugared type of two Kdo residues.This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O.Each residue of letter representative is shown in embodiment 4 tables 2.* the displacement of the low district of the H-4 proton resonance of Gal I (g) and Gal II (h) be since in the KOH treating processes hydrolysis of PCho residue and migration cause.

Positively charged ion capillary electrophoresis-electrospray the mass spectrum of Figure 33 .Pm strain X 73 core os.A) m/z 1108 ²⁺Product ion spectrum, b) utilize high mouthful of m/z 451.5 that presses ⁺Product ion spectrum.

The 2D-of Figure 34 .Pm strain X 73 core os ³¹P- ¹H-HMQC-TOCSY NMR SPECTRAL REGION shows between PEtn and the galactose residue ³¹P- ¹The H coupling is when mixing time is optimized for 10 Hz ³¹P-resonance (X-axle) and ¹Dependency between the H-resonance.This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O.

The 2D-of Figure 35 .Pm strain X 73 core os ¹³C- ¹H-HSQC-TOCSY NMR SPECTRAL REGION shows ¹³C-resonance (Y-axle) and ¹Dependency between the H-resonance shows the dependency of C-5, C-6, H-5 and the H-6 resonance of galactose residue.This spectrum is at the D of pH 7.0 ₂25 ℃ of following records among the O.

Figure 36. by full cell lysate being carried out SDS-PAGE and silver dyeing, analyze the LPS of pasteurella multocida.(A) comparison of pasteurella multocida LPS pattern: wild-type VP161 (swimming lane 1); Heptose based transferase mutant AL251 (swimming lane 2); Control strain AL438 (AL251 that contains vector plasmid pAL99) (swimming lane 3) and complementary mutant strain AL298 (swimming lane 4).

(B) comparison of pasteurella multocida LPS pattern: glycosyltransferase mutant AL251 (swimming lane 1); Wild-type VP161 (swimming lane 2) and from three different chickens of AL251 inoculation isolating pasteurella multocida wild-type revertant ( swimming lane 3,4 and 5).

Figure 37. the negatively charged ion capillary electrophoresis-electrospray mass spectrum of pasteurella multocida core os.(A) the double charge zone of parental plant VP161 core os; (B) single charge area of mutant strain AL251 core os.

Figure 38. from (A) pasteurella multocida parental plant VP161 and (B) the LPS core os of pasteurella multocida mutant strain AL251 ¹The H-NMR SPECTRAL REGION.This spectrum is at 25 ℃ of following records, and with interior acetone under 2.225ppm as with reference to benchmark.

Figure 39. the NOESY SPECTRAL REGION of pasteurella multocida VP 161 core os.The NOE connectivity as shown in the figure.Insert; VP 161 kernel OS structures.This spectrum is at 25 ℃ of following records, and with interior acetone under 2.225ppm as with reference to benchmark.

Figure 40. from (A) parental plant VP161 and (B) structure of the supposition of the pasteurella multocida kernel LPS of mutant strain AL251, wherein R is that oligonucleotide chain on the Glc extends.

Figure 41 .a) hemolytic Man bacillus strain A1, b) structural representation of the core oligosaccharide of actinobacillus pleuropneumoniae serotype 1.Express the glycosyltransferase that works in the fs of outer core modification.

Figure 42 .a) the O-deacylated tRNA LPS of hemolytic Man bacillus mutant strain losB, and b) uses negatively charged ion capillary electrophoresis-electrospray ionisation mass spectrum of O-deacylated tRNA LPS of the hemolytic Man bacillus mutant strain losB of the pNF 2176AAlosB reverse complemental contain the losB gene.

Figure 43. the 2D-TOCSY NMR SPECTRAL REGION of the complete deacylated tRNA LPS of wild-type hemolytic Man bacillus strain A1 and mutant strain losB.The expression of each residue and is irised out the outer core residue that the losB mutant strain lacks as shown in the figure.This spectrum is 25 ℃ of following records in the D2O of pH 7.0, and mixing time is 400ms.

Figure 44. the ELISA (OD of the D42 polyclonal serum of mouse #1-5 ₄₀₅) result of experiment, this experiment is at the LPS of the purifying of bacterial strain Mh losB (▲) and wt (■).The mouse label as shown in the figure.All serum dilutions as shown in the figure.

Figure 45. the ELISA (OD of nine kinds of kernel LPS mAb ₄₀₅) result of experiment, this is tested at bacterial strain MhlosB and wt, the LPS of App serotype 1 and 5a and Pm bacterial strain VP161 and X73, and the LPS-OH of Mh and Pm bacterial strain.MAb label and diluent are as shown in the figure.

Figure 46. the ELISA (OD of the D42 polyclonal serum of mouse #1, mouse #2+3, mouse #4 and mouse #5 ₄₀₅) result of experiment, this experiment is at the LPS of bacterial strain Mh losB and wt, App serotype 1 and 5a and Pm bacterial strain VP 161 and X73.The mouse label as shown in the figure.All serum use with 1: 50 extent of dilution.

Figure 47. the ELISA (OD of the D152 polyclonal serum of mouse #5 ₄₀₅) result of experiment, this experiment is at the LPS of bacterial strain Mh losB and wt, App serotype 1 and 5a and Pm bacterial strain VP 161 and X73.Extent of dilution as shown in the figure.

Figure 48. the ELISA (OD of the useless supernatant liquor of two kinds of representative kernel LPS mAb (spent supernatant) ₄₀₅) result of experiment, this experiment is at the LPS of bacterial strain Mh losB and wt, Ap serotype 1 and 5a and Pm bacterial strain VP 161 and X73.MAb label and extent of dilution are as shown in the figure.

Figure 49. use negatively charged ion capillary electrophoresis-electrospray mass spectrum of the LPS of Mh losBKOH processing.

The SDS-PAGE and the western blot analysis of Figure 50 .MhlosB-HAS binding substances.On the 12.5%SDS-PAGE gel, carry out electrophoresis, and be 1: 10 with extent of dilution ⁶Sugared specificity mAb G8 carry out trace and screening.

Figure 51. to a) HSA; B) CE-ES-MS of HSA-MhlosB glycoconjugate analyzes.

Figure 52. inoculated the ELISA (OD of the D23 polyclonal serum of mouse #V1-V5 and control mice C6, C8 and C9 ₄₀₅) result of experiment, this experiment is at the LPS of bacterial strain Mh losB, and this experiment is used for screening that IgG replys (▲) and IgM replys (■).The mouse label as shown in the figure.The extent of dilution of all serum as shown in the figure.

Figure 53. inoculated the ELISA (OD of the D45 polyclonal serum of mouse #V1-V5 and control mice C6, C8 and C9 ₄₀₅) result of experiment, this experiment is at the LPS of bacterial strain Mh losB, and this experiment is used for screening that IgG replys (▲) and IgM replys (■).The mouse label as shown in the figure.The extent of dilution of all serum as shown in the figure.

Figure 54. the ELISA (OD of polyclonal serum V2 (1: 25 diln) ₄₀₅) result of experiment, this experiment is at the LPS of bacterial strain Mh losB and wt, Ap serotype 1 and 5a and Pm bacterial strain VP161 and X73.

Figure 55. the ELISA (OD of polyclonal serum V2 (1: 25 diln) ₄₀₅) result of experiment, this experiment is at the full cell of bacterial strain Mh losB and wt, Ap serotype 1 and 5a and Pm bacterial strain VP161 and X73.

Figure 56. the ELISA (OD of polyclonal serum Mh#1 (1: 100 diln) ₄₀₅) result of experiment, this experiment is at the full cell of bacterial strain Mh losB and wt, Ap serotype 1 and 5a and Pm bacterial strain VP161 and X73.

Figure 57. the ELISA (OD of polyclonal serum Mh#1 (1: 100 diln) ₄₀₅) result of experiment, this experiment is at the LPS of bacterial strain Mh losB and wt, Ap serotype 1 and 5a and Pm bacterial strain VP161 and X73.

Figure 58. from a) mAb G3 and b) ELISA (OD of the ascites of mAb G8 ₄₀₅) result of experiment, this experiment is at the LPS of bacterial strain Mh losB and wt.

Figure 59. from a) mAb G3 and b) ELISA (OD of the ascites of mAb G8 ₄₀₅) result of experiment, this is tested at bacterial strain Mh losB and wt; Ap serotype 1 and 5a; The full cell of Pm bacterial strain VP161, X73 and Pm70.

Figure 60. from a) mAb 3-5 and b) ELISA (OD of the ascites of mAb 3-16 ₄₀₅) result of experiment, this experiment is at the LPS of bacterial strain Mh wt and Pm bacterial strain VP161.

Figure 61. from a) mAb 3-5 and b) ELISA (OD of the ascites of mAb 3-16 ₄₀₅) result of experiment, this is tested at bacterial strain Mh wt and losB; The full cell of Ap serotype 1 and Pm bacterial strain VP161 and X73 and meningococcus bacterial strain L2 galE.

Figure 62. the serum bactericidal test of using the immune serum diluent from mAb G3 and corresponding complement defect contrast to carry out; Percentage survival=[the average #CFU T30/ of test has only the average #CFU T30 of Mh] * 100% wherein.

Figure 63. the serum bactericidal test of using the immune serum diluent from mAb G8 and corresponding complement defect contrast to carry out; Percentage survival=[the average #CFU T30/ of test has only the average #CFU T30 of Mh] * 100% wherein.

Figure 64. the serum bactericidal test that the polyclonal serum diluent that uses mouse (Mh#1 D140) and corresponding complement defect from the full cellular immunization of Mh losB to contrast carries out; Percentage survival=[the average #CFU T30/ of test has only the average #CFU T30 of Mh] * 100% wherein.

Figure 65. to a) mAb G3 and b) mAbG8 ascites carries out the albumin A column purification, and the universal trocar before and after the upper prop is carried out ELISA (OD to the LPS of Mh wt bacterial strain ₄₀₅) detect.

Figure 66. inoculate the lung of the B group mouse that back 3 days (dpi 3) kills, be presented at the neutrophilic granulocyte that has moderate quatity in the medium sized segmental bronchus tube chamber.

Figure 67. inoculate the lung of the back C group mouse that killed in 3 days, show the distinguishable bronchopneumonia that goes out, and have a spot of lymphoidocyte in some zone.

Embodiment

Embodiment 1

Present embodiment has formed Can.J.Chem.80, the basis of 1715 (2002) middle publications.Research hemolytic Man bacillus serotype A 1.Analytical table to the LPS of hemolytic Man bacillus serotype A 1 is understood Hex ₃Hep ₅Kdo is main core oligosaccharide component.This measures by the following method: the LPS sample is carried out the weak acid hydrolysis, and (1%HOAc, 3h), carries out 1D 1H NMR and FAB-MS analysis to the oligosaccharide compositions that obtains by 100 ℃.Alditol acetate and 2-butyl glycoside derivates to core oligosaccharide carry out the GLC-MS analysis revealed, contain D-glucose, D-semi-lactosi, L-D-heptose and DD-heptose in the main component of core oligosaccharide, and its mol ratio is 2: 1: 3: 2.Find that from methylation analysis the D-Gal residue is terminal irreducibility part, and have Hex ₂Hep ₅Lack in the minority composition of the core oligosaccharide component that Kdo forms.Determined that by colorimetric analysis Kdo is present among the LPS.

Hemolytic Man bacillus LPS uses anhydrous hydrazine to re-use highly basic earlier and handles, and can generate water-soluble deacylated tRNA LPS oligosaccharides.The representative of deacylated tRNA LPS sample comprises the complete main chain oligosaccharides of the natural materials of core and lipid A oligosaccharides part.This confirms that by electrospray ionisation ESI-MS this experiment provides and Hex ₃Hep ₅Kdo ₁HexN ₂(H ₂PO ₃) ₃Corresponding molion is as main oligosaccharide compositions (seeing experimental section).

In proton spectrum (Fig. 1) and HMQC and COSY spectrum (Fig. 2), observe 10 anomers ¹H NMR resonance and methene proton resonance.To anomer resonance, by it ¹The descending of H nmr chemical displacement is marked with a-j, and the methene proton of Kdo is marked with k3 _EqAnd k3 _AxThe integration at b1 and de1 and j1 anomer peak lacks 40% than the integration of other anomer resonance peaks, has confirmed the heterogeneity in this sample.Downfield bimodal (downfielddoublet) has appearred in the 4.91ppm place near h1, and illustrating at h1 also has some heterogeneities.

The same nuclear and the heteronuclear 2D-NMR that have carried out standard analyze.From the COSY spectrum of Fig. 2, can determine the position of H-2 resonance.Recognize for residue b, d, e, f and g, J _1,2Very little, have the characteristics of sweet dew-heptose, 2D-TOCSY can not be used for shifting magnetization from H-1 through H-2.Find out that from the HMQC spectrum of Fig. 3 the H-2 of heptose residue and other resonance are overlapping, make that 2D-TOCSY is difficult to these residues are analyzed.2D-NOESY spectrum shows that also the NOE number is high unusually, particularly resonates for b1, de1.Also there are several resonance overlapped in the anomer district.Therefore, because the heterogeneity of spectrographic complicacy and this sample uses the 1D system of selection to extract spectrum parameter, this spectrum parameter can't use the 2D method of standard to obtain, thereby can resolve structure and conformational analysis.HMQCTOCSY and HMBC experiment are for discerning fully, and particularly the unitary identification fully of heptose is also extremely important.Use this method, just may be to bigger main chain oligosaccharides (A1) ¹H and ¹³(embodiment 1, table 1) is discerned in the displacement of C nmr chemical fully.

From before research known Kdo-GlcN _II-GlcN _ISequence and part identification, and the identification done of place is consistent therewith.Residue a and h are carried out 1D-TOCSY make it possible to identification resonance, measure the proton coupling constant (Fig. 4 a, 4b).Phosphate-based position was by doing in the past ³¹P HMQC experimental verification.From HMQC, HMQC-TOCSY and HMBC spectrum, discern then ¹³The displacement of C nmr chemical.This information makes and residue a and h can be defined as lipid A α-D-GlcN and β-D-GlcN pyrans glycosyl units partly.Most protons, ³¹P and ¹³Displacement of C nmr chemical and previous in similar structural element, report similar.In the 1D-TOCSY of h1, h ' 5 peaks at 3.62ppm place are because Kdo-(2-6)-β-D-GlcN _IIThe hydrolysis of glycosidic link causes.In solution behind the some months, this key complete hydrolysis, respectively 3.82 and the 3.92ppm place h ' 6 and h ' 6 appear.Also find the 3.91ppm place clearly the anomer signal be that h ' 1 by this disaccharides causes.

For Kdo, H-4 and H-5 resonance are from selective exitation H-3 _EqOr H-3 _Ax1D-TOCSY experiment in identification.Since have at C-4 place one phosphate-based, H-4 resonates and moves to the downfield position, this passes through ³¹P HMQC checking.Less J _5,6＜1Hz has stoped TOCSY to shift (Fig. 4 c) through H-5.Yet, between the k4 of Fig. 2 c and k6, observe strong NOE, this x-ray structure with Kdo is consistent.(k4 k6) finishes identification (Fig. 4 d) to use 1D NOESY-TOCSY.Shown in the back, for HepI-(1-5)-Kdo key, also observe d1-k7 NOE, this is that Kdo is in the substituted characteristics in C-5 place.Use this NOE, from 1D-NOESY-TOCSY (de1, in k7) detected Kdo resonance (Fig. 4 e) have with the front experiment in the identical chemical shift and similar multiplet pattern found, thereby confirmed Kdo ¹H NMR identification.From HMQC spectrum, obtain Kdo's then ¹³C NMR identification, and from HMQC-TOCSY spectrum, verify.

Residue i is defined as β-D-glucose that 6-replaces, and is designated as Glc _IThe anomer resonance of residue i is overlapping with the H-4 resonance of Kdo.In the 1D-TOCSY of these two overlapping resonance, can distinguish the resonance of residue i, because the J of Kdo _5,6Coupling constant very little (Fig. 4 c).All resonance can be detected, and the coupling constant of these multiplets can be measured up to H-6.Because its β-D configuration, i1-i3 and i1-i5 NOE also are observed (Fig. 2 and Fig. 5 f) in NOESY spectrum.From HMQC spectrum, obtained Glc then _I ¹³C NMR identification, and use the checking of HMQC-TOCSY spectrum.By comparing with the chemical shift of terminal glucose, the glycosidation downfield position that 3.7ppm is observed in resonance for C-6 is moved, and shows that it is substituted in this position.Also observe-the obvious displacement of 2.2ppm for C-5.About the rotational isomer of C-5-C-6 key distribute can be from Fig. 5 f among the i1-i5 NOE viewed H-5 multiplet determine.Clearly, J _5,6And J _5,6'. have＜the less value of 2Hz, because the H-5 multiplet is seemingly by the bigger J of 10Hz _4,5It is bimodal that coupling is dominated.This shows that H-6 and H-6. ' intersect with the H-5 ortho position, and 06-C6-C5-05=-60 ° rotational isomer is preferably in solution.

Residue c is defined as terminal alpha-D-glucose, is designated as Glc _IIFrom the 1D-TOCSY (Fig. 4 f) of c1, can detect resonance up to H-5, the proton coupling constant based on measuring shows that residue c is a α-Pu Taotang.Compare from HMQC spectrum and with the chemical shift of terminal glucose model compound, can finish all ¹H and ¹³C NMR identification.

Tell terminal galactose from the 1D-TOCSY of j1, residue j is designated as Gal, and observes the resonance (Fig. 4 j) up to H-4.In order to pass through less J _4,5Coupling constant and tell H-5 has been carried out 1D-TOCSY-NOESY (j1, j4) (Fig. 4 h).Compare from HMQC spectrum and with the chemical shift of terminal galactose model compound, can finish all ¹H and ¹³C NMR identification.

In order to belong to the heptose residue, synthesized model compound to obtain accurately ¹H and ¹³Displacement of C nmr chemical and J _{H, H}Value.These are extremely important for belonging to by the chemical shift comparison the terminal heptose unit.And, in case glycosidation, replacement carbon ¹³C NMR resonance has the displacement of significant downfield glycosidation.The proton spectrum of D-D-heptose and D-L-heptose is shown in Fig. 6.In solution, every kind of compound all exists α and beta form.Use the 1D-TOCSY experimental identification they ¹H NMR spectrum.For obtaining coupling constant and chemical shift accurately, carried out proton spectrographic spin simulation.Mimic spectrum is shown in Fig. 6.Mimic spectrum has accurately reproduced viewed spectrum, the particularly tight coupling (Fig. 6 b) of H-3-H-in D-α-L-heptose.Use HMQC identification ¹³The displacement of C nmr chemical.The NMR data of heptose monose provide in the table 2 at embodiment 1.The chemical shift of L-D-heptose is identical with the D-L-heptose, because their enantiomers each other.

In the TOCSY experiment, from A1, they can be identified as heptose in the narrower anomer resonance of residue b, d, e, f and g, this is because J _1,2It is less to be coupled, and lacks magnetization from the transfer of H-1 to H-2.All heptose have α-D configuration among the A1 because unique from NOE in the residue of H-1 to H-2 (Fig. 2).(H-1 H-2) discerns all heptose residues to use 1D-TOCSY-TOCSY.Because the less J of 1.8Hz _1,2Value, thereby hindered first TOCSY step that magnetization is transferred to H-2 and further shifts from H-1.Yet, because the bigger j of 3Hz _2,3Value, second step on H-2 can further be transferred to higher screwing on certainly with magnetization.Yet for the L-D-heptose, magnetization is shifted and is rested on H-5, and this is because the less J of 1.6Hz _5,6Value.For the D-D-heptose, it is less that obstruction is shifted in magnetization, and this is because the bigger J of 3.2Hz _5,6Value.Yet relaxation effect also can hinder magnetization and shift, and can not use the transfer that lacks on the H-5 evidence as the identification of L-D-heptose.

Residue b is defined as L-α-D-heptose that 2-replaces, and is designated as Hep _II(b1, (Fig. 7 a) b2) to pick out the resonance at 3.64ppm and 3.9ppm place for 1D-TOCSY-TOCSY.3.64ppm the multiplet pattern of locating is the indication of H-5 resonance, and in the multiplet pattern at 3.9ppm place and monose the H-3 of observed tight coupling and H-4 resonate similar (Fig. 6 b).In order to distinguish H-6,1D-TOCSYNOESY (b2, b5) (Fig. 7 b) have been carried out.In first TOCSY step of b2, a6 resonance is also illuminated, but second step was only selected b5 resonance.The NOE of b2 and also is observed among the NOE between the residue on d2 on b3 and b6.In case after the b6 position is determined, use the HMQC-TOCSY of C-7-H-7s-C-6-H-6 to discern H-7 and H-7. ' resonance (Fig. 3 b).From HMQC spectrum, obtain the identification of other resonance then, and from HMQC-TOCSY and HMBC spectrum checking (Fig. 3).Chemical shift being compared with the chemical shift of L-α-D-heptose, shown that C-2 has the downfield displacement of 9ppm, C-3 has-upfield shift of 0.8ppm, showing at the C-2 place has replacement.C-4 to the chemical shift of C-7 within the 0.6ppm of monose chemical shift.

Residue e is defined as terminal L-α-D-heptose, is designated as Hep _IIIThough d1 and e1 resonance are overlapping, because their H-2 resonance is not overlapping, so it doesn't matter.(de1 e2) picks out e3, e4 and e5 spin (Fig. 7 c) to 1D-TOCSY-TOCSY.Among the b1 NOE in Fig. 5 a, also observe e5 resonance.1D selects the high digital resolution of experiment to make it possible to by the multiplet pattern of observing them resonance in the different experiments accurately be mated.Also observe b1-e7 and b1-e7. ' NOE among Fig. 5 a.Shown in hereinafter, these NOE are caused by b1 proton and e5 and e7 and e7 ' proton next-door neighbour institute.In the HMQC-TOCSY of C-7-H-7s-C-6-H-6, can determine the position of H-6 resonance. ¹H and ¹³C NMR identification can use HMQC and HMQCTOCSY to finish.Residue e's ¹H and ¹³The displacement of C nmr chemical is similar to L-α-D-heptose.

Residue d is defined as 3,4, and the trisubstituted L-α of 6--D-heptose is designated as HepI.

(de1 d2) picks out narrow multiplet at the 4.17ppm place to 1D-TOCSY-TOCSY, picks out the multiplet (Fig. 7 d) of broad at the 4.01ppm place.4.01ppm and the multiplet (d2) at 4.17ppm place also is observed in the 1D-NOESY of b1, and (Fig. 5 a).4.17ppm the resonance of locating also is observed (Fig. 5 f) in the 1D-NOESY of i1.In HMQC spectrum, in (δ c, δ h) (74.9,4.17), (72.5,4.17) locate to pick out two narrow intersection peaks, locate to pick out a wide intersection peak in (75.3,4.01).The HMQC-TOCSY dependency also can be observed between these intersection peaks.Will ¹³Displacement of C nmr chemical and embodiment 1, the chemical shift of the α in the table 2-D-heptose pyranose is compared, and can find out obviously that the intersection peak that (74.9,4.17) and (75.3,4.01) are located has experienced ¹³The displacement of C NMR downfield glycosidation.Because these three intersect the peak from d3, d4 or d5, have only d5 intersection peak can not experience big glycosidation displacement, because the replacement on the heptose can not occur in the C-5 place.Therefore, the intersection peak that (72.5,4.17) are located be identified as (C-5, H-5).Based on HMBC (d3, d1) and (d3, dependency b1), the intersection peak that (75.3,4.01) are located be identified as (C-3, H-3).Therefore (74.9,4.01) intersection peak of locating be identified as (d4, d1), with viewed HMBC (d4, i1) dependency and (i1, d4) NOE consistent (Fig. 3 and Fig. 5 f).Can discern d6 resonance from the 1D-NOESY of i1, this is because when having only residue d to be the L-D-heptose, for GlcI-(1-4)-HepI key, also can expect and observe strong NOE to H-6.D6 resonance also can be observed (Fig. 5 b) in the 1D-NOESY of c1.(C-7, H-6) (i1, d6) (not shown) are determined the position that H-7 and H-7. ' resonate for intersection peak (Fig. 3) and 1DNOESY-TOCSY from HMQCTOCSY.Chemical shift is compared with the chemical shift of L-α-D-heptose, shown that C-3, C-4 and C-6 have 3.9,7.9 and the downfield glycosidation displacement of 11.6ppm respectively.

As follows, because the heterogeneity (Fig. 1) of branch's heptose should exist 4, the dibasic L-α of 6--D-heptose (d ').From the HMQC and COSY spectrum in anomer district,, can not observe the independent signal of H-1 or H-2 owing to overlapping with other resonance.By inference, the chemical shift of proton of d ' 1 is identical with d1's, and the chemical shift of d ' 2 is similar to e2's.

Residue g is defined as D-α-D-heptose that 6-replaces, and is designated as Hep _IV(g1 g2) identifies g3, g4 and g5 spin (Fig. 7 e) to 1D-TOCSY-TOCSY.3.94 the multiplet pattern of locating is the sign of H-5 resonance.In order to distinguish H-6,1D-TOCSY-NOESY (g2, g5) (Fig. 7 f) have been obtained., on g3 and g6, and be observed on the NOE between the residue of inferring on the i6 from the NOE of g2.In case determine the position of g6, (f1, g6) (Fig. 7 g) discerns H-7 and H-7. ' resonates just can to use the HMQC-TOCSY (Fig. 3 b) of C-7-H-7s-C-6-H-6 and 1D-NOESY-TOCSY.Then, can obtain from HMQC spectrum, and use HMQC-TOCSY spectrum checking (Fig. 3) the identification of other resonance.In 1D-NOESY (f1), observe g6 and g5 resonance (Fig. 5 d).From molecular model research, can get, have only that NOE f1-g5 NOE just might (see below) when residue g is the D-D-heptose.Chemical shift is compared with the chemical shift of D-α-D-heptose, shown that C-6 has the downfield displacement of 4.3ppm.

Residue f is defined as D-α-D-heptose that 7-replaces, and is designated as HepV.(f1 f2) identifies spin up to f6 to 1D-TOCSY-TOCSY, shows that residue f is the D-D-heptose.F5 multiplet pattern is quite clear.From the 1D-TOCSY that f6 begins, pick out f7 and f7 ' resonance.Then, from HMQC spectrum, obtained ¹³C NMR identification, and use the checking of HMQCTOCSY spectrum.Chemical shift is compared with the chemical shift of α-D-D-heptose, shown that C-7 has the downfield displacement of 8.8ppm.Only detect terminal D-α-D-heptose (being designated as f '), this is owing to the heterogeneity at this key position causes.As 1D-TOCSY-TOCSY (f1, f2) shown in, can detect f ' 5 and f ' 6 resonance, and the intersection peak in HMQC and the HMQC-TOCSY spectrum, this intersects peak corresponding to the intersection peak of terminal D-α-D-heptose, the latter again with embodiment 1, the intersection peak of the D-α-D-heptose in the table 2 is similar.

From the 1D-NOESY spectrum of anomer resonance shown in Figure 5 and the HMBC spectrum (Fig. 3 c) of anomer proton resonance, can set up the sequence of core oligosaccharide.NOE also observes in the experiment of the 1D-TOCSY-NOESY shown in Fig. 7 b and the 7f between residue.The results are shown in embodiment 1, in the table 3, structure is shown among Fig. 1.From the integration and the new resonance appearance in time of anomer resonance, can determine to exist heterogeneous key position.K (2-6) h and b (1-3) d key are experience several months hydrolyzable in 3 the solution at pH, and j (1-7) f key is stable.

Observe unusual many long-range NOE, cross over nearly five successive residues.For α-D sugar, NOE in the expection H-1-H-2 residue.For β-D-sugar, NOE in expection H-1-H-3 and the H-1-H-5 residue.For (1-x) key, NOE between expection H-1-C-1-O-1-C-x-H-x glucosides.Also can appear at anomer NOE between the residue between the sugar of two keyed jointings on H-x ± 1 and H-x ± 2.Other keep clear of, and NOE is considered to long-range NOE between the residue of glycosidic link, and as embodiment 1, table 3 is listed.

In order to explain a large amount of long-range NOE, use Metropolis Monte Carlo (MMC) method to carry out conformational analysis, to change the glycosidic link angle, the multiple conformation of molecule is taken a sample.Use this method,, find that all observed long-range NOE may be interpreted as e-b branch and g-i ramose next-door neighbour for the kernel oligosaccharides that has Kdo at reducing end under neutral.These long-range NOE may be because Hep _IThe restriction of the kernel residue that last three tapping points bring causes.

Be shown in Fig. 8 by calculating the least energy conformer that obtains.Each the kind of proton spacing that records from these coordinates provides in the table 3 from embodiment 1.As observed, the existence of most NOE may be interpreted as distance between short proton.It is inconsistent that the long-range NOE of g1-b2 and g1-b3 and Fig. 8 paint the distance that obtains in the molecular model.Although (3,4,6)-Hep is arranged _IThe restriction of substitute mode, but glycosidic link also has flexibility, and this point must be considered.As shown in Figure 9, for g1-b2 and g1-b3 distance, chosen and the corresponding to multiple conformation of observed NOE with distance between short proton.Identical situation can be applicable to NOE between every other long-range and residue.The long-range NOE of g1-b2 and g1-b3 and e1-i4 crosses over four residues, has about three glucosides (φ, ψ) the angle movability of 6df altogether.The long-range NOE intensity of variation of crossing over five residues (e-b-d-i-g) between e1-g2 and the e1-g3 is bigger, and this is owing to have the glucosides angle of 8df, does not also consider the possible flexibility of C-5-C-6 key in g (1-6) the i key.B1-e5, b1-e7 and b1-e7. ' depend on the rotation of the C-6-C-7 of the movability of e (1-2) b glycosidic link and residue e.In all cases, between the appearance with multiple conformation of distance between short proton and viewed residue and long-range NOE be consistent.

Verified in this research, it is two-4 that the lipid A district of hemolytic Man bacillus A1 LPS molecule is contained, D-glycosamine two sugar moieties that 4 '-phosphorylation β-1,6 connects.The character and the substitution pattern of the fatty acyl group that links to each other with this disaccharides do not appear in the newspapers.Fully the LPS molecular composition of acidylate the outer field most leaflets of bacterial film, playing an important role aspect the film integrality keeping.The monose part of this molecule stretches out usually, leaves the determined plane of bacterial film.LPS oligosaccharides part plays an important role aspect virulence, and participates in inducing host immune response.For the relative size in the lipid A district of the core oligosaccharide that obtains this LPS molecule and film grappling and the visual impression of direction, using at associated biomolecule is that the lipid A lipid acid substitution pattern of finding in the hemophilus influenzae has made up molecular model.This model is shown among Figure 10.It is reported; the hemophilus influenzae lipid A has six fatty acyl groups; wherein amide group of reductibility glycosamine residue (C-2) and C-3 hydroxyl be by 3-hydroxyl tetradecane acid acidylate, and the C-2. ' acid amides of irreducibility residue and C-3. ' hydroxyl are by 3-mnyristoyl oxygen tetradecanoic acid acidylate.As shown in figure 10, because kernel provides suitable inflexible structure, the monose part is from determining that bacterial film planar lipid A partly stretches out.The particularly terminal Gal residue of terminal residue can be observed bigger movability.In the NOESY of Fig. 2 spectrum, the movability of not observing with this residue increases corresponding to anomer resonance NOE.

The core texture of having found several LPS is hyperbranched, and this can cause the conformation clearly of this kernel.In the research formerly, find that the LPS of moraxelle catarrhalis (Moraxella catharrhalis) has adopted unusual conformation, wherein can be observed very rare anticonformation isomer (anticonformer).For this LPS molecule camber ramose 3,4, the trisubstituted D-glucosyl residue of 6-, detect β-D-Glcp-(1-4)-DGlcp and ramose glucose unit keyed jointing dihedral angle (C-1 '-O-1 '-C-4-H-4) near 180 °.

This result of study provides the detailed icon of the LPS core oligosaccharide plot structure of hemolytic Man bacillus serotype A 1.We illustrate in front, there is immunogenicity in the oligosaccharides district of hemolytic Man bacillus LPS at mouse, sheep and Niu Zhongjun, and 8 kinds (being serotype A 1, A5, A6, A7, A8, A12, A14 and A16) in 12 kinds of hemolytic Man bacillus serotype have identical core oligosaccharide determinant.The core oligosaccharide of serotype A 1 and A8 shows much at one ¹H NMR spectrum proves to have total basic structure.Can find out obviously that from this result of study the O-chain defective type LPS that is produced by hemolytic Man bacillus serotype A 8 lacks terminal Gal unit in core oligosaccharide, this residue may provide the site for the O-chain adheres to.Can provide basis to the understanding of LPS textural difference between the hemolytic Man bacillus serotype at the vaccine of hemolytic Man bacillus bovine pasteurellosis (pasturellosis).Serotype A 1 is to cause this sick major microorganisms, accounts for 30% of the total death toll of global livestock.Serotype or its antigen in vaccine preparation a little less than the use virulence can provide effective disease treatment means.

The experiment of embodiment 1

Prepare LPS from hemolytic Man bacillus

From Veterinary Infectious Diseases Organization (VIDO), Saskatoon, SK, Canada obtains pasteurella haemolytica (hemolytic Man bacillus) serotype A 1 (NRCC 4212).From the bacterial cultures of fermentor cultivation by hot phenol solution method (Severn etal.Carbohydr.Res. 240, 277 (1993)) extract and purifying LPS.

The LPS deacylated tRNA produces the main chain oligosaccharides

As before at Severn et al.J.Bacteriol. 178, described in 1731 (1996), by revising the deacylated tRNA method of Holst et al, preparation main chain oligosaccharides.(20mL, 37 ℃, 30min) sample (400mg) is removed ester bonded lipid acid from the lipid A of LSP to use the anhydrous hydrazine processing at ambient temperature.In refrigerative reaction mixture (0 ℃), add acetone (triploid is long-pending) and destroy unnecessary hydrazine.It is centrifugal that (5000rpm, 10min) the O-deacylated tRNA LPS product of precipitation separation is used washing with acetone, and freeze-drying moisture.(100 ℃ of lasting 20h remove the N-acyl group for 4M, 10mL) middle heating O-deacylated tRNA sample (200mg) at the KOH aqueous solution.With reaction mixture cooling (0 ℃), use the 4MHCl neutralization, it is centrifugal that (12000 * g 30min) removes sedimentary lipid acid.Supernatant liquor is at (the Amicon of the Amicon concentration compartments with 500 molecular weight mwco membranes (concentration cell); YC05) filter in, and use deionized water wash, chloride ion-containing (does not use AgNO in elutriant ₃Solution is measured).The material freeze-drying of will dialysing obtains deacylated tRNA LPS (about 80mg).On DEAE A-25, pass through anion-exchange chromatography purifying oligosaccharides.Main chain oligosaccharide compositions (about 50mg) is shown as the double-charge ion of m/z 1124.8 in positively charged ion ESI-MS, and conduct and Hex ₃Hep ₅Kdo HexN ₂(H ₂PO ₃) ₃The corresponding leading ion of (M, 2246.9) composition.The MS-MS of double-charge ion is at m/z500 (HexN ₂(H ₂PO ₃) ₂) and 801 (KdoHexN ₂(H ₂PO ₃) ₂) locate to produce the characteristic fragment, they correspond respectively to the deacylated tRNA lipid A and Kdo-P replaces the unit.

D-glycerine-L-sweet dew-heptose

In alkaline ethanol (alkaline methanol), use Nitromethane 99Min. condensation D-semi-lactosi, the preparation heptose.The crystallization 1-deoxidation-1-nitro-D-glycerine-L-sweet dew-enanthol that will obtain from the aqueous solution of deionization product (158 ℃ of mp, productive rate 21%) is converted into its sodium salt.This solution re-uses Rexyn 101 (H after using dilute sulphuric acid (35 ℃) to handle ⁺) and Amberlite A4 (OH ^-) the ion exchange resin deionization, freeze-drying generates the heptose (productive rate 80%) of syrup form then.By cellulose column chromatogram classification product, with fourth-1-alcohol-water (1: 10 v/v) as eluent.The component concentrating under reduced pressure drying that contains heptose.Have [α] _DD-glycerine-L-sweet dew-the heptose of-14 ° (c 0.2, water) is by paper chromatography purifying, its reduction (NaBH on GLC ₄) and acetylate have unimodally, retention time is with real heptan-O-acyl group-D-glycerine-L-sweet dew-enanthol is corresponding, determines its purity thus.

D-glycerine-D-sweet dew-heptose

Prepare heptose from the D-altrose, use the Nitromethane 99Min. condensation, generate 1-deoxidation-1-nitro-D-glycerine-D sweet dew-enanthol (109 ℃ of mp, [α] _D-7.0 ° (c 1.1, EtOH), productive rate 27%), its sodium-salt aqueous solution slowly drops to and remains in 0 ℃ of 20% (v/v) sulfuric acid that also constantly stirs, and is converted into D-glycerine-D-sweet dew-heptose.Reaction mixture uses saturated Ba (OH) ₂Neutralization is filtered, through Rexyn 101 (H ⁺) and Duolite A4 (OH ^-) resin removes residual ionic species, is condensed into syrup (productive rate 92%).Paper chromatography shows, is mixed with altrose and unchanged 1-deoxidation-1-nitro-D-glycerine-D-sweet dew-enanthol (about 2 to 3%) in the heptose product.This product uses fourth-1-alcohol-water (1: 10 v/v) as moving phase by the cellulose chromatography purifying.D-glycerine-D-sweet dew seminose has [α], and D+22 ° (c 2, MeOH).Reduction (NaBH on GLC ₄) and acetylizad sample produce unimodally, in real heptan-O-acyl group-D-glycerine-D-sweet dew-D enanthol, shown the identity and the purity of synthetic heptose.

The electrospray mass spectrum

(Micromass, Manchester U.K.) go up analytic sample at three grades of quadrupole mass spectrometers of the VG Quattro that electrospray ion source is housed.The main chain oligosaccharides is dissolved in the acetonitrile-water (about 1: 2 v/v) that contains 0.5% acetate.Injecting volume is 10 μ L, and flow velocity is set to 4mL min ^-1The contact voltage of electrospray (tip voltage) is generally 2.7kV, and mass spectrograph scans from m/z 50 to 2500, and be 10s sweep time.For the MS-MS experiment, use the first step four utmost points to select precursor ion, in having only four utmost point chambers of RF, use the fragmention of argon collisional activation to carry out mass spectroscopy by the scanning third stage four utmost points.Collision energy is generally 60ev (reference experiment framework).

Nucleus magnetic resonance

Use standard software, on Bruker AMX 600, AMX 500 or Varian Inova 600 spectrographs, generate NMR spectrum.All measurements are all carried out for 3 times at 300K and pH, comprise the 10mg sample, are dissolved in 0.6mL D ₂Among the O.Measurement is for 3 times in order to improve proton spectrographic resolving power, as previous way (Cox, 1996) at pH.

Acetone is used as at 2.225ppm ¹H spectrum, be used as at 31.07ppm ¹³Mark or external standard in the C spectrographic.The 2D technology that the same nuclear of standard is relevant with heteronuclear is used to the routine identification of core oligosaccharide: COSY, TOCSY, NOESY, three grades of quantum with nuclear phase close experiment, HMQC, HMQC-TOCSY and HMBC and ³¹P HMQC.The Varian software of use standard carries out the spin simulation of heptose monose.From being used for spinning mimic parameter rather than obtain chemical shift accurately and coupling constant from the spectrographic peak lists.

Carrying out selectivity 1D-TOCSY, 1D-NOESY, 1D-TOCSY-TOCSY, 1D-TOCSY-NOESY and 1D-NOESY-TOCSY tests and carries out completely residue identification and determine that 1H-1H nuclear Overhauser strengthens between the f residue.Being used to describe the term that 1D selects the application of sequence is that 1D EXP (spin, mixing time) and 1D EXP1-EPX2 (spin 1, mixing time; Spin 2, mixing time), wherein EXP, EXP1 and EXP2 represent TOCSY or NOESY.In addition, in the drawings, selected resonance marks with underscore.The resonance that indicates double underline represents that this resonance is chosen as second and selects step.As shown in Figure 1, all residues are marked with letter, and spin is marked with atomicity, so a1 is meant the H-1 resonance of residue a.

On the AMX spectrograph, realize selective exitation by half Gauss pulse.The mixing time that is used for TOCSY depends on spin system.The mixing time of common 30 to 180ms scopes (spin locking time) can be used for discerning this spin system.The mixing time of 1D-NOESY depends on the correlation time of the molecule and the internal motion of glycosidic link.The NOESY mixing time arrives in the 400ms scope 150.Be NOE between the residue that detects terminal Gal residue, carry out the 1D-ROESY experiment with the mixing time of 500ms.For the double selection experiment, strobe pulse is short as far as possible, with the loss of signal strength of avoiding causing owing to relaxation effect.One of every part one suboptimization.1D-TOCSY can carry out about several minutes.1D-NOESY cost several minutes was by several hours, and this depends on the size of NOE.Some double selection experiment will spend up to 12h.1D-TOCSYTOCSY and 1D-TOCSY-NOESY are the most effective.Owing to sample is degraded in time, some experiment is also carried out in order to using the pulsed field gradient on Inova 600 spectrographs.

Molecular model

Use previous described Metropolis Monte Carlo method (Peters et al.Carbohydr.Res. 238, 49 (1993)) and carry out conformational analysis.Use the PFOS electromotive force.Use from quantum chemistry procedure sexual intercourse change that (Quantum Chemistry Program Exchange, QCPE) MM3 obtain the coordinate that minimizes of monose.The least energy conformation of using every kind of disaccharides is as initial conformation.From the Kdo of reducing end, various oligosaccharides are calculated, until complete structure.For the kernel octose, use 5 * 10 ⁴Grand motion (macro move), the step-length of glycosidic link is 5, temperature is 1 * 10 ³K causes receiving than being 0.36.Use the least energy conformer to generate the molecular model of kernel octose.From the coordinate that each grand motion is preserved, extract distance.Use the least energy conformer of lipid A structure and Kdo key to generate the complete LPS that has lipid A.Use E.Keeler, University of Freiburg, the Schaka197 of Germany finishes Molecular Graphs.

The nmr chemical displacement (ppm) of the core oligosaccharide component of table 1. hemolytic Man bacillus (pasteurella haemolytica) serotype A 1 LPS

Residue	δ C δ H	C-1 H-1	C-2 H-2	C-3 H-3 H-3	C-4 H-4	C-5 H-5	C-6 H-6 H-6	C-7 H-7 H-7	C-8 H-8 H-8
										Hep I D		100.3 5.17	71.1 4.13	75.3 4.01	74.9 4.17	72.5 4.17	81.2 4.11	63.5 4.02 3.89
Hep II B		100.7 5.57	80.5 4.26	70.6 3.89	67.6 3.90	72.2 3.64	69.6 4.05	64.1 3.70 3.60
										Hep III E		102.5 5.16	71.5 4.01	71.5 3.87	67.0 3.83	72.4 3.78	70.2 4.04	64.5 3.83 3.68
Hep IV G		99.8 4.95	70.5 4.08	71.7 3.81	67.9 3.78	71.8 3.94	77.0 4.14	61.2 3.91 3.80
										Hep V F		99.0 5.04	70.8 3.93	71.5 3.85	68.1 3.82	73.7 3.99	71.7 4.22	71.6 4.16 3.85
Hep V f		99.0 5.04	70.8 3.93	71.5 3.85	68.3 3.77	73.7 3.97	72.8 4.05	62.9 3.79 3.73
										Glc I 1		104.0 4.64	74.2 3.51	77.7 3.45	70.2 3.64	74.6 3.54	65.5 4.06 3.69
Glc II C		102.4 5.22	72.9 3.58	73.9 3.83	69.3 3.58	72.4 3.95	60.3 3.96 3.76
										Gal J		104.3 4.46	71.7 3.56	73.5 3.67	69.5 3.93	76.0 3.71	61.8 3.80 3.76
GlcN I A		92.6 5.75	54.8 3.45	70.2 3.93	70.5 3.51	73.4 4.13	69.7 4.28 3.89
										GlcN II H		99.7 4.88	56.3 3.17	72.2 3.90	75.0 3.94	74.6 3.78	63.4 3.81 3.64
Kdo K			99.7	34.5 2.37 2.13	70.8 4.61	72.7 4.32	73.2 3.87	69.9 3.78	64.2 3.94 3.73

Illustrate: in 25 ℃, pH 3 and D20, from HMQC and HMBC DATA REASONING, wherein the CH3 signal of outside acetone is set to 2.225ppm for 1H NMR, is set to 31.07ppm for 13C NMR at 600MHz (1H).δ C mean error is ± 0.2ppm that δ H mean error is ± 0.02ppm.Be designated as f ' owing to the heterogeneous f that causes than small component.CH2 spin system (H, H ') is by the descending sort of chemical shift.For Kdo, H-3 and H-3 ' ownership are H-3eq and H-3ax.

The NMR data of table 2.D-L-heptose and D-D heptose monose

Heptose	δ C δ H J H，H	C-1 H-1 J 1，2	C-2 H-2 J 2，3	C-3 H-3 J 3，4	C-4 H-4 J 4，5	C-5 H-5 J 5，6	C-6 H-6 J 6，7	C-7 H-7 J 6，7	H-7 J 7，7
										D-α-L-		95.00 a 5.166 1.8	71.45 3.914 3.1	71.36 3.838 10.0	67.05 3.845 9.7	71.81 3.749 1.6	69.63 4.024 7.3	63.84 3.689 5.5	3.652 -11.7
D-β-L-		94.74 b 4.866 1.0	72.02 3.927 3.2	74.09 3.649 10.0	66.69 3.788 9.8	75.43 3.329 1.8	69.53 3.98 7.5	63.57 3.713 5.8	3.695 -11.7
										D-α-D-		94.86 a 5.151 1.8	71.32 3.905 3.4	71.38 3.812 9.4	68.35 3.756 10.1	73.42 3.865 3.2	72.72 4.018 3.3	62.75 3.797 7.6	3.708 -12.0
D-β-D-		94.79 b 4.851 1.1	71.84 3.921 3.3	74.11 3.622 9.5	68.16 3.682 9.9	77.22 3.423 3.3	72.623 4.025 3.4	62.58 3.788 7.4	3.725 -12.0

Illustrate: at 25 ℃ D ₂Among the O, fit 13C spectrum (150MHz) at 600MHz (1H) from the 1H spin module and measure, wherein the CH3 signal of acetone is set to 2.225ppm for 1H NMR, is set to 31.07ppm for 13C NMR.The unit of δ C and δ H is ppm, and δ C mean error is ± 0.005ppm that δ H mean error is ± 0.003ppm.JH, H value unit is Hz, mean error is ± 0.2Hz.H-7 and H-7 ' are by the descending sort of chemical shift.

^aJ _C1，H1＝171±1Hz

^bJ _{C1, H1}=160 ± 1Hz, uncoupling never ¹³C NMR spectral measurement.

HMBC and the NOE data of table 3.A1, and with the distance of the least energy conformer of core heptose shown in Figure 8

Key	HMBC H-1-C-x	NOE in the residue	r()	NOE between residue	r()	Long-range NOE	r()
								b(1-3)d	b1-d3	b1-b2 b5-b3 b5-b6	2.6 2.5 2.4	b1-d3 b1-d4 b5-d2 k3ax-d5	2.6 3.7 2.3 3.2	b1-e5 b1-e7 b1-e7 b1-i2	3.3 2.9 2.6 2.2
c(1-6)d	c1-d6	c1-c2	2.4	c1-d6	2.0	c1-i1	2.4
								d(1-5)k		d1-d2	2.6	d1-k5 d1-k7	2.2 2.9
e(1-2)b	e1-b2	e1-e2	2.6	e1-b2 e1-b1	2.1 2.8	e1-g2 e1-g3 e1-i4	4.2 2.3 2.0
								f(1-6)g a	f1-g6	f1-f2	2.6	f1-g6 f1-g5	2.5 2.6
g(1-6)i	g1-i6	g1-g2 g5-g3 g5-g6	2.6 2.6 2.5	g1-i6 g1-i6 g5-i6	2.6 2.6 3.0	g1-b2 g1-b3	4.2 4.9
								i(1-4)d	i1-d4	i1-i3 i1-i5	2.6 2.4	i1-d4 i1-d6	2.8 2.1	i1-c1	2.4
j(1-7)f a	j1-f7	j1-j2 j1-j3 j1-j5	3.1 2.7 2.4	j1-f7 j1-f7	2.7 2.5

A provides the mean distance that calculates from MMC for j and f residue in Gal-(1-7)-HepV-(1-6)-Hep IV sequence (j-f-g).

Embodiment 2

Present embodiment has formed Carbohydr.Res. 339: the basis of publication in 1973 (2004).Research actinobacillus pleuropneumoniae serotype 5a, b, 2 and 1.

Coupled columns fractionated LPS carries out glycan analysis and shows, glucose (Glc), semi-lactosi (Gal), N-acetyl-glycosamine (GlcNAc), D-glycerine-D-sweet dew-heptose (DD-Hep) and L-glycerine-D-sweet dew-heptose (LD-Hep) ratio separately is approximately 2: 1.5: 1: 2: 3.As described in material and the method, acid hydrolysis products is carried out gel filtration chromatography separate to come the purifying core os, obtain to be rich in core os and do not contain the antigenic component of O-, and carry out glycan analysis with relative, this analyzes demonstration; Glc, Gal, DD-Hep and LD-Hep ratio separately are 2: 1: 2: 3.Because the capsular polysaccharide of serotype 5b contains N-acetyl-D-glycosamine and ketose residue, we suspect that LPS has some pod membranes (CPS) to mix, why not having CPS in the fractionated core os sample, is because the ketose key (ketosidic bond) among the CPS is to for obtaining the acid hydrolysis condition responsive that core os adopts.In addition, more a spot of semi-lactosi (unique O-antigen residue) shows that the component that is detected mainly is a core os, does not have tangible O-antigen to extend.

Preparation LPS-OH also passes through the gel filtration chromatography classification.To the component of wash-out when containing the low corresponding to volume of ratio O-antigen, analyze (embodiment 2, table 1) by CE-ES-MS.Observe a kind of simple mass spectrum, this mass spectrum corresponding to the molecule of forming 2Hex, 5Hep, Kdo, P, the corresponding to 2537amu of lipid A-OH.Double-charge ion m/z 1268 is carried out CE-MS/MS analyze (data do not provide) at m/z 951 and two single electric charge peaks of 1584 generations, confirmed that the size of O-deacylated tRNA lipid A is 952amu, the size of core os is 1584.O-deacylated tRNA lipid A kind (952amu) is made up of the disaccharides of N-acetylize (3-OH C 14:0) glycosamine residue, and each residue is replaced by phosphoric acid molecules.The ES-MS of fractionated OS sample and CE-ES-MS analyzed show that its quality is 1505 Da, and form 2Hex, 5Hep, Kdo consistent (embodiment 2, table 1) (Figure 11).The CE-ES-MS spectrum of the core os component of more late wash-out has 1562 quality, than the high 57amu of main sugared type (embodiment 2, table 1).This quality is corresponding to the amino acid glycine, and this observes in the LPS of meningococcus and hemophilus influenzae recently.The CE-ES-MS/MS analysis is gone up (data do not provide) with second heptose residue (Hep II) that this glycine residue is positioned the Kdo molecule.

On core os, carry out methylation analysis, to determine the connection pattern of this molecule.Only the component corresponding to core os is carried out analysis revealed, the LD-Hep and 3,4 that exists Glc, terminal DD-Hep that terminal Glc, the 6-of about equimolar amount replace, DD-Hep, 2-that terminal LD-Hep, 6-replace to replace, the trisubstituted LD-Hep of 6-.Carry out analysis revealed to mainly containing the antigenic OS component more early of O-, the Gal (O-antigen component) that exists 6-to replace has confirmed the antigenic connection pattern of O-.

For the accurate position of illustrating OS be connected pattern, carry out NMR research (Figure 12 be a) not containing the antigenic collection of O-OS component.Realize OS's by COSY and TOCSY experiment ¹The identification of H resonance.Figure 13 shows the anomer of each residue from OS ¹A series of selectivity 1D-TOCSY experiments of H resonance.In the process that NMR analyzes, clearly Ap 5a OS structurally with the structurally associated of hemolytic Man bacillus core os, the identification of Ap 5a OS spectrographic can be with reference to this ¹H NMR data help carry out (embodiment 2, table 2).

In the selection spectrum of Ap 5a OS, from heptose residue (Hep I, (Figure 13 a), Hep II, (Figure 13 b), Hep III, (Figure 13 c), Hep IV (Figure 13 d) and Hep V, (Figure 13 e)) spin system that produces is easy to from the anomer of 5.11 (HepI), 5.70 (Hep II), 5.17 (Hep III), 4.96 (Hep IV) and 5.03 (Hep V) ppm ¹H resonance distinguishes that described resonance is coupled with the form of the spin system that points to sweet dew-pyranose basic ring system.Observed heterogeneity in the anomer proton of Hep I and Hep II (Figure 12 a) since the Kdo residue when acid hydrolysis, reset and cause.Based on the form (Figure 13 f) of spin system, other residues in the alpha-anomer district that 5.21ppm (Glc II) locates are defined as glucopyranose.All the other anomer resonance in this spectrum downfield district (4.45-6.00ppm) all are attributable to the residue of β-connection, and this is because their anomer ¹H resonance and, under the situation that residue has been resolved, the J that they are higher ^1.2(about 8Hz) coupling constant.From the form (Figure 13 g) of spin system, a resonance of locating at 4.66ppm (Glc I) is identified as glucose-configuration.The form (Figure 13 h) of the characteristic spin system of the H-4 resonance from TOCSY experiment is identified as semi-lactosi-pyrans glycosyl residue with the residual resonance at 4.49 in the downfield district (Gal I) ppm place.This experiment also relates to the Kdo spin system, because the Kdo H-6 at 4.48ppm place ¹H resonance is also illuminated, and be presented at 4.10 and 4.21ppm H-4 and H-5 are arranged respectively ¹H resonance.Yet the Kdo spin system is difficult to definite fully, and this is because the Kdo residue is reset when the core hydrolysis, and the strength level of the methylene radical H-3 proton that may cause owing to deuterium exchange is extremely low.Yet, in another 1-D TOCSY experiment, further discern this spin system from the H-3 axis of 1.92ppm, the equator proton at demonstration 2.08ppm place and the H-4 proton at 4.10ppm place ¹H resonate (data do not provide).

Between anomer and the residue between the aglycon proton on the contiguous glycosyl residue ¹H- ¹H NOE measures the sequence that can determine glycosyl residue among the OS, and confirms and expansion methylation analysis data.Determined the connection pattern (Figure 14) (embodiment 2, table 2) of Ap 5a OS in this way.Therefore proton to Hep III H-1 and Hep II H-2 (Figure 14 a) and between Hep II H-1 and the Hep I H-3 (Figure 14 b) intensive stride the internuncial appearance of glucosides NOE, established the sequence and the attachment point of three LD-heptose residues.This connection pattern often runs in the kernel OS of hemolytic Man bacillus and hemophilus influenzae.And NOE has verified 1, the 2-keyed jointing between the residue between anomer proton Hep III H-1 and the Hep II H-1.Check that from the H-1 of Glc I the connectivity of NOE shows that this glucosyl residue is connected with the Hep I of 4-position, this is to draw according to NOE (Figure 14 c) between the residue of Hep I H-4 and Hep I H-6.The form of NOE often occurs for the heptose residue that 4-replaces between the residue of H-6.Occur long-range NOE connectivity between the H-1 of the H-1 of Glc I and Glc II and show that the glucosyl residue of α-configuration (Glc II) replaces Hep I in the 6-position, this observes in hemolytic Man bacillus OS.The NOE connectivity of checking the H-1 of Glc II confirms that this glucosyl residue is connected with Hep I in the 6-position, and this is to draw according to NOE between the residue of Hep I H-6 (Figure 14 d).Similarly, for Glc I, between the anomer 1H of Glc I and Glc II resonance, observe long-range NOE connectivity.The link position of other heptose residues (Hep IV and Hep V) is derived as follows.The NOE connectivity of checking the H-1 of Hep IV shows that this heptose residue is connected with Glc I in the 6-position, and this is to draw according to NOE between the residue of Glc I H-6 and H-6 ' (Figure 14 e).At last, determine that Hep V has replaced Hep IV in the 6-position, this is to draw according to the NOE connectivity (Figure 14 f) from Hep V H-1 to Hep IVH-6.In addition, the OS to serotype 5a carries out the attachment point that the NMR analysis makes it possible to distinguish O-chain galactose residue.The component that only contains a kind of galactose residue is used for this purpose.Anomer ¹The NOE connectivity of H resonance comprises 3.68 and the H-3 at 3.93ppm place and the internal connectivity of H-5, and the 3.93ppm place between connectivity (Figure 15 a).Then selectivity 1-D experiment is used to distinguish the spin system of the proton resonance at 3.93ppm place.In the NOESY step, carry out the 1D NOESY-TOCSY experiment of the H-1 proton of Gal, then in the TOCSY step,, confirmed the connectivity (Figure 15 b) of the resonance at the resonance at 3.93ppm place and 4.06ppm place in the selective exitation that the 3.93ppm place resonates.Use the mixing time of 150ms, the 1-D TOCSY that carries out the anomer proton resonance of Hep III residue at 5.16ppm tests H-4 and the H-5 proton resonance (Figure 13 c) that has shown at this spin system of 3.82ppm place.This resonance is shone by selectivity in the NOESY step then, demonstrate the Hep III H-6 resonance at 4.06ppm place, thereby the 7-position that has confirmed Hep III residue is the attachment point (Figure 15 c) of O-chain.From ¹³C- ¹H HMBC experiment obtains checking property data, and this experiment picks out the anomer of the O-chain galactose residue at 4.48ppm place ¹The intersection peak of H resonance, this intersection peak and 70.3ppm place ¹³C resonance relevant (Figure 15 d), ¹³C- ¹This intersection peak is found the proton resonance relevant (Figure 15 e) with the 3.93ppm place in the HHSQC experiment, ¹³C- ¹This intersection peak is shown as and has-CH in the H HSQC spectrum ₂The posivtive spike of-Ji Tezheng, the 7-position that has confirmed the heptose residue is the attachment point of O-chain.This conclusion confirms by carry out methylation analysis on the component that only contains a kind of galactose residue, shows the LD-Hep residue that exists 7-to replace; When being carried out methylation analysis, the core os component that does not have the O-chain do not observe this mistake aldehyde alcohol acetic ester derivative that methylates.

Research actinobacillus pleuropneumoniae serotype 5b

All that LPS, the LPS-OH of serotype 5b and OS are done are analyzed all the analysis of describing with the front in serotype 5a identical or extremely similar (embodiment 2, table 1 and 2; Figure 12 b).

Research actinobacillus pleuropneumoniae serotype 2

The glycan analysis of complete LPS shown have Glc, DD-Hep, LD-Hep, Rha, Gal, GlcNAc and GalNAc, its ratio is approximately 8: 2: 2: 1: 2: 1: 2, and O-antigen and capsular polysaccharide are consistent with existing in this material.The fractionated acid hydrolysis products is carried out glycan analysis, show in scrubbed component early to have Glc, Rha, Gal and GalNAc, its ratio is approximately 2: 1: 1: 1, and the antigenic component of O-is consistent with being rich in.Lack the antigenic later component of O-and show and only have Glc, DD-Hep and LD-Hep, its ratio is approximately 3: 2: 3, with to lack O-antigen in this core os component consistent.

Preparation LPS-OH also passes through the gel filtration chromatography classification.To the component of wash-out when containing the low corresponding to volume of ratio O-antigen, analyze (embodiment 2, table 1) with the negatively charged ion pattern by CE-ES-MS.Observe a kind of simple mass spectrum, the molecule of this mass spectrum correspondence is 2700amu, with form 3Hex, 5Hep, Kdo, P, lipid A-OH is consistent, also has the second kind molecule of a small amount of quality less than 80amu, itself and phosphate-based the matching of disappearance.Triply charged ion m/z 899 is carried out CE-MS/MS analyze (data do not provide) at single electric charge peak of m/z 951 generations, confirmed that the size of O-deacylated tRNA lipid A is 952amu, more macromolecular quality is 2700amu.It is 1667 Da that the CE-ES-MS that lacks the antigenic fractionated core os of O-sample is analyzed its quality of demonstration, with composition 3Hex, 5Hep, Kdo consistent (embodiment 2, table 1).Thereby mass spectroscopy shows that the core os of serotype 2 is compared with the OS of serotype 5a and 5b, comprises a glucosyl residue more.

Carry out methylation analysis to lacking the antigenic core os component of O-, show the LD-Hep, 4 that the Glc, the terminal DD-Hep that exist terminal Glc, 6-to replace, DD-Hep, 2-that terminal LD-Hep, 2-replace replace, the dibasic DD-Hep of 6-and 3,4, the trisubstituted LD-Hep of 6-, its ratio is approximately 6: 3: 3: 2: 1: 2: 3: 2.The main difference between the data of methylating of serotype 2 and 5b OS is DD-Hep that list-6-replaces by 4, and the dibasic DD-Hep of 6-replaces, and the 4-position that has confirmed inner DD-Hep residue is the attachment point of additional glucosyl residue experimentally.The serotype of distinguishing by methylation analysis 2 and the ratio of the terminal glucose residue between the 5b, also with in serotype 2 core os, exist additional this conclusion of terminal glucose residue consistent.

¹H-NMR data (embodiment 2, table 2 (Figure 12 c)) have been proved conclusively mass spectrum and methylation analysis data, and the core os that has confirmed serotype 2 is identical with serotype 5b's, but pick out the glucosyl residue (Glc III) of a terminal α-configuration more.The NOE data can be determined the 4-position of the attachment point of Glc III at Hep IV, and this is according to from the anomer proton of the Glc III of 4.53ppm ¹H resonates 4 of Hep IV of the 3.96ppm place ¹NOE connectivity (data do not provide) draws between the H resonance.The NOE connectivity is also observed in 6-position to Hep IV, and this before also observed in the heptose residue that 4-replaces.

Research actinobacillus pleuropneumoniae serotype 1

Coupled columns fractionated LPS carries out the glycan analysis demonstration and has Rha, Glc, Gal, GlcNAc, DD-Hep and LD-Hep, and ratio is approximately 1: 3: 1: 0.5: 1: 3.Picking out Rha and GlcNAc shows still have some O-antigen components in this component.Carry out glycan analysis and show that the ratio of Glc, Gal, DD-Hep and LD-Hep is 2: 1.5: 1: 3 lacking the antigenic core os component of O-.Carry out glycan analysis and show that the ratio of Rha, Glc and GlcNAc is approximately 2: 1: 1 containing the antigenic component early of total length O-, with the antigenic structure of disclosed this serotype O-is consistent.

Preparation LPS-OH also passes through the gel filtration chromatography classification.To the component of wash-out when containing the low corresponding to volume of ratio O-antigen, analyze (embodiment 2, table 1) with the negatively charged ion pattern by ES-MS and CE-ES-MS.Observe a kind of simple mass spectrum, the molecule of this mass spectrum correspondence is 2874amu, its with form 4Hex, HexNAc, 4Hep, Kdo, P, lipid A-OH are consistent, also have a small amount of quality greater than second kind of molecule (consistent) of 123amu and quality with the phosphorylethanolamine residue of other existence less than the third molecule of 80amu (with lacking the phosphoric acid residue and matching).Triply charged ion m/z 957 is carried out CE-MS/MS analyze (data do not provide) at single electric charge peak of m/z 951 generations, the size that has confirmed O-deacylated tRNA lipid A is 952amu, more macromolecular quality is 2874amu, and produces a double charge peak at m/z 959, corresponding to core os.ES-MS and the CE-ES-MS analysis that lacks the antigenic several core os components of O-shown that its quality is 1840 Da, with composition 4Hex, HexNAc, 4Hep, Kdo consistent (embodiment 2, table 1).The double-charge ion of m/z 930 is carried out CE-MS/MS with cation mode to be analyzed and demonstrates single charge ion, this with serotype 1 core os in exist following residue consistent, comprise HexNAc m/z 204, Hex-Hex-HexNAc m/z 528, Hep-Hex-Hex-HexNAc m/z 720 (Figure 16).Therefore, mass spectroscopy shows that serotype 1 core os lacks than serotype 5a and 5b core os and contains a DD-Hep residue, but contains two Hex and a HexNAc residue more.Yet, carrying out in the glycan analysis lacking the antigenic core os of O-, the evidence that lacks HexNAc begins to allow the people obscure.

Carry out Gal, the terminal LD-Hep, 4 that methylation analysis shows that Glc, the 3-of terminal Glc, the 6-replacement that has about equimolar amount replace to lacking the antigenic core os component of O-, the LD-Hep and 3 that DD-Hep, the 2-that the dibasic Gal of 6-, 4-replace replaces, 4, the trisubstituted LD-Hep of 6-.Any evidence that lacks HexNAc still allows the people puzzled.

Therefore, mass spectrum, sugar and methylation analysis data are consistent with viewed inner core among serotype 2,5a and the 5b, ¹H NMR data have been proved conclusively these deductions (Figure 12 d) (embodiment 2, table 2). ¹H NMR data also make it possible to distinguish non-existent other core os residue in the core os of serotype 2,5a and 5b.According to H-4 in the TOCSY experiment ¹The characteristic spin system of H resonance has been discerned α-configuration galactose residue (Gal II) at the 5.18ppm place.According to its anomer proton ¹The form of H resonance and its characteristic spin system has been discerned beta configuration galactose residue (Gal I) at the 4.55ppm place.According to the H-2 of 4.34ppm place proton ¹H resonance (with ¹³C- ¹52.6ppm in the H HSQC experiment ¹³The C chemical shift is correlated with (Figure 17 a)), has discerned α-configuration N-acetylhexosamine residue (HexNAc) at the 4.88ppm place. ¹³The C chemical shift is consistent with the carbon atom that nitrogen replaces.Yet, be difficult to spin system near this HexNAc residue on the H-2 proton, as if the H-2 proton chemical shifts be positioned at quite low magnetic field.The NOE connectivity has been set up the anomer proton of the Gal I of 4.55ppm place residue and the Hep IV of 3.94ppm place 4 the pattern that is connected between residue.Similarly, 3 NOE connectivity of the Gal I residue at the Gal II anomer proton at 5.18ppm place and 3.79ppm place has been set up this and has been connected.Yet, 4.88ppm 4 of the Gal II residue at the anomer proton of the HexNAc residue of locating and 4.25ppm place, and 4.12 and 6 of this residue at 4.01ppm place between residue between the NOE connectivity table understand that the HexNAc residue has replaced Gal II residue at 4 and 6, this and methylation analysis data consistent, but still make us puzzled (Figure 17 c).The FAB-MS of OS of methylating makes the glycosylation sequence to this part of OS that further understanding arranged.Main glycosyl oxonium ion of viewed A type and less important ion (lacking methyl alcohol) are as follows: 464 → 432 (Hex, HexNAc) ⁺, 668 → 636 (Hex ₂, HexNAc) ⁺, 916 → 884 (Hex ₂, HexNAc, Hep) ⁺, 1120 → 1088 (Hex ₃, HexNAc, Hep) ⁺, 1368 (Hex ₃, HexNAc, Hep ₂) ⁺, 1572 → 1540 (Hex ₄, HexNAc, Hep ₂) ⁺, and 1865 → 1833 (Hex ₃, HexNAc, Hep ₄) ⁺These FAB data and NOE and positively charged ion CE-ES-MS/MS data consistent, but the evidence that lacks terminal HexNAc residue makes the people puzzled, but with glycan analysis and methylation analysis data consistent.The definite data that lack the HexNAc residue make us carry out complicated more NMR research, with the essence of the HexNAc residue of attempting to distinguish supposition, determine the connection pattern in this zone of the core os of serotype 1.

H-1 by the scope of 4.88ppm place, the mixing time HexNAc residue from 30 to 150ms ¹A series of selectivity 1D experiments of H-resonance demonstrate the H-2 at 4.34ppm place ¹H-resonance and be identified as the weak signal of H-3 of 4.13ppm place and the H-4 of 3.36ppm place.In order to verify these inferences, finish the identification of this HexNAc residue, carried out other selection experiment.H-4 from 3.36ppm ¹H-resonance obtains 1-D TOCSY experiment, has verified H-2 and H-3 identification, respectively 3.93,3.66 and 3.64ppm punishment discern H-5 and H-6,6 ' resonance (Figure 17 d).H-2 from 4.34ppm ¹H-resonance obtains 1-D TOCSY experiment, has verified H-3 and H-4 identification (Figure 17 e).H-4 from 3.36ppm ¹H-resonance obtains 1-D NOESY experiment, has verified H-2, H-3, H-5 and H-6,6 ' identification (Figure 17 f).From these measuring coupling constants, obtain j _1,24.8Hz, j _2,31.0Hz, J _3,49.7Hz, J _4,51.4Hz, J _5,66.5Hz, J _{5,6 '}6.5Hz, K _{6,6 '}-12Hz.Carried out 2D- ¹³C- ¹H-HSQC NMR spectrum (Figure 17 e), the C-1 that picks out the HexNAc molecule are to the C-6 position ¹³The C-chemical shift is respectively 101.1ppm, 52.6ppm, 68.5ppm, 70.0ppm, 70.7ppm and 64.1ppm.It is puzzled that these data are made us at first, yet the retrieval that this breadboard sugared database carries out has been found a category likelihood data of the open chain N-acetylgalactosamine residue in the core os of mycetozoan (Proteus) bacterial classification.Although find that the open chain residue is unexpected, but with sugar, methylate and the FAB analytical data consistent, this is because of the hydrolysising condition sensitivity of this residue to being adopted in sugar and the methylation analysis, and the formation meeting of the glycosyl oxonium ion of this terminal residue is hindered by the open chain configuration of this residue in FAB analyzes.

Therefore, the structural analysis of the core os of serotype 1,2,5a and 5b is finished, and picks out the conservative property inner core in all bacterial strains, has different modifications on this conservative property structure, as shown in figure 18.

Structural analysis to the core oligosaccharide (representing core type I, II, II and II) of serotype 1,2,5a and 5b demonstrates relative conservative structure.The kernel OS of every chain is all identical, is made up of the trisaccharide L-glycerine that is connected with the Kdo residue-D-sweet dew-heptose residue.In every kind of serotype, contiguous heptose residue (Hep I) is replaced by second L-glycerine of L-glycerine-D-sweet dew-heptose trisaccharide-D-sweet dew-heptose residue (Hep II) at 3, replaced by β-glucosyl residue (Glc I) at 4, replaced by α-Pu Taotang residue (Glc II) at 6.In every chain, all found a D-glycerine-D-sweet dew-heptose residue (Hep IV) for 6 of Glc I residue.In serotype 2,5a and 5b, second D-glycerine-D-sweet dew-heptose residue (Hep V) replaced 6 Hep IV.Unique difference between serotype 2 and 5a, the 5b is, in serotype 2, a glucosyl residue arranged in that 4 of Hep IV residue are multi-link.Between the OS structure of these OS structures and the hemolytic Man bacillus serotype A 1 found previously, exist surprising similarity.Unique difference is to lack other terminal galactose residues in the Hep V of hemolytic Man bacillus A1 OS between 5b, 5a OS structure and hemolytic Man bacillus serotype A 1 core os.Do not have Hep V residue in serotype 1, Hep IV is replaced by trisaccharide α-GaloNAc-(1-4,6)-α-Gal-(1-3)-β-Gal-at 4, and wherein, the HexNAc residue is rare open chain configuration.In serotype 1, being identified as the structure of extending from the initial trisaccharide of Hep I arranges and previous find among haemophilus ducreyi bacterial strain 2665 LPS identical, yet compare with the lacto-N-neotetraose structure that the DD-Hep that finds in haemophilus ducreyi is interrupted, serotype 1 LPS has different extensions on Gal I residue.

Thereby two kinds of core types for observed Ap LPS in SDS-PAGE have obtained structural explanation.Serotype 2,5a and the 5b of core type II has closely similar LPS structure, and difference only is that a glucosyl residue is arranged in the serotype 2 more.Yet the serotype 1 of core type I lacks the DD-Hep residue, but two hexoses and a new open chain HexNAc residue are arranged.Whether in other core type I serotype, exist in order to study this new open chain HexNAc residue, checked LPS from serotype 6,9 and 11.The evidence of open chain HexNAc in serotype 9 and 11 MS and NMR experiment (data provide) in all be found, but in serotype 6, do not find.The SDS-PAGE pattern that is used for core type is classified be studies show that further serotype 6 has the LPS migration model of two kinds of core types, therefore might have only core type II pattern by our serotype 6 bacterial strains of inspection.

The available data seldom in the biosynthetic Genetic Control of the LPS of Ap.As if one piece of paper of people such as nearest Galarneau has been distinguished three genes of transposon mutagenesis, relate to the biosynthesizing in the core os district of Ap serotype 1 LPS.Based on the homology of other glycosyltransferases, these genes temporarily are characterized as glycosyltransferase.By inference, these three genes are lbgB, α-1,6-DD-heptose based transferase, lbgA, β-1,4-galactosyltransferase, and hexose or N-acetyl-hexosamine transferring enzyme.Preceding two genes, lbgAB, the structure of distinguishing in serotype 1 core os with this paper is consistent, has the locus identical with haemophilus ducreyi LPS and arranges.Another piece paper of people such as Rioux has been distinguished gene galU, the structure gene of UTP-alpha-D-glucose-1-phosphoric acid uridine acyltransferase.The migration model that has different cores-lipid A district from the SDS-PAGE of the isolating LPS of serotype 1 Ap galU mutant strain, this mutant strain to the adhesivity of pig tracheal cell a little less than, to the virulence of pig a little less than, illustrate that core os district essence or the change that presents are influential to the virulence of this animal pathogen.

Distinguish that the open chain HexNAc residue that makes new advances is very interesting.This structure is in the past only at two kinds of mycetozoan bacterial classifications, distinguish out that its meaning is not clear recently in husky thunder bacterium (Shewanella oneidensis).As what have been found that in the existing document, the open chain residue of distinguishing herein is found simultaneously at 4 and 6 adjacent residues of two replacements, so this may be the total arrangement mode of this type of residue.

The front comprises in hemolytic Man bacillus, haemophilus ducreyi and the atypical hemophilus influenzae at several bacterial strains, has observed distinguishing of DD-Hep residue from the oligosaccharides of Hep I extends.In hemolytic Man bacillus, observe two DD-Hep residues, and in haemophilus ducreyi and hemophilus influenzae, only find a DD-Hep residue.Have two kinds of situations in Ap: serotype 2 and 5a, 5b have two DD-Hep residues the oligosaccharides from HepI extends, and serotype 1 has only a DD-Hep residue.Three-LD-heptose base kernel group is also observed in the front in hemolytic Man bacillus, haemophilus ducreyi and hemophilus influenzae.Here in the App bacterial strain that all were studied, find 3,4, in hemolytic Man bacillus LPS, all observes before the trisubstituted Hep I of the 6-residue, however haemophilus ducreyi LPS only have with in hemophilus influenzae, find identical 3, the dibasic Hep I of 4-residue.

7 attachment points for the O-antigen galactose residue of serotype 5a that pick out Hep III residue are to make us very interested, and with the core oligosaccharide mutant of three kinds of different truncation types of viewed serotype 1 in still to have this phenomenon of O-antigen consistent, this is because the expectation function of these three kinds of truncation type gene products can not disturb the unitary biosynthesizing of kernel LD-heptose base trisaccharide, thereby the acceptor that O-antigen adheres to still exists in mutant LPS core oligosaccharide.

This research has characterized the core oligosaccharide zone of several Ap bacterial strains (representing two kinds of core types) from structure, picks out the conservative property inner core and new outer core is formed.Known this zone relates to the adhesivity of Ap, thus the virulence of relating to.Therefore, this research can promote the further research to the dependency of the structure in the core oligosaccharide zone of Ap LPS and the potential virulence of this biology.

Material and method-embodiment 2

Substratum and culture condition

With Ap serotype 1 (bacterial strain 4074), 2 (bacterial strains 4226), 5a (bacterial strain K17) and 5b (bacterial strain L20) 37 ℃ of following overnight incubation on the Chocolate Agar flat board at first, culture is used to inoculate 1 L brain heart infusion (BHI) substratum, this substratum is added with the β NAD (SigmaN-7004) that final concentration is 5ug/ml, protohemine (haemin, Sigma H-2250) and the 1% glucose glucose (10g) that final concentration is 5ug/ml.Then with culture under 37 ℃ with 200rpm incubation 6 hours, and be used for being seeded in 23 L BHI substratum (added ingredients is the same) of 28 L NBS fermentor tanks.Then with this culture at 37 ℃, 24 lmin ^-1Ventilation 200rpm stirs down and cultivated 18 hours.Cell killing (2% phenol w/v, 4 hours) uses Sharples continuous centrifuge results (about 40g weight in wet base).

Separate and the purifying lipopolysaccharides

From the population of stem cells of serotype 5a and 5b, separate lipopolysaccharides (LPS) by following method: after with the organic solvent washing population of stem cells, re-use hot water/phenol method.Water is made water dialysis, freeze-drying, if serotype 2, LPS from the phenol of abundant dialysis mutually separation.The exsiccant sample is soluble in water, generate the solution (w/v) of 1-2%, use deoxyribonuclease I (DNase) (0.01mg/ml) and rnase (RNase) (0.01mg/ml) handled 3 hours down at 37 ℃, use Proteinase K (0.01mg/ml) processing 3 hours then.To dialyse, the exsiccant sample is soluble in water, generates 1% solution, ultracentrifugation (5 hours, 100,000g).LPS precipitation is soluble in water again, and freeze-drying (by the gel-filtration purifying,, is collected and is contained sugared component, freeze-drying as elutriant with water on the post of 1cm * 100cm) at Bio-Gel P-2.Use anhydrous hydrazine 37 ℃, handle the LPS one hour of purifying, preparation O-deacylated tRNA LPS (LPS-OH) under stirring.To be reflected on the ice bath and cool off, and slowly add cold acetone (70 C, 5 times of volumes), to destroy excessive hydrazine, sedimentary LPS-OH is by centrifugation.Then sample is crossed Bio-Gel P-2 column purification as mentioned above.Core oligosaccharide (OS) separates by following method: use 1% acetic acid treatment (10mgml ^-1, 100 ℃, 1.5 hours) and the LPS of purifying, remove insoluble lipid A by centrifugal (5000g) then.Freeze dried OS is further purified by the Bio-GelP-2 post with freeze dried each component.

Analytical procedure

Sugar is measured by GLC-MS with the form of its alditol acetate derivative.Use 4 M trifluoroacetic acids 100 ℃ of following hydrolysis 4 hours in sample.With hydrolysate at H ₂Reduction (NaBD among the O ₄) spend the night, as catalyzer, use diacetyl oxide with residual sodium acetate 100 ℃ of acetylizes 2 hours.On GLC-MS, load onto 30 M DB-17 capillary columns (180 ℃ to 260 ℃, 3.5 ℃/min), carry out MS with the electronic impact pattern on the Varian SaturnII mass spectrograph.Methylation analysis is undertaken by NaOH/DMSO/ methyl-iodide method, and analyzes by GLC-MS as above.

Mass spectroscopy

(Micromass, Manchester U.K.) upward carry out ESI-MS with the negatively charged ion pattern, directly sample are injected 25% acetonitrile solution that contains 0.5% acetate at VG Quattro mass spectrograph.Carry out capillary electrophoresis (CE)-ESI-MS on crystal Model 310 (CE) equipment (AYI Unicam), this equipment sprays interface by minitype ion and is connected with API 3000 mass spectrographs (Perkin-Elmer/Sciex).To protect liquid (sheath solution) (Virahol-methyl alcohol, 2: 1) with the flow velocity of 1 L/min be defeated by lower dead volume Y-tube (tee) (250 μ m i.d., ChromatographicSpecialties).All aqueous solution filters by 0.45-μ m filter (Millipore) before use.Protection liquid electrospray stainless steel needle (No. 27) docked with lower dead volume Y-tube, so that can flow to the termination of capillary column.Use the deionized water solution (pH9.0 contains 5% methyl alcohol) of 10mM ammonium acetate/ammonium hydroxide, on the long naked fused quartz kapillary of about 90cm, obtain isolate.The general voltage of using 20kV during injection.Use laser pincers (Sutter Instruments) with outlet drawing-down capillaceous to about 15 μ m i.d..Obtain mass spectrum with sampling time 3.0ms, per step 1m/z unit, total quality scan mode.With sampling time 1.0ms, per step 1m/z unit's acquisition MS/MS data.In having only four utmost point collision cell of RF,, extremely carry out mass spectroscopy by the scanning third stage four by nitrogen and the formed fragment ions of selected precursor ion collisional activation.

Nucleus magnetic resonance

Use 5mm or 3mm triple resonant ( ¹H, ¹³C, ³¹P) probe carries out the NMR experiment on Varian Inova 400,500 and 600 MHz spectrographs.Freeze dried sugared sample is dissolved in the D of 600 L (5mm) or 140 L (3mm) 99% ₂Among the O.This experiment is carried out under 25 ℃, simultaneously HOD (deuterate H ₂O) signal at the 4.78ppm place is suppressed.The methyl resonance of acetone is as internal standard, 2.225ppm correspondence ¹H spectrum, the 31.07ppm correspondence ¹³C spectrum.Will from Varian, COSY, TOCSY, NOESY, ¹³C- ¹H HSQC, ¹³C- ¹H HSQC-TOCSY and ¹³C- ¹The 2D pulse sequence relevant with heteronuclear with same nuclear standard H HMBC is used for conventional identification.Have Z spectral filter and selectivity 1D-TOCSY and 1D-NOESY experiment, and the similar experiment of 1-D of 3-D NOESY-TOCSY and TOCSY-NOESY experiment finishes residue identification, and determine ¹H- ¹The Overhauser of H nuclear strengthens.The pulse width of selective pulse is 30-80Hz.The mixing time of 30-150ms is used for the 1D-TOCSY experiment.The mixing time of 400-800ms is used for the 1D-NOESY experiment.

Embodiment 2, table 1: the composition of the O-deacylated tRNA LPS of actinobacillus pleuropneumoniae serotype 1,2,5a and 5b and the negatively charged ion ES-MS of core oligosaccharide and CE-ES-MS data and supposition.Average quality unit is used to calculate the molecular weight based on the composition of following supposition: Hex, 162.15; HexNAc, 203.19; Hep, 192.17; Kdo, 220.18; P, 79.98; PEtn, 123.05; Gly, (lipid A-OH) is 952.00 to 57.05.O-deacylated tRNA lipid A.

Serotype	Observed ion (m/z)		Molecular mass (Da)		The composition of inferring
						(M-2H) 2- 3H) 3-	(M-	Observed value	Calculated value
	1 O-deacylated tRNA	1396 1436 1497	930 957 998	2794 2874 2997						2792.7 2872.6 2995.7	HexNAc, 4Hex, 4Hep, Kdo, lipid A-OH HexNAc, 4Hex, 4Hep, Kdo, P, lipid A-OH HexNAc, 4Hex, 4Hep, Kdo, P, PEtn, lipid A-OH
Core os					919 928	-	1840 1858	1840.7 1858.7	HexNAc，4Hex，4Hep，aKdo a HexNAc，4Hex，4Hep，Kdo
	2 O-deacylated tRNAs	1309 1349	872 899	2620 2700						2620.5 2699.5	3Hex, 5Hep, Kdo, lipid A-OH 3Hex, 5Hep, Kdo, P, lipid A-OH
Core os					832	-	1667	1667.5	3Hex，5Hep，Kdo
	5a O-deacylated tRNA	1268	845	2537						2537.4	2Hex, 5Hep, Kdo, P, lipid A-OH

Serotype	Observed ion (m/z)		Molecular mass (Da)		The composition of inferring
						(M-2H) 2- 3H) 3-	(M-	Observed value	Calculated value
	Core os	752 780		1505 1562						1505.3 1562.3	2Hex，5Hep，Kdo 2Hex，5Hep，Kdo，Gly
5b O-deacylated tRNA					1268	845	2537	2537.4	2Hex，5Hep，Kdo，P，Lipid A-OH
	Core os	752 780	-	1505 1562						1505.3 1562.3	2Hex，5Hep，Kdo 2Hex，5Hep，Kdo，Gly

^aThe number ion (loses H corresponding to molion-18 ₂O).

Embodiment 2, table 2: the core os of actinobacillus pleuropneumoniae serotype 1,2,5a and 5b ¹H-and ¹³The C-NMR chemical shift.

	H-1	H-2	H-3	H-4	H-5	H-6	H-7	NOE’s
											Kernel aSerotype 1,2,5a, 5b								Between	Inner	Long-range
Kdo (k)	-	-	2.08 1.92	4.10	4.21	4.48	nd
											Hep-I (a)	5.11 (98.9)	4.01 (71.2)	3.97 (73.7)	4.21 (74.7)	3.79 (72.6)	4.13 (80.3)	3.88 3.73 (62.9)	4.20Kdo H-5	4.01 H-2
Hep-I (A)	5.37 (101.3)	4.08 (71.2)	3.95 (73.5)	4.22 (74.6)	3.78 (72.6)	4.13 (80.3)	3.88 3.73 (62.9)	nd	4.00 H-2

Hep-II (b)	5.70 (100.2)	4.19 (80.5)	3.87 (70.7)	3.89 (67.5)	3.55 (72.7)	4.04 (70.3)	3.76 3.74 (64.2)	5.15 Hep III H-1 3.97 Hep I H-3	4.19 H-2 3.87 H-3	3.79 Hep I H-5 3.82 Hep III H-5 3.77 Hep III H-7a 3.56 Glc I H-2
											Hep-III b (c)	5.17 (102.3)	4.00 (71.5)	3.88 (71.6)	3.82 (67.1)	3.82 (72.4)	4.06 (70.2)	3.93 3.93 (70.3)	5.70 Hep II H-1 4.19 Hep II H-2	4.00 H-2	4.0g Hep IV H-2 3.80 Hep IV H-3 3.63 Glc I H-4
Hep-III c (c)	5.17 (102.3)	4.00 (71.5)	3.88 (71.6)	3.82 (67.1)	3.82 (72.4)	4.04 (70.2)	3.77 3.62 (64.6)	5.70 Hep II H-1 4.19 Hep II H-2	4.00 H-2	4.08 Hep IV H-2 3.80 Hep IV H-3 3.63 Glc I H-4
											β-Glc(Glc-I) (d)	4.66 (104.0)	3.56 (74.1)	3.43 (77.8)	3.63 (70.3)	3.54 (74.5)	4.06 3.70 (65.5)	-	4.21 Hep I H-4 4.13 Hep I H-6	3.54 H-5 3.43 H-3	5.21 Glc II H-1
α-Glc(Glc-II) (e)	5.21 (102.6)	3.58 (72.8)	3.81 (73.8)	3.59 (69.3)	3.92 (72.4)	3.96 3.76 (60.2)	-	4.13 Hep I H-6	3.58 H-2	4.66 Glc I H-1

Outer core Serotype 5a, 5b
											Hep-IV (f)	4.96 (99.8)	4.08 (70.5)	3.80 (71.7)	3.78 (68.1)	3.93 (71.9)	4.13 (77.0)	3.90 3.80 (61.2)	4.06 Glc I H-6a 3.70 Glc I H-6b	4.08 H-2
Hep-V (g)	5.03 (99.0)	3.92 (70.8)	3.84 (71.5)	3.79 (68.2)	3.97 (73.7)	4.02 (73.1) -	3.79 3.74 (63.0)	4.13 Hep IV H-6 3.93 Hep IV H-5	3.92 H-2 3.97 H-5	4.19 Hep II H-2 4.04 Hep II H-6 3.93 Hep IV H-5
											β-Gal(Gal-I) (h)	4.49 (104.2)	3.55 (71.6)	3.68 (73.4)	3.97 (69.5)	3.93 (74.5)	3.75 3.61 (65.7)	-	3.93 Hep III H-7a 3.93 Hep III H-7b	3.68 H-3 3.93 H-5
Serotype 2
											Hep-IV	4.96	4.13	3.90	3.96	4.05	4.30	3.97	4.06 Glc I H-6a	4.14 H-2

	(99.5)	(70.3)	(70.6)	(78.0)	(70.3)	(75.4)	3.82 (60.9)	3.70 Glc I H-6b
										Hep-V	5.02 (98.6)	3.88 (70.7)	3.82 (71.5)	3.78 (68.1)	3.97 (73.9)	4.00 (73.0)	3.80 3.74 (62.8)	4.30 Hep IV H-6 4.05 Hep IV H-5	3.88 H-2
β-Glc(Glc III)	4.53 (103.4)	3.33 (74.0)	3.51 (76.4)	3.41 (70.4)	3.51 (77.0)	3.95 3.74 (61.6)	-	3.96 Hep IV H-4 4.30 Hep IV H-6 4.05 Hep IV H-5	3.51 H-3 3.52 H-5
										Serotype 1
Hep-IV d	4.95 (99.7)	4.13 (70.2)	3.94 (70.7)	3.94 (79.5)	3.94 (72.9)	4.17 (66.9)	3.83 3.80 (61.9)	4.15 Glc I H-6a 3.74 Glc I H-6b	4.13 H-2

β-Gal(Gal-I)	4.55 (103.9)	3.67 (70.3)	3.79 (78.4)	4.17 (65.9)	4.17 (71.6)	3.87 3.75 (62.4)	-	3.94 Hep IV H-4	3.79 H-3 4.17 H-5
										α-Gal(Gal-II) (j)	5.18 (97.3)	3.97 (68.8)	4.06 (68.7)	4.25 (76.7)	4.13 (64.2)	4.12 4.01 (69.5)	-	3.79 Gal I H-3	3.97 H-2
α-GalNAcOpen chain (i)	4.88 (101.1)	4.34 (52.6)	4.13 (68.5)	3.36 (70.0)	3.93 (70.7)	3.66 3.64 (64.1)	-	4.25 Gal II H-4 4.12 Gal II H-6a 4.01 Gal II H-6b	4.34 H-2

^aKernel data derives from serotype 5a; The alphabetical label of residue is as shown in bracket.Chemical shift from other serotype kernel residues is identical in fact

^bThe data of the Hep III residue of the replacement of serotype 5a and 5b

^cThe data of serotype 1 and 2 terminal Hep III residue

^dFor the 1H-of serotype 1 resonance, Glc I H-6a and H-6b are respectively 4.15 and 3.74ppm.

Embodiment 3 present embodiments have formed the basis of one piece of publication among the Glycobiology 15:323 (2005).Research pasteurella multocida bacterial strain Pm70

The LPS of purifying is carried out glycan analysis show glucose (Glc), the ratio separately of semi-lactosi (Gal) and L-glycerine-D-sweet dew-heptose (LD-Hep) is approximately 4: 2: 3.Also recognize minor N-acetyl-glucosamine (GlcNAc) and N-acetyl-GalN (GalNAc), and, compare with the pathogenic agent of nearest other beasts of studying, do not recognize D-glycerine-D-sweet dew-heptose (DD-Hep) (Brisson, et al, 2002; St.Michael et al, 2004).The GLC analysis revealed of core oligosaccharide (OS) deutero-butyl-glucosides, Glc, Gal and GalNAc residue exist with their D-isomeric forms.

Preparation O-deacylated tRNA LPS (LPS-OH), and use the gel filtration chromatography classification, and analyze (embodiment 3, table 1) with CE-MS.In CE-MS analyzes, observe simple mass spectrum, main peak is the triply charged ion of m/z1173.8, this peak corresponding to form HexNAc2, Hep4, Hex6, PEtn, Kdo, P, the molecule of the corresponding to 3525amu of Lipid A-OH also has on a small quantity by m/z1132.9 ^3-With 1215.2 ^3-The quasi-molecular ions that from main fragment, loses or obtain a PEtn residue that characterizes.CE-MS analysis (not display data) to triply charged ion m/z 1173.8 obtains the single electric charge peak of a m/z951 and the double-charge ion of a m/z 1236.5, thereby the size of determining O-deacylated tRNA lipid A is 952amu, and the size of core os is 2475amu.The main kind (952amu) of O-deacylated tRNA lipid A is made up of N-acyl (3-OH C 14: 0) glycosamine residue disaccharides, and each residue is replaced by a phosphoric acid molecules.What is interesting is,, increase the small amounts of sugars type of Kdo molecule simultaneously, by m/z 1125.7 corresponding to lacking hexose and phosphoric acid molecules ^3-With 1166.7 ^3-Characterize, there are two kinds of distinct arranging (embodiment 3, table 1) in the Kdo zone of this hint molecule, and promptly Kdo-P or Kdo-Kdo arrange.In the CE-MS spectrum of the LPS that KOH handles, observe a kind of similar mixing (embodiment 3, table 1) that contains one and two Kdo residue sugar type.ES-MS and CE-MS analyze and find that classified core os sample has 2492Da, this and HexNAc2, and Hep4, Hex6, PEtn, the composition unanimity of Kdo (embodiment 3, table 1) is (Figure 19).Core os is carried out CE-MS/MS with cation mode analyze, to obtain the locating information of some functional groups in the OS molecule.To m/z 1246.5 ²⁺The MS/MS analytical table of double-charge ion understand several product ions (Figure 20).A kind of with 203.5 ⁺The HexNAc residue and two kind 407.5 ⁺Single charge ion of HexNAc residue correspondence preponderate.Also identify other product ions of forming shown in corresponding Figure 20.In scanning, according to m/z 817.52 to the precursor ion of m/z 316 (corresponding Hep-PEtn group) ⁺(Hex3, Hep4, Kdo, PEtn), 898.52 ⁺(Hex4, Hep4, Kdo, PEtn), 979.52 ⁺(Hex5, Hep4, Kdo, PEtn), 1059.52 ⁺(Kdo is PEtn) with 1263.52 for Hex6, Hep4 ⁺(HexNAc2, Hex6, Hep4, Kdo, the PEtn) identification of the hydration double-charge ion of (Figure 21) is positioned the PEtn district of core os the heptose residue (Hep) of kernel.By to m/z 893 ⁺The scanning of the precursor ion of (corresponding HexNAc-HexNA group) has disclosed 893 ⁺Single charge ion, this list charge ion is corresponding to Hex3, HexNAc2 (not display data) forms.Therefore, these two kinds of precursor ion scanning experiments have shown kernel composition Hex3, Hep4, Kdo and PEtn, and have the outer core extension of a 3Hex and 2HexNAc residue.

The methylation analysis that core os is carried out for the connection mode of determining molecule shows terminal Glc, the Glc that 6-replaces, the Glc that 4-replaces, the Gal that 4-replaces, Gal and terminal LD-Hep that 3-replaces are about 2: 1: 1 with mol ratio: 1: 1: 1: 1 ratio exists, and observe less terminal Gal, the LD-Hep that 2-replaces, 3, the dibasic LD-Hep of 4-and 3,4, the LD-Hep of 6-three-replacement.In addition, by the excessively methylated sugar alcohol acetic ester of comparison, with 4 from actinobacillus pleuropneumoniae (Ap) serotype 2, the retention time and 4 of the LD-Hep residue of 6 two-replacement, 6 two-replace the DD-Hep residue to make a distinction, determined its ownership, and consistent with no DD-Hep among the Pm LPS.

In order to illustrate definite position and the connection mode of OS, to the OS component and fully the sample (Figure 22) of deacylated tRNA (KOH processing) carried out NMR research, wherein provide the clearest, the spectrogram of homogeneous to the OS component.By COSY and TOCSY (Fig. 5 a) experimental identification OS and the KOH LPS that handles ¹H resonance is simultaneously with reference to relevant core os (Brisson, et al, 2002 on the structure of hemolytic Man bacillus (Mh) and Ap; St.Michael et al, 2004) (embodiment 3, table 2).

The LPS's that handles at Pm70 OS and KOH ¹In the H-NMR spectrogram, from heptose residue (Hep I (E), Hep II (F), Hep III (G) and Hep IV (J)) 5.10 _OS(OS sample)/5.19 _KOH(KOH handles sample) (Hep I, E), 5.87os/5.74 _KOH(Hep II, F), 5.23 _{Os﹠amp; KOH}(Hep III is G) with 5.12 _{Os﹠amp; KOH}(Hep IV, J) anomer of ppm ¹Recognize the spin system that comes from above-mentioned heptose residue in the H resonance,, above-mentioned spin system is defined as sweet dew-pyranose basic ring system in conjunction with the form of these spin systems.Because the heterogeneity (identification of more Hep I signal in the OS sample is described in detail in detail) that Hep I anomer proton is arranged is observed in the existence of the multiple rearrangement product of adjacent Kdo molecule after acid hydrolysis in the OS sample.The only appearance of NOE ' s between H1 and H2 resonance in the residue, α-configuration that can conspicuous definite heptose residue.5.22os _{﹠amp; KOH}Ppm (Glc II, H) and 5.09os/5.53 _KOH(GalNAc II/GAlN II, two residues in alpha-anomer district P) are confirmed as glucose-pyranose and semi-lactosi-pyranose respectively according to the form of its spin system to ppm.Semi-lactosi-configuration residue is at 5.09os/5.53 _KOHBe confirmed as aminosugar under the ppm, this is at 4.24os/3.65 according to it _KOHH-2 proton under the ppm ¹H resonance and determine, ¹³C- ¹In the H HSQC experiment, itself and 50.4os/51.5 _KOHPpm's ¹³The C chemical shift is relevant.Should ¹³The C chemical shift is consistent with the carbon atom that nitrogen replaces.In the TOCSY experiment, at 4.95os/4.99 _KOHPpm (Gal II, N) under, appear at H-4 resonance according to its characteristic spin system, alpha-anomer district residue residue is defined as semi-lactosi-pyranose (Figure 23).Remaining anomer resonance in spectrographic downfield district (4.45-6.00ppm) is according to their chemical shift and high J under this residue parsing situation of different 1H resonance _1,2The coupling constant of (～8Hz) is owing to β-connection residue.At 4.65os _{﹠amp; KOH}Ppm (GlcI, I), 4.70os﹠amp; KOHppm (Glc III, K) and 4.69os _{﹠amp; KOH}(form of spin system according to them is defined as glucose-configuration with it to ppm for Glc IV, the L) resonance under.In the TOCSY experiment, at downfield district 4.53os _{﹠amp; KOH}Ppm (Gal I, M) and 4.73os/5.01 _KOHPpm (GalNAc I/GalNI, O) under, appear at according to the characteristic spin system of H-4 resonance, residual resonance is defined as semi-lactosi-pyranose residue.At 4.73os/5.01 _KOHUnder the ppm, according to semi-lactosi-configuration residue under 4.12/3.53ppm, the H-2 proton ¹H resonance is defined as an aminosugar with it, its with ¹³C- ¹In the H HSQC experiment, 51.9os/53.1 _KOHPpm's ¹³The C chemical shift is relevant.Should ¹³The C chemical shift is consistent with the carbon atom that nitrogen replaces.3.27 and 4.16ppm under the OS sample in, observe PEtn partial C H ₂Proton signal, its respectively with ¹³C- ¹In the H HSQC experiment, 40.1 and 62.2ppm under characteristic ¹³The C chemical shift is relevant.In addition, 2.06 and 2.04ppm under the OS sample in, observe the ethanoyl characteristic signal of aminosugar, its respectively with ¹³C- ¹In the H HSQC experiment, 22.4 and 22.1ppm under ¹³The C chemical shift is relevant.

By between residue ¹H- ¹H NOE assay method is determined the order of glycosyl residue among the OS between the anomer proton and aglycon proton of adjacent glycosyl residue, and determines and expanded the analytical data of methylation.Make the connection mode (Figure 24) (embodiment 3, table 2) of having determined Pm70 deacylated tRNA oligosaccharides in this way.Like this, just as normal observed three-heptose base section, at proton to Hep III (G) H-1 and Hep II (F) H-2, occur and the strong NOE annexation of glucosides between Hep II (F) H-1 and Hep I (E) H-3 and Hep I (E) H-1 and Kdo (C) H-5, set up the order and the attachment point of these three kinds of LD-heptose residues, this connection mode runs into (Cox et al, 2001 a in the kernel OS of hemophilus influenzae of being everlasting (Hi) and Mh; Brisson et al, 2002).And NOE ' s is 1 between the residue of the anomer proton between Hep III (G) H-1 and Hep II (F) H-1, and the 2-connecting key provides affirmation (Romanowska et al, 1988).NOE connectivity to Glc I (I) H-1 is investigated, and by NOE between the residue of Hep I (E) H-4 and Hep I (E) H-6, illustrates that this glucosyl residue is connected in the 4-position with Hep I (E).(Backman et al, 1988) often take place in NOE between the residue of a H-6 concerning 4-replaces the heptose residue.Viewed among the OS as Mh and Ap in front, the long-range NOE between Glc I (I) H-1 and Glc II (H) H-1 is internuncial to occur showing that α-configuration glucosyl residue (Glc II (H)) replaces Hep I (Brisson, et al, 2002 in the 6-position; St.Michael et al, 2004).NOE connectivity to Glc II (H) H-1 is investigated, and by NOE between the residue of Hep I (E) H-4, determines that this glucosyl residue is connected in the 6-position with Hep I (E).Similar Glc I (I) observes a long-range NOE connectivity between GlcI (I) and Glc II (H) anomer 1H resonance.By NOE between the residue of Glc I (I) H-6a and H-6b, the NOE connectivity of Hep IV (J) H-1 is investigated, disclose this heptose residue and be connected in the 6-position with Glc I (I).Observing kernel monose structure Hep IV residue (J) in before Mh and Ap is D-glycerine-D-sweet dew configuration, and the Hep IV residue (J) here is L-glycerine-D-sweet dew configuration, and this is because unique configuration of the heptose residue that recognizes in glycan analysis.According to the NOE connectivity and ¹³C- ¹The H-HMBC evidence, and the methylation analytical data is inferred the connection mode of outer core residue.Two glucose configuration residue (K﹠amp; L), their anomer proton is 4.70 _{OS﹠amp; KOH}/ 4.69O _{S﹠amp; KOH}Resonance under the ppm shows 4.15 _{OS﹠amp; KOH}With 4.31 _{OS﹠amp; KOH}The NOE connectivity of Hep IV residue (J) H-4 and H-6 proton resonance under the ppm, with in the methylation analysis observed 4,6-two replaces LD-heptose residue unanimities, and to front observed DD-HepIV in Ap serotype 2 arrange similar (St.Michael et al, 2004).By ¹H- ¹³C HMBC experiment (Figure 25) can determine that Glc III (K) is connected in HepIV (J) on 4, and Glc IV (L) is connected in HepIV (J) on 6.From Gal I (M) 4.53 _{OS﹠amp; KOH}Anomer proton resonance under the ppm shows that to the connectivity between the H-4 proton resonance NOE of Glc IV (L) Gal I (M) replaces Glc IV (L) on the 4-position.Show to the connectivity the H-4 proton resonance NOE of Gal I (M) from the anomer proton resonance of Gal II (N), Gal II (N) replaces Gal I (M) on the 4-position, determined two 4-are connected the hexose residue with the methylation analysis data, and promptly 4-connects glucose and a 4-to be connected galactose residue consistent.Show to the connectivity the H-3 proton resonance NOE of Glc II (N) from the anomer proton resonance of GalNAc I/GAlN I (O), GalNAc I/GAlN I (O) replaces GlcII (N) on the 3-position, confirm a 3-connection hexose residue by methylation analysis again and determine.At last, show to the connectivity the H-3 proton resonance NOE of GalNAc I/GalN I (O) from the anomer proton resonance of GalNAc II/GalN II (P), GalNAc II/GalN II (P) replaces GalNAc I/GalN I (O) on the 3-position, consistent with the HexNAc-HexNAc disaccharides that MS/MS confirms.By with the OS sample ³¹P- ¹H-HSQC and ³¹P- ¹The 3-position of H-HSQC-TOCSY experimental verification Hep II (F) is the position of substitution of PEtn.The intersection peak of the proton resonance of HSQC experimental identification to from the phosphorus signal to 4.41ppm, this intersection peak belongs to 3 of Hep II residue (F), this is further confirmed in HSQC-TOCSY experiment and is expanded, and the H-2 of this HSQC-TOCSY experiment demonstration Hep II (F) and H-1 proton resonance lay respectively at 4.31 and 5.87ppm (not display data).

Be connected to L-α-D-Hep I-(1-5)-α-Kdo4P-(2-6)-β-GlcN4P-(1-6)-α-GlcN1P (embodiment 3, table 2) by what the analysis of the LPS that handles through KOH has been determined Hep I-Kdo-lipid A district (E-C-B-A).Discern the component that obtains containing two kinds of Kdo by chromatographic separation and MS, but its quantity not sufficient is analyzed to be used for NMR.

Utilization (the May et al of Pm70 strain gene group sequence, 200) together with comprehensive cognition to the OS structure, add glycosyltransferase information, make the biosynthetic candidate's glycosyltransferase of several Pm70 of being used for OS be identified (Figure 26), described glycosyltransferase will be structurally with taxonomy on relevant kind connect.In the Pm70 genome sequence, confirmed the heptose transferring enzyme of several suppositions, comprised a Hep III Tase PM1294, a Hep II Tase PM1844, two Hep I TasesPM1302 and PM1843 and a Hep IV Tase PM1144.At embodiment 3, describe each the best homologue in database in these genes in the table 3 in detail, the function shown in this high homology show candidate PM gene has.Our group of front and co-worker showed once that PM1294 was Hep III Tase (Harper et al, 2004) in another Pm bacterial strain VP161.The gene that α-Pu Taotang (H) is added to the 6-position of Hep I (E) is not known, but to β-glucanotransferase (it replaces Hep I (E) in the 4-position), a good homologue PM1306 is arranged.Because the Kdo transferring enzyme has the fabulous homologue of extensive number, thus its to be identified at an easy rate be PM1305, yet, in the Pm genome, only recognize a Kdo transferring enzyme homologue.What is interesting is, several and Kdo (C), Hep I (E), the gene cluster ground that the biosynthesizing of Glc I (I) is relevant is present in this chromosomal this zone.The glycosyltransferase that the outer core district is inferred as if also cluster appear at chromosomal a certain zone from PM1138 to PM1144.Always can not observe this glycosyltransferase gene bunch in this Pseudomonas, in fact, the glycosyltransferase of Hi OS is scattered in whole genome widely.In genomic another zone of Pm (from PM0506 to PM0512), can find the glycosyltransferase gene seat of another supposition.In Hi and haemophilus ducreyi (Hd), this locus all is arranged in well with so-called lsg locus.The effect of the locus of this not designated any concrete effect in the HiOS biosynthesizing is document (Phillips et al, 1996,2000; Cox et al, 2001b) call for Votes in.But in the middle of this Pm70 locus is a sialytransferase homologue (PM0508), this homologue is one of three sialytransferase homologues in Pm70 (also being PM0188 and the PM1174) genome, and in our laboratory, structural research is still being carried out to investigate under suitable growth conditions, and whether Pm70 may be sialylated.At embodiment 3, in the table 3 in detail, the nucleotide sugar donor candidate gene that is activated has been described in detail also.

Discuss

Genomic oligosaccharide structure analysis demonstrates a kind of structure to the Pm70 of Pm bacterial strain, this similar is in determined relevant bacterial classification Mh (Brisson et al before, 2000), Ap (St.Michaelet al, 2004), Hd (Schweda et al, 1994) and Hi (Cox et al, LPS core oligosaccharide structure 2001a).In each case, core os comprises the three-heptose base unit that is equal to connection that is connected on the Kdo residue.What is interesting is that as a rule, the HepII residue of 3-position is substituted by the PEtn residue in Pm, and Ap, Hd and Mh do not comprise the PEtn residue, and Hi has a PEtn residue in the 6-position of HepII.The substitute mode of the Hep I residue of Pm with in beasts pathogenic agent Ap and Mh, find identical, in 4-position and 6-position two glucosyl residues are arranged, and in the Hep of Hi and Hd I residue, have only the 4-position to be substituted.In addition, in some bacterial classifications of three kinds of beasts pathogenic agent, Hd and Hi, the glucosyl residue in Hep I 4-position is always replaced in the 6-position by a heptose residue.Yet, to compare with the heptose residue of D-glycerine-D-sweet dew configuration in Ap, Hd, Mh and some Hi bacterial strains, the heptose residue that replaces glucosyl residue in Pm (with some Hi bacterial strains) is L-glycerine-D-sweet dew configuration.In these bacterial strains, the substitute mode of heptose residue is varied, and in this one side of OS structure, conservative inner core similarity stops between multiple bacterial strain.In Pm the heptose residue in 4-and 6-position by two glucosyl residues two-replacement, to heptose residue in Ap serotype 2 same position by two-replace similarly, but replace by another heptose residue rather than by glucosyl residue in the 4-position.Mh also has another D in the 4-position, and D-heptose residue comes from the 4th the further hexose extension of heptose residue and also have in Ap serotype 1, Hd and Hi, extend but here observe at new GalNAc-GalNAc disaccharide unit terminated.

In the Pm70 genome, recognize similar specific homologue Pm about glycosyltransferase based on Pm70 OS structure.Consider two LPS members' of the existence that depends on one or two Kdo residue new discovery, can notice enjoyably in the Pm genome, only to recognize a homologue about Kdo residue transferring enzyme.This is not astonishing, because the pleiotropy essence of Kdo transferring enzyme is proved fully that for example identical Kdo transferring enzyme can shift a Kdo residue and to lipid A second Kdo residue be transferred to initial Kdo residue.Though the new feature of Pm LPS is the member that one and two Kdo residue that has been disclosed is arranged, as far as our knowledge goes, is not identified before and has been.But, in the Pm70 genome, observe the homologue of two good Hep I (E) to the transferring enzyme of Kdo (C) (α-1,5 heptose transferring enzyme).Transferring enzyme has highest homology to the HI 0261 (OpsX) of Hi, wherein comprises a Kdo residue in the LPS structure; Second transferring enzyme has highest homology to the WaaC from intestinal bacteria and klepsiella pneumoniae, and two Kdo residues are arranged in the LPS structure in described intestinal bacteria and the klepsiella pneumoniae.Therefore, the appearance that two kinds of structures are arranged in the identification of two Hep I transferring enzymes and the Kdo zone of Pm70 LPS conforms to, and the rule of understanding this organism Kdo transferring enzyme is absorbing.

This research has characterized the core os zone of Pm genome bacterial strain from structure, confirms to be used for the complete biosynthetic glycosyltransferase of inferring of core os.

Material, method

Substratum and growth conditions

Pm bacterial strain Pm70 (NRCC#6232) earlier on the Chocolate Agar flat board in 37 ℃ of overnight incubation, culture is inoculated into 1L brain-heart immersion liquid (BHI) substratum, this substratum is added with, final concentration is the β NAD (Sigma N-7004) of 5ug/ml, the protohemine of final concentration 5ug/ml (SigmaH-2250) and 1% glucose (10g).Then with culture at 37 ℃, 200rpm cultivated 6 hours down, was inoculated into a 24L BHI substratum (adding the same) in the 28L NBS fermentor tank.Again with culture in 37 ℃, per minute ventilation 24 times, rotating speed is at 200rpm, 20%O ₂Saturated cultivation down 18 hours.Then handle with Unidasa (1g, Sigma), cell killing (2% phenol w/v, 4 hours) is collected (～240g weight in wet base) with the Sharples continuous centrifugal machine.

The separation and purification of lipopolysaccharides

Next use organic solvent washing freeze drying cell piece (～70g) obtain～50g, from the 10g freeze drying cell piece that cleans with hot water, phenol processes, isolate lipopolysaccharides (LPS) (Westphal and Jann, 1965).With water dewater the dialysis and freeze-drying.With the dry-eye disease solution (w/v) that obtains 1-2% soluble in water, with ribodesose smoked plum I (DNase) (0.01mg/ml) and rnase (RNase) (0.01mg/ml) handled 3 hours in 37 ℃, use Proteinase K (0.01mg/ml) to digest then 3 hours.Dialysis, dry sample are dissolved in the water and make 1% solution, remove insoluble substance (124g) back in the 45K ultracentrifugation in the 8K low-speed centrifugal.45K centrifugal and LPS precipitation water dissolve again and freeze-drying (180g).The LPS of purifying (75g) shakes in 37 ℃ with anhydrous hydrazine and handles 1 hour with preparation O-deacylated tRNA LPS (LPS-OH).React in the ice bath and cool off, and to destroy remaining hydrazine, centrifugation goes out sedimentary LPS-OH (60mg) to add low temperature acetone (70 ℃, 5 times of volumes) gradually.As described above, this sample is passed through Bio-Gel P-2 column purification.By with 1% acetate (10mg/ml ^-1, 100 ℃, 1.5 hours) and handle the LPS (100mg) of purifying, centrifugal subsequently (5000g) removes insoluble lipid A to isolate core oligosaccharide.Be further purified freeze dried OS (50mg) with freeze dried each component by Bio-Gel P-2 post.LPS-OH (20mg) was handled 16 hours at 125 ℃ with 4N KOH, and the neutralization back is with the classification of foregoing anionresin liquid chromatography, isolate complete deacylated tRNA LPS (Vinogradov, E and Bock, K.1999).

Analytical procedure

Being confirmed to be by GLC-MS sugar is its alditol acetate derivative (Sawardeker et al, 1965).With sample with the 4M trifluoroacetic acid in 100 ℃ of hydrolysis 4 hours, reduction (NaBD4) is spent the night in water then, and with residual sodium acetate be catalyzer with acetic anhydride in 100 ℃ of acetylizes 2 hours.GLC-MS be equipped with one 30 M DB capillary column (180 ℃ to 260 ℃, with 3.5 ℃/min), MS carries out with the electronic impact pattern on VarianSaturn II type mass spectrograph.Carry out methylation analysis by NaOH/DMSO/ methyl-iodide method (Ciucanu and Kerek, 1994), and analyze by above-mentioned GLC-MS.Absolute configuration is analyzed decision (St.Michael et al, 2004) by the GLC of butyl glycoside derivative.

Mass spectroscopy

(Micromass, Manchester U.K.) carry out with the negatively charged ion pattern ESI-MS, directly inject the sample of 25% acetonitrile solution that contains 0.5% acetate with VG Quattro mass spectrograph.Capillary electrophoresis (CE)-MS is at (the Prince Technologies of Prince CE system, TheNetherlands) carry out on, this system via a mini spray interface in conjunction with API 3000 mass spectrographs (Applied Biosystem/Sciex, Concord, Canada).Send protection liquid (Virahol-methyl alcohol, 2: 1) in the Y-tube with low dead volume (250 μ m i.d., Chromatographic Specialties) with the flow velocity of 1pL/min.All aqueous solution filtered with 0.45 μ m filter membrane (Millipore) before using.Hang down the Y-tube of dead volume so that the end that is delivered to capillary column of protection liquid with an electrospray stainless steel needle (No. 27) adjacency.Melt at the long sky of about 90cm with 10mM ammonium acetate/ammonium hydroxide, pH9.0, the deionized water solution that contains 5% methyl alcohol and to finish separation on the silicon capillary.Generally use the voltage of 20kV in the injection site.Use laser pincers (SutterInstruments) to make outlet capillaceous taper to about 15 μ m i.d.Under the total quality scan pattern, the residence time of every 1m/z unit step is 3.0ms, can obtain mass spectrum spectrum.Every 1m/z unit residence time is 1.0ms, obtains the MS/MS data.In having only four utmost point collision cell of RF, selected precursor ion and nitrogen collisional activation form fragmention, extremely fragmention are carried out mass spectroscopy by the scanning third stage four.

Nucleus magnetic resonance

NMR experiment use 5mm or 3mm triple resonant ( ¹H, ¹³C, ³¹P) probe, at Varian Inova400,500 and the 600MHz spectrograph on finish.With 99% the D of freeze-drying sugar sample dissolution in 600 μ L (5mm) or 140 μ L (3mm) ₂Among the O.Above-mentioned experiment is carried out under 25 ℃, to suppress 4.78ppmHOD (deuterated water) signal.The methyl resonance conduct of acetone is 2.225ppm's ¹H spectrum and 31.07ppm's ¹³C spectrographic inner parameter.From Varian, COSY, TOCSY, NOESY, ¹³C- ¹H HSQC, ¹³C- ¹H HSQC-TOCSY and ¹³C- ¹H HMBC is used to general ownership with standard with the nuclear 2D pulse sequence relevant with heteronuclear.2D ¹H- ³¹P HSQC experiment is carried out finishing in 6 hours on Varian Inova 400 spectrographs.Optimize coupling constant by serial 1D-HSQC experiment at 12Hz.F2 ( ¹H) Wei sweep length is 6.0ppm, F1 ( ³¹P) Wei sweep length is 16.2ppm.In the relaxation delay phase, it is 1.5s that the water presaturation postpones, and be 0.21s the acquisition time of t2, under the pattern of 180 (HMQC) scanning, can obtain 32 lattice.2D ¹H- ³¹P HSQC-TOCSY experiment adopts identical parameter to carry out 8 hours on Varian Inova 400 spectrographs with the HSQC experiment, and the TOCSY mixing time is 80ms.

Embodiment 3, table 1: the core os, O-deacylated tRNA and the negatively charged ion CE-MS of the LPS that KOH handles and the composition of supposition that come from pasteurella multocida bacterial strain Pm70.Average quality unit forms according to following supposition and is used to calculate molecular weight: Hex, 162.15; Hep, 192.17; Kdo, 220.18; HexNAc, 203.19; HexN, 161.15; PEtn, 123.05.

Bacterial strain	[M-3H] 3-	[M-2H] 2-	Observed molion	The molion that calculates	Relative intensity	Infer and form
							The Pm70 core os	- 829.8	1111.2 1173.1 1245.3	2224.4 2348.2 2492.5	2224.0 2347.0 2491.2	0.1 0.2 1.0	2HexNAc，4Hep，5Hex，Kdo 2HexNAc，4Hep，5Hex，PEtn，Kdo 2HexNAc，4Hep，6Hex，PEtn，aKdo
Pm70 O-deacylated tRNA	1125.7 1132.9 1166.7 1173.8 1215.2	1689.3 1700.7 1750.4 1761.4 -	3380.3 3402.5 3502.9 3524.6 3648.6	3378.2 3400.1 3501.2 3523.1 3646.2	0.1 0.3 0.2 1.0 0.2	2HexNAc, 4Hep, 5Hex, 2Kdo, lipid A-OH 2HexNAc, 4Hep, 6Hex, Kdo, P, lipid A-OH 2HexNAc, 4Hep, 5Hex, PEtn, 2Kdo, lipid A-OH 2HexNAc, 4Hep, 6Hex, PEtn, Kdo, P, lipid A-OH 2HexNAc, 4Hep, 6Hex, 2PEtn, Kdo, P, lipid A-OH
							Pm70 KOH	980.3 973.3	1471.3 -	2944.3 2922.9	2944.2 2922.8	1.0 0.2	6Hex，4HexN，4Hep，Kdo，4P 5Hex，4HexN，4Hep，2Kdo，3P

Embodiment 3, table 2: for the complete deacylated tRNA that comes from pasteurella multocida Pm70 (KOH handles) LPS ^aAnd core os ^{b 1}H-and ¹³The C-NMR chemical shift.

	H-1	H-2	H-3	H-4	H-5	H-6	H-7	H-8	NOE’s
												α-GlcN a (A)	5.74 (92.5)	3.46 (55.0)	3.93 (70.3)	3.52 (70.6)	4.14 (73.4)	4.31 3.89 (70.1)			Between	Inner	Long-range
-	3.46 H-2
			β-GlcN a (B)	4.89 (99.9)	3.17 (56.4)	3.91 (72.6)	3.92 (75.2)	3.78 (74.7)	3.72 3.57 (63.2)												4.31α-GlcN H-6 3.89α-GlcN H-6	3.91 H-3 3.78 H-5
Kdo a (C)	-	-										2.37 2.03 (35.0)	4.62 (71.1)	4.28 (72.7)	3.83 (73.0)	3.77 (70.1)	3.97 3.72 (64.5)	3.72β-GlcN H-6 3.57β-GlcN H-6
			Hep I a (E)	5.19 (100.1)	4.15 (71.0)	4.03 (74.1)	4.20 (75.0)	4.20 (72.4)	4.08 (81.4)	4.08 3.92 (63.7)											4.28 Kdo H-5 3.77 Kdo H-7	4.15 H-2
Hep I b (E)	5.10 (99.4)	4.02 (70.6)										3.99 (nd)	4.22 (73.9)	nd (nd)	4.11 (79.5)	3.86 3.73 (62.1)		nd nd	4.02 H-2
			Hep II a (F)	5.74 (99.8)	4.34 (79.8)	4.47 (75.3)	4.09 (66.6)	3.67 (72.8)	4.09 (69.4)	3.71 3.62 (64.1)											5.23 Hep III H-1 4.03 Hep I H-3	4.34 H-2

Hep II b(F)	5.87 (99.4)	4.31 (80.6)	4.41 (76.3)	4.09 (66.2)	3.67 (72.3)	4.09 (69.7)	nd nd (nd)	5.23 Hep III H-1 3.99 Hep I H-3	4.31 H-2
											Hep III ab(G)	5.23 (102.0)	4.06 (71.7)	3.90 (71.8)	3.87 (67.2)	3.88 (72.7)	4.06 (70.6)	3.80 3.76 (64.6)	5.87 Hep II H-1 4.31 Hep II H-2	4.06 H-2
β-Glc(Glc I) ab(I)	4.65c (104.2)	3.56 (74.4)	3.41 (78.2)	3.63 (70.6)	3.53 (74.9)	4.11 3.75 (65.8)	-	4.22 Hep I H-4 4.11 Hep I H-6	3.53 H-5 3.41 H-3	5.22 Glc II H-1
											α-Glc(Glc II) ab(H)	5.22 (101.9)	3.60 (72.3)	3.83 (73.1)	3.61 (68.7)	3.93 (71.7)	3.97 3.77 (60.6)	-	4.11 Hep I H-6	3.60 H-2	4.65 Glc I H-1
Hep IV ab(J)	5.12 (100.2)	4.01d (70.1)	4.00 (69.8)	4.15 (78.0)	3.94 (71.1)	4.31 (80.1)	nd nd (nd)	4.11 Glc I H-6 3.75 Glc I H-6	4.01 H-2
											β-Glc(GlcIII) ab(K)	4.70 (103.5)	3.36 (74.3)	3.55 (76.6)	3.44 (70.6)	3.58 (76.9)	3.96 3.76 (61.7)		4.15 Hep IV H-4	3.55 H-3 3.58 H-5
3-Glc(Glc IV) ab(L)	4.69 (104.4)	3.46 (74.1)	3.71 (75.2)	3.71 (79.8)	3.70 (75.7)	4.02 3.84 (61.1)		4.31 Hep IV H-6 4.15 Hep IV H-4	3.71 H-3 3.70 H-5

β-Gal(Gal I) ab(M)	4.53 (104.3)	3.61 (71.8)	3.77 (73.2)	4.07 (78.4)	3.81 (76.4)	3.93 3.86 (61.4)	3.71 Glc IV H-4	3.77 H-3 3.81 H-5
										α-Gal(Gal II) a(N)	4.99 (101.2)	4.07 (68.8)	4.17 (79.9)	4.32 (69.9)	4.42 (71.4)	3.72 3.72 (61.2)	4.07 Gal I H-4	4.07 H-2	3.81 Gal I H-5
α-Gal(Gal II) b(N)	4.95 (101.4)	3.93 (68.7)	4.02 (79.9)	4.29 (69.9)	4.41 (71.3)	3.71 3.71 (61.4)	4.07 Gal I H-4	3.93 H-2	3.81 Gal I H-5
										β-GalN I a(O)	5.01 (101.3)	3.53 (53.1)	4.20 (74.3)	4.40 (63.9)	3.80 (76.2)	nd nd (nd)	4.17 Gal II H-3	4.20 H-3 3.80 H-5
β-GalNAc I b(O)	4.73 (103.7)	4.12 (51.9)	3.84 (75.7)	4.13 (64.7)	3.67 (75.9)	nd nd (nd)	4.02 Gal II H-3	3.84 H-3 3.67 H-5
										α-GalN II a(P)	5.53 (92.6)	3.65 (51.5)	4.23 (67.0)	4.07 (68.8)	4.01 (73.4)	3.82 3.82 (62.1)	4.20 GalNAc I H-3	3.65 H-2
α-GalNAc II b(P)	5.09 (94.5)	4.24 (50.4)	3.82 (68.7)	4.03 (69.3)	3.89 (72.5)	3.82 3.82 (61.8)	3.84 GalNAc I H-3	4.24 H-2	4.12 GalNAc I H-2

pEtn b	3.26 (40.1)	4.16 (62.2)
			CH 3C＝O b	2.06 (22.4)
CH 3C＝O b	2.04 (22.1)

^aLPS data from the KOH processing; ^bData from the core os sample; ^AbFrom the LPS of KOH processing and the data of OS sample, ownership is consistent; Except the residue I's of the LPS that handles from KOH ^cThe H-1 chemical shift is the residue J of 4.60ppm and the LPS that handles from KOH ^dThe H-2 chemical shift is 4.11ppm.

Embodiment 3, and table 3. is in pasteurella multocida genome bacterial strain Pm70, and LPS examines biosynthetic vertebra and decides glycosyltransferase.

The pasteurella multocida gene	Estimation function	Best autoploid	e-value
				M1305	Kdo to lipid A a-2,6 Kdo transferring enzymes	KdtA Hi(HI0652) KdtA Hd(HD0454)	e -152e -120
M1843	Hep I to Kdo α-1,5 heptose based transferase	WaaC Kp WaaC Ec	e -96e -94
				M1302	Hep I to Kdo α-1,5 heptose based transferase	OpsX Hi(HI0261)	e -149
M1844	Hep II to Hep I α-1,3 heptose based transferase	RfaF Hi(HI1105) RfaF Hd	e -164e -139
				M1294	Hep III to Hep II α-1,2 heptose based transferase	OrfH Hi(HI0523)	e -127
M0223	PEtn to Hep II	Lpt3 Nm(NMB2010)	e -154
				M1306	G1c I to Hep I β-1,4 Transglucosylase	LgtF Hi(HI0653)	e -108
M1144	Hep IV to Glc I α-1,6 heptose based transferase	LbgB App LbgB Hd(HD1720)	e -93e -87
				M1143	Glc IV to Hep IV β-1,6 Transglucosylase	LbgA Hd(HD1721) LbgA App	e -74e -73
M1141	Gal I to Glc IV β-1,4 galactosyltransferase	Lic2a Hi(HI0550)	e -38
				M1139	Gal II to Gal I α-1,4 galactosyltransferase	LgtC Hi(HI0258) LgtC Nm	e -62e -59
M1140	GalNAc I to Gal II α-1,3 N-acetyl-galactosaminyl transferase	LgtD Hi(HI1578)	e -83

M1138	GalNAc II to GalNAc I β-1,3 N-acetyl glucosamine ammonia transferring enzyme	GTase App	e -62
				M0858	The CMP-Kdo synthetic enzyme	HI0058	e -103
M0884	The ADP-Hep pyrophosphorylase	HI1526						0
				M1289	UDP-Glc pyrophosphorylase (galU)	HI0812	e -145
M0286	UDP-Glc-4-isomerase (galE)	HI0351	e -173
				M1030	UDP-N-acetyl glucosamine ammonia isomerase	HI0873	e -122

Embodiment 4 present embodiments have formed the basis of one piece of document in " Carbohydrate Research340,59 (2005) ".The lipopolysaccharides structural analysis of pasteurella multocida bacterial strain VP161.

Present embodiment has been illustrated the lipopolysaccharides structure that derives from pasteurella multocida bacterial strain VP161.This lipopolysaccharides is easy to be subjected to the influence of multiple degradation process.Set up the structure of purified product by monose and methylation analysis, NMR spectrum and mass spectrum.Following lipopolysaccharides structure is to determine on the basis of the binding data of these experiments,

Wherein, according to the NMR data, all sugar all exists with the pyranose ring form, and Kdo represents 2-ketone-3-deoxidation-octulosonic acid, and L-α-D-Hep represents L-glycerine-D-sweet dew-heptose, and PPEtn represents the tetra-sodium thanomin, and PCHo represents phosphorylcholine.What is interesting is, when detecting the LPS of the complete deacetylation of O-, clearly, in the arranging of the Kdo zone of this molecule, have variability.Discovery has the sugared type of a Kdo-P part, and the sugared type with Kdo-Kdo group.In addition, when having two Kdo residues, Glc II residue is not connected on the Hep I, but when Kdo-P arranges when very complicated, Glc II residue then is connected on the Hep I, this discloses a kind of biochemical synthetic uncompatibility, and this uncompatibility ascribes sterically hindered effect or inappropriate receptor conformation to.Comprising genome strain Pm70, in the pasteurella multocida bacterial strain that other are studied the Kdo district of LPS has also found this variation.

Pasteurella multocida (Pm) is a Gram-negative bacteria, also is the pathogenic agent of a plurality of species, can produce very serious disease in the edible animal and the mankind.The Pm bacterium is the fowl cholera of chicken or turkey, the hemorrhage septicemia of ox, the bite pathogenic media of transmissible disease of atrophic rhinitis and people's cat and dog.Just identified some Pm virulence factors, these virulence factors comprise pod membrane and the LPS of serologic group A and B before.Yet,, have the report of mutual contradiction about the intracellular toxin character of the LPS that separates from Pm.From serologic group B:2 strain is isolated be proved to be in toxic LPS, vein injects the clinical symptom that LPS can produce hueppe's disease bison.But, find the lethal effect that the turkey poult can be resisted isolating LPS from Pm serologic group A strain relatively, although the liver injury of its inflammatory reaction and microscopic is to viewed similar in mammalian hosts.In contrast, find that Embryo Gallus domesticus and mouse are extremely sensitive for the toxic action of Pm LPS.

Based on the antibody response to LPS, the Pm bacterial strain can range Heddleston serotype, and simultaneously, the antibody that produces at hot deactivation Pm vaccine is mainly used in opposing LPS, and protection host opposing has the bacterial strain of phase homologous serotype.Studies show that in early days; adopt hot phenol/water method purifying and be injected into mouse and the LPS of rabbit body produces very weak antibody response; and do not produce the provide protection that opposing Pm infects; yet; identical lps injection is in the chicken body; then induce good antibody response, this antibody response can be protected inoculator's resist the disease passively.The monoclonal antibody that is produced by the LPS of serotype A bacterial strain demonstrates and has microbe killing properties, and can protect mouse opposing homology to attack fully.In addition, the conditioning monoclonal antibody of anti-Pm serotypes B bacterial strain LPS shows and can partly protect mouse opposing Pm to infect.

Can influence Pm viability in vivo undoubtedly through the LPS structure of modifying.Recently, picked out the three strains quilt mutant of the Pm bacterial strain VP161 of attenuation significantly, each mutant locates all to have a single transposon to insert at gene pm1294 (called after waaQpm).This gene pm1294 is proved to be subsequently and is used to encode the heptose based transferase, and the sudden change of this gene produces the LPS structure of height brachymemma.In addition, just be fabricated out before the Pm galE mutant, and in the mouse body attenuation, but do not have its LPS structural analysis to be reported.Employing according to the Pm kantigen, is grouped into 5 kinds of serotype group A, B, D-F with its strain isolated by serotype by the passive hemagglutination test that the red blood corpuscle of kantigen sensitization carries out.Serologic group A (hyaluronic acid), the structural information of the pod membrane of D (heparin) and F (chrondroitin) is obtainable, each in described hyaluronic acid, Vitrum AB and the chrondroitin all is the mucopolysaccharide of fully being studied.Somatocyte (LPS) type also can be used for the identification of cell strain, and two kinds of systems that mainly reported are arranged here.The Namioka system tests based on tube agglutination, can discern 11 kinds of serotypes; And the Heddleston system is used gel diffusion precipitation reaction, can discern 16 kinds of serotypes, is present preferred method.

1981, begin to recommend to use a kind of modular system of identifying pasteurella multocida serotype, this system utilization letter A, D, E and F distinguish Carter pod membrane type, utilize numeral to distinguish Heddleston somatocyte type simultaneously.Pm expresses does not have the antigenic LPS molecule of polymer O-, promptly so-called rough type LPS.Recently, we have analyzed the LPS structure of genome bacterial strain Pm70, and this LPS structure shows rough type LPS structure.The research is also at another kind of Pm bacterial strain, and promptly (a kind of highly toxic serotype A: carry out 1 bacterial strain), with the enlightenment of acquisition to the PmLPS structure, and whether the Kdo zone of research in bacterial strain exists variation to VP161.Before, we characterize out the core os of the heptose based transferase mutant of VP161, and we report the complete structure of LPS here, and the novel of Kdo zone that is included in the LPS molecule arranged.

Experiment

Substratum and culture condition

Pasteurella multocida VP161 on the Chocolate Agar flat board in 37 ℃ of initial growth 16h, then culture is inoculated into 1L brain heart infusion (BHI) substratum, this brain heart infusion (BHI) substratum is added with β-NAD that final concentration is 5ug/ml (Sigma N-7400), and final concentration is protohemine (Sigma H-2250) and 1% glucose (10g) of 5ug/ml.Then, culture behind 37 ℃, 200rpm incubation 6h, is inoculated into fermentor tank.Then, pasteurella multocida VP161 in 24L BHI meat soup, cultivates 18h under 37 ℃, 20%DO value condition in the 28L fermentor tank.Add phenol to 2% and come cell killing, add 1g Unidasa (RocheChemicals) and stir 1h behind the adding phenol 3h; Afterwards, use Sharples continuous centrifuge (～210g) harvested cell.

The separation of lipopolysaccharides, purifying and degraded

With pasteurella multocida cell (the about 210g of weight in wet base) freeze-drying, obtain about 56g freeze drying cell.In order to improve the LPS extraction efficiency, freeze drying cell is removed lipid and other lipophilic compositions with organic solvent washing (1 times of ethanol, 2 times of acetone, 2 times of light sherwood oils).Cell after the washing (obtaining 10g from about 42g) adopts hot phenol/water method to extract, and water merges and relative flowing water dialysis 48h.With the retentate freeze-drying, obtain about 1.6g, be formulated as 2% aqueous solution, handle 4h with DNA enzyme and RNA enzyme at 37 ℃, next handle 4h at 37 ℃ with Proteinase K.Little peptide is removed in dialysis.After the freeze-drying, (about 0.2g) is formulated as 2% aqueous solution with dialysate, under the 8000g centrifugal 15 minutes (must about 85mg 8K precipitation), then with supernatant liquor 100, further centrifugal 5h under the 000g.The precipitation that will contain the LPS of purifying is dissolved again, freeze-drying (must about 17mg).In order to prepare O-deacetylation LPS (LPS-OH), with 8K deposited material (about 40mg) with anhydrous hydrazine at 37 ℃ of stir process 1h.The cooling of above-mentioned reaction ice bath then, step by step, adds cold acetone (70 ℃, 5 times of volumes) and destroys excessive hydrazine, and, freeze-drying separation centrifugal by dissolved precipitation (about 35mg) again obtains sedimentary LPS-OH.Then, sample carries out purifying with freeze dried each component by Bio-Gel P-2 post.With 1% Glacial acetic acid (10mg/ml, 100 ℃, 1.5h) handle 8K deposited material (about 45mg) and LPS (about 17mg) respectively, subsequently by centrifugal (5,000g) remove insoluble lipid A, separate to obtain core oligosaccharide (OS).Then, adopt process same as described above, will be further purified by Bio-Gel P-2 post from the sedimentary freeze-drying OS of 8K sample.Handle LPS-OH (about 12mg) 16h with 4N KOH at 125 ℃, the LPS of complete deacylated tRNA can be separated; Neutralized reaction product subsequently can be separated by the anionresin liquid chromatography.

Analytical procedure

Can measure sugar with the form of its alditol acetate derivative by GLC-MS.100 ℃ with 4M trifluoroacetic acid hydrolysis sample 4h, hydrolysate reduces 16h with NaBD4 in water; Then, be catalyzer with residual sodium acetate, use diacetyl oxide at 100 ℃ of acetylize 2h.The GLC-MS instrument is equipped with 30MDB-17 capillary column (speed with 3.5 ℃/min is warmed up to 260 ℃ from 180 ℃), and MS carries out under the mass spectrometric electron impact pattern of VarianSaturn II.Carry out methylation analysis by NaOH/DMSO/ methyl-iodide method, and use GLC-MS and analyze.Absolute conformation can be analyzed by the GLC of butyl glycoside derivative to determine.

Mass spectroscopy

Directly with sample dispersion in 25% acetonitrile solution that contains 0.5% acetate, (Micromass, Manchester carry out ESIMS and analyze under negatively charged ion pattern U.K.) at the VGQuattro mass spectrometer.Capillary electrophoresis (CE)-MS is at the Prince CE (PrinceTechnolgies of system, The Netherlands) carries out in, this Prince CE system is by a little spray interface and API 3000 mass spectrometers (Applied Biosysten/Sciex, Concord, Canada) connection.Protection liquid (Virahol-methyl alcohol, 2: 1) with the speed of 1 μ L/min be transported to a Y-tube with low dead volume (250 μ m i.d., ChromatographicSpecialties) in.All aqueous solution passes through 0.45-μ m filter membrane (Millipore) before use and filters.A stainless steel electrospray syringe needle (No. 27) makes protection liquid can be transported to the end of capillary column in abutting connection with the Y-tube that should hang down dead volume.Use pH9.0, the deionized water solution of 10mM ammonium acetate/ammonium hydroxide that contains 5% methyl alcohol is as elutriant, melts at the sky that is about 90cm and finishes separation in the silicon capillary.Generally use 20kY voltage in the injection site.Use laser pincers (SutterInstruments) that outlet capillaceous is tapered to 15 μ m i.d.Under the total quality scan pattern, the residence time of every 1m/z unit step is set to 3.0ms, can obtain mass spectrum spectrum.Every 1m/z unit residence time is set to 1.0ms, obtains the MS/MS data.In having only four utmost point collision cell of RF, selected precursor ion and nitrogen collisional activation form fragmention, extremely fragmention are carried out mass spectroscopy by the scanning third stage four.

Nucleus magnetic resonance

NMR experiment use a 5mm or 3mm triple resonant ( ¹H, ¹³C, ³¹P) probe carries out on VarianInova 400,500 and 600MHz spectrograph.Freeze dried sugared sample dissolution is in the 99%D20 of 600 μ L (5mm) or 140 μ L (3mm).This NMR experiment is carried out under 25 ℃, to be suppressed at HOD (the deuterate H at 4.78ppm place ₂O) signal.Acetone is 2.225ppm's ¹H spectrum and 31.07ppm's ¹³The resonance of C spectrographic methyl is as internal reference.From Varian, COSY, TOCSY, NOESY, ¹³C- ¹H HSQC, ¹³C- ¹H HSOC-TOCSY and ¹³C- ¹H HMBC is used to general ownership with the relevant 2D pulse sequence of standard nuclear together and heteronuclear.1D ¹³The P experiment is 40ppm a sweep length, and 20000transient carries out in Varian Inova 200 spectrographs of acquisition time 1.6s.2D ¹H- ³¹P HSQC experiment is carried out 6h on Varian Inova 400 spectrographs.Test and optimize coupling constant by carrying out a series of 1D-HSQC at 10Hz.F2 ( ¹H) Wei sweep length is 6.0ppm, F1 ( ³¹P) Wei sweep length is 16.2ppm.The water presaturation time of relaxation delay phase is 1.5s, and the t2 acquisition time is 0.21s, under the pattern of every lattice 180 (HMQC) scanning, can obtain 32 lattice.Adopt and the identical parameter of HSQC experiment, 2D ¹H- ³¹P HSQC-TOCSY experiment is carried out 8h under Varian Inova 400 spectrographs, wherein the TOCSY mixing time is 150ms.

Result and analysis

The research of pasteurella multocida bacterial strain VP161

The glycan analysis result of the LPS of purifying and 8K deposited material shows, glucose (Glc), and the ratio of semi-lactosi (Gal) and L-glycerine-D-sweet dew-heptose (LD-Hep) is about 2: 1: 4 respectively.Simultaneously, also identify small amount of N-acetyl-glycosamine (GlcNAc).The GLC analytical results of butyl-glucosides deutero-core oligosaccharide shows that Glc and Gal all are D-type isomer.

LPS-OH can be prepared by the LPS of fermentor cultivation cell, uses CE-MS then it is analyzed (embodiment 4 tables 1).At m/Z is that 992.0,999.0 and 1040.0 places observe trivalent ion, and concerning smallest molecule, these trivalent ions are corresponding to 2PCho, 4Hep, 3Hex, the composition of 2Kdo and hydroxyl lipid A.As shown in following, bigger sugared type is corresponding to such molecule, and phosphoric acid molecules substitutes second Kdo residue in this molecule, and the hexose residue more than is arranged on the nuclear oligosaccharides; For the sugared type (m/z 1040.0) of maximum, then corresponding to additional PEtn residue is arranged at the Kdo-P place.Through Chocolate Agar is dull and stereotyped cultivate after, sugared type in addition can be that 1033.0 and 1081.0 trivalent ion shows (embodiment 4 tables 1) by m/z.The MS/MS analytical results shows that in sugared type mixture, found two kinds of different hydroxyl lipid A-OH types, it is that molecular mass is the type of foundation of 952amu, can be that 475.5 and 951.5 divalence and monovalent ion shows according to the m/z of MS/MS; Another kind contains the type of additional PEtn residue, is that 536.5 divalent ion is revealed (Figure 27 C) according to the m/z of MS/MS.The type of foundation (952amu) of O-deacylated tRNA lipid A comprises the disaccharides of N-acetyl (3-OH C 14:0) glycosamine residue, and each residue all uses a phosphoric acid molecules to replace.Because m/z is the existence of 1033.0,1040.0 and 1081.0 trivalent ion, bigger lipid A type only could be observed in dull and stereotyped grown cell and be obtained.In addition, found the evidence that has a part of P-PEtn according to the MS/MS of sugared type, this with by the trivalent ion m/z1040.0 of univalent ion (m/z is 219.5) and 1081.0 corresponding (Figure 27 c).The MS/MS that according to m/z is 992.0,999.0 and 1033.0 trivalent ion does not find this ion.Further the MS/MS test has shown the core os bulk of molecule.For m/z is 992.0 trivalent ion, and as indicated in m/z is 1012.5 divalent ion, core os is that (Figure 27 a) for 2027amu.This is corresponding to the composition of 2Kdo, 2PCho, 4Hep and 3Hex.For m/z is 999.0 trivalent ion, and as indicated in m/z is 1023.5 divalent ion, core os is 2049amu (Figure 27 b).This is corresponding to Kdo, P, 2PCho, 4Hep, the combination of 3Hex.It for m/z 1040.0 trivalent ion, as as indicated in m/z is 1084.5 divalent ion, the discovery core os is 2172amu, perhaps, as as indicated in m/z is 536.5 divalent ion, the supposition core os is 2049amu, and it is corresponding to the basic lipid A type (Figure 27 C) that has additional PEtn residue.Therefore, be used to discern m/z confirmed by the feature divalent ion of two kinds of lipid A types of 475.5 and 536.5 as those two, m/z be 1040.0 ion corresponding to the isomerose type, this isomerose type has part P-PEtn or have additional PEtn on lipid A on the Kdo.In MS/MS analyzes, also observed and lost CO from Kdo ₂Evidence, generally all like this.

Core oligosaccharide (is derived from LPS and 8K deposited material, the generation identical spectra) MS that carries out separately analyzes, show the different form of chips that come from m/z 903.0 and 984.0 bivalent positive ion, these bivalent positive ions are corresponding to the divalence negative ion that in embodiment 4 tables 1 at m/z is 902.0 and 983.0, and this is with to go up the existence of hexose residue near the heptose residue (Hep I) of Kdo the most consistent with disappearance.(Figure 28 MS/MS a) has shown and the corresponding to form of chips of disappearance Hex residue on Hep I the divalent ion of m/z 903.The MS/MS of the divalent ion of m/z 984 (Figure 28 b) shows, compare with the former, bigger OS has additional hexose residue, this hexose residue is positioned on the Hep I residue, this point can be by m/z682.0 bivalent ions existence, and according to the disappearance of this signal of the bivalent ions MS/MS of m/z 903.0 but the bivalent ions appearance of m/z 697.0 determines that (Figure 28 is a).These aggregation of data get up to show that VP161 LPS has produced one group of new sugared type, and some sugared types comprise an a kind of Kdo type that has phosphoric acid or be connected with tetra-sodium thanomin part, and the another kind that comprises two Kdo molecules.In the kind that comprises two Kdo molecules, on the immediate heptose residue of core os, there is not the hexose residue, this shows that this biosynthesizing of arranging is impossible.The position of PCho residue also can be determined by these MS/MS tests under positive ion mode.M/z is that 424.5 divalent ion is found the composition corresponding to 2PCho, 2Hex and Hep, it is respectively 328.5 and 520.5 monovalent ion with PCho-Hex and the corresponding m/z of PCho-Hex-Hep that this bivalent ions follow-up MS/MS/MS demonstrates, and this shows that two PCho-Hex partly are connected in Hep residue (Figure 28 c).

In order to determine the mode of connection of molecule, O-deacylated tRNA LPS (LPS-OH) has been carried out methylation analysis, the result shows terminal Glc, the Glc that 6-replaces, terminal LD-Hep, the LD-Hep and 4 that 2-replaces, the dibasic LD-Hep of 6-is about 1: 1: 1 with mol ratio: 1 ratio exists, simultaneously, also found the terminal Gal of minute quantity, 3, the dibasic LD-Hep of 4-and 3,4, the trisubstituted LD-Hep of 6-.After for the HF treating processes of removing the phosphoric acid residue (these phosphoric acid residues can hinder phosphorylation sugar in hydrolytic process optimum discharges), repeat methylation analysis, the result shows, except that the t-Gal residue, identical sugar exists with identical ratio, this t-Gal residue doubles the amount of other compositions now, and this shows that the PCho residue has replaced the Gal glycosyl.

In order to illustrate definite position and the mode of connection of OS, those spectrographic OS with homogeneous that can send tool decision have partly been carried out NMR research.With the core os of those structurally associateds as a reference, described core os derives from pasteurella multocida strain Pm70 and relevant bacterial classification (hemolytic Man bacillus and actinobacillus pleuropneumoniae), has obtained the ownership (embodiment 4 tables 2) of the 1H resonance signal of OS sample by COSY and TOCSY experiment.From nearest disclosed pasteurella multocida strain Pm70, kernel residue (Hep IV (f/f ')) to the turn of a hair be connected on the kernel, the listed ownership of embodiment 4 tables 2 is also consistent with it.Yet, do not have the PEtn residue in the 3-position of the HepII of VP161 core os (b).For the core os sample, what is interesting is, go up the existence of GlcII residue (e) and distinguish (Figure 29) that disappearance can cause two groups of signals to the kernel residue of remainder at HepI (a).As mentioned above, two Glc I signals of 4.64 (d) and 4.51 (d ') ppm can be by being connected to HepI (a) the 4-position and the NOE of 6-position identify, yet, when Glc II lacked, the disappearance that connects at GlcII (e) and the NOE between the anomer proton resonance of the GlcI of 4.51ppm place residue (d ') identified the spin system of this GlcI (d ') residue.Otherwise, when GlcII exists, GlcII (e) and the existence that between the NOE of the anomer proton resonance of the GlcI of 4.64ppm place residue (d), is connected, then characterize out the spin system (Figure 29) of this GlcI (d) residue, before just in the LPS of Pm70 and relevant species hemolytic Man bacillus and actinobacillus pleuropneumoniae, observed being connected between this anomer NOE.Adopt this mode, based on existence and the disappearance of GlcII (e), the remaining kernel residue of ownership just becomes possibility.The position of the hexose residue on Hep IV (f/f ') still also needs to illustrate with identifying.MS analyzes demonstration, and two hexose residues all are substituted with the PCho residue, and all substitutes onto on the HepIV (f/f ').The increase of determined t-Gal amount has confirmed this point in the methyl analysis of carrying out after HF handles, and this shows that the hexose residue that supports PCho all is the Gal glycosyl.The Gal residue of two beta comfigurations (Gal I and GalII) relies on their coupling constant and the specific rotational system of H-4, and is identified in the core os sample at 4.70 (g) and 4.66 (h) ppm place respectively.Gal I (g) and Gal II (h) link position on Hep IV (f/f ') can be inferred out by the NOESY experiment, this NOESY experiment shows that GalI residue (g) is connected the 4-position of Hep IV (f), and Gal II residue is connected to the 6-position (Figure 29) of Hep IV (f/f ').This supposition can be passed through ¹³C- ¹The H-HMBC experiment is confirmed, should ¹³C- ¹The H-HMBC experiment also confirms other annexations (Figure 30) on core os simultaneously.In order to determine the position of two PCho residues, carried out ³¹P- ¹H-HSQC and ³¹P- ¹H-HSQC-TOCSY experiment, results verification the 3-position of each Gal residue of ownership in advance are the link positions (Figure 31) of each PCho residue.This can pass through ¹³C- ¹The H-HMQC experiment is confirmed, and the chemical shift of each C-3 atom of (about 78ppm) Gal residue in the downfield district of this experimental verification is consistent with phosphorylation.

In order further to explore, the deacetylation sample after KOH handles is tested newly the arranging of the Kdo zone of molecule.The LPS that will contain the complete deacetylation of one and two Kdo residue partly separates, and this is (Figure 32 a and the b) that can accomplish.Clear and two the Kdo residues that have the bag sugar-containing type that inerrably manifest of Figure 32, with two groups of transverse axis in Figure 32 b and longitudinal axis proton signal (z3e, z3a, z ' 3e and z ' 3a) compare, having only one group of transverse axis and longitudinal axis signal for the H-3 proton of Kdo among Figure 32 a is visible.For a Kdo residue that comprises sample, complete ownership is possible, still, owing to can only obtain this glycosyl of minute quantity, causes very faint spectral signal, and for two Kdo residues that comprise sample, only the part ownership is possible.Yet the fundamental research in these two spectral signal anomer zones (rudimentary examination) shows undoubtedly, in Figure 32 a, has Glc II residue (e) signal (only having a Kdo residue here); In Figure 32 b, there is not the signal (having two Kdo residues here) of Glc II residue (e).Shown as the core os data, the existence of Glc II residue or disappearance can influence the chemical shift of several other anomer proton resonances, particularly, and Hep I (a), the chemical shift of Hep II (b) and Glc I (d) signal, this with the influence of inner core molecule conformation is matched.The ownership of a Kdo residue of bag sugar-containing type is listed in embodiment 4 tables 2, and this has confirmed the ownership based on the core os sample, and it can be expanded to the ownership in the Kdo-lipid A zone that comprises the sugared type that contains a Kdo residue.

The structural analysis of pasteurella multocida (Pm) VP161 strain oligosaccharides has shown that a kind of and fixed LPS core oligosaccharide structure before have the structure of similarity and otherness, these core oligosaccharide structures are the genome bacterial strain Pm70 Man bacillus of relevant species hemolytic with other (Mh) at Pm, actinobacillus pleuropneumoniae (Ap).In each case, core os comprises three heptose unit that are equal to connection that are connected on the Kdo residue.What is interesting is that in Pm70, the 3-position most cases of Hep II residue is all replaced by the PEtn residue, and in relevant species App with other of VP161 bacterial strain and Mh, does not then find kernel PEtn residue.Eliminating replaces this point of HepII with PEtn and changes, and the Pm bacterial strain is enjoyed an inner core of guarding relatively with relevant domestic animal species Mh and App.Only other differences of Pm inner core are, compare with the heptose residue of the D-glycerine-D-sweet dew configuration that in App and Mh, is run into, L-glycerine-heptose the residue of D-sweet dew configuration is positioned at the extension of the GlcI residue of HepI, and the existence of Pm kernel GlcII residue is variable, and this is the Pm that the variability by molecule Kdo zone causes obviously.Chemistry has been found this GlcII residue quantitatively in the kernel LPS of App and Mh.Found to extend in the difference of this conservative kernel area in the VP161 bacterial strain, thus, HepIV residue quilt is in the two replacements of the part of the PCho-Gal of 4-position and 6-position.As far as we know, also not observing this structure in the past arranges.Run into two PCho residues in same LPS molecule, this is rarely found; It is this only document record examples of arranging that atypia Hi carries bacterial strain 11 and 16.The existence of PCho residue may be related to the toxicity of Pm organism, and document has been reported PCho adhering to and the cluster effect in respiratory tract.Find also that simultaneously the mutant of bacterial strain VP161 all is attenuated in mouse model and chicken, this mutant present two PCho residues of disappearance by the LPS structure of brachymemma.Other authors' early stage research also found the reduction on the galE mutant toxicity of Pm serotype D bacterial strain, may since the LPS structure change caused.Yet the attractive spot of VP161 LPS structure is exactly the Kdo zone variation of being found, has had been found that the sugared type that comprises a Kdo and two Kdo in this Kdo zone.In addition, being arranged by the Kdo zone changes the influence to inner core caused, and promptly HepI goes up existence or the disappearance of Glc II, is interesting.It is not known at present to α-1,6 Transglucosylase that Hep I residue shifts to be responsible for GlcII.It is pointed out that the unique homologue that only identifies the Kdo transferring enzyme in Pm genome bacterial strain Pm70, the LPS of this Pm bacterial strain comprises the group of the kind that has one and two Kdo equally.What is interesting is, the gene order of the Kdo transferring enzyme by relatively deriving from Pm, App and Mh, relate to described variation with the regulatory factor of probing into the difference on any sequence and probing into other, the difference on the above-mentioned sequence is attributable to the difunctionality characteristic PmPmMh of Pm transferring enzyme.Originally determined the LPS structure of second kind of Pm bacterial strain, these two kinds of bacterial strains have similar inner core and variable outer core is modified, and all show interesting variation in the Kdo zone of molecule, and the importance of this variation needs further research.

Embodiment 4, table 1: form from the O-deacylated tRNA LPS (LPS-OH) of pasteurella multocida bacterial strain VP161 and the negatively charged ion CE-MS data and the supposition of core os.Average quality unit forms according to following supposition and is used to calculate molecular weight: Hex, 162.15; Hep, 192.17; Kdo, 220.18; PEtn, 123.05; Lipid A-OH, 952.00.

Bacterial strain	[M-3H] 3-	[M-4H] 4-	Observed molion	The molion that calculates	The lipid A size	The core os size	Infer and form
								VP161 LPS-OH VP161 core os	992.0 999.0 1033.0 1040.0 1040.0 1081.0	744.0 749.0 774.0 780.0 780.0 810.0 [M+2H] 2+ 901.8 982.9	2979.5 2999.5 3101.0 3123.5 3123.5 3245.0 1805.6 1967.8	2977.6 2999.5 3100.7 3122.6 3122.6 3245.6 1805.4 1967.6	952 952 1075 952 1075 1075 - -	2025.6 2047.5 2025.7 2170.6 2047.6 2170.6	2PCho, 3Hex, 4Hep, 2Kdo, lipid A-OH 2PCho, 4Hex, 4Hep, Kdo-P, lipid A-OH 2PCho, 3Hex, 4Hep, 2Kdo, lipid A-OH 2PCho, 4Hex, 4Hep, Kdo-P-PEtn, lipid A-OH 2PCho, 4Hex, 4Hep, Kdo-P, lipid A-OH 2PCho, 4Hex, 4Hep, Kdo-P-PEtn, lipid A-OH 2PCho, 3Hex, 4Hep, Kdo 2PCho, 4Hex, 4Hep, Kdo

Embodiment 4, table 2: for the core os that comes from pasteurella multocida VP161 and fully deacylated tRNA (KOH handles) LPS 1H-and ¹³The C-NMR chemical shift. ^aThe LPS data that KOH handles are come the sugared type of self-contained Kdo residue; ^bThe data of core os sample; ^aThe LPS that bKOH handles and the data of OS sample, ownership is consistent.Because sizable heterology that the hydrolysis of Pcho residue and migration are introduced, thereby do not comprise the data of the LPS that the KOH from GaI-I and GaI-II handles.

	H-1	H-2	H-3	H-4	H-5	H-6	H-7	H-8	NOE’s
												α-GlcN a (x)	5.75 (92.7)	3.47 (55.1)	3.93 (70.5)	3.53 (70.7)	4.13 (73.7)	4.31 3.90 (70.2)			Between	Inner	Long-range
			β-GlcN a (y)	4.88 (100.0)	3.17 (56.6)	3.92 (72.8)	3.94 (75.3)	3.78 (74.9)	3.75 3.59 (63.4)
Kdo a (z)	-	-										2.37 2.06 (35.0)	4.62 (71.2)	4.29 (72.9)	3.84 (nd)	3.77 (70.3)	3.96 3.72 (64.6)

Hep-I a(a)	5.18 (100.4)	4.13 (71.3)	4.01 (75.2)	4.19 (75.2)	4.19 (72.8)	4.11 (81.5)	nd nd (nd)	4.29 Kdo H-5	4.09 H-2
											Hep-I b(a)	5.07 (101.9)	4.09 (71.3)	3.96 (73.9)	4.20 (74.7)	3.78 (72.9)	4.13 (80.3)	3.88 3.75 (62.9)	nd	4.09 H-2
Hep-I b(a’)	5.01 (101.4)	4.15 (71.3)	4.04 (73.9)	4.26 (74.2)	nd (nd)	4.05 (nd)	nd nd (64.2)	nd	4.15 H-2
											Hep-II a(b)	5.62 (100.7)	4.26 (80.8)	3.90 (70.9)	3.90 (67.8)	3.63 (72.4)	4.07 (69.7)	3.72 3.62 (64.6)	5.14 Hep III H-1 3.96 Hep I H-3	4.19 H-2	3.75 Hep I H-5
Hep-II b(b)	5.70 (100.1)	4.19 (80.5)	3.86 (70.7)	3.84 (67.6)	3.55 (72.8)	4.05 (70.3)	3.76 3.65 (64.5)	5.14 Hep III H-1 3.96 Hep I H-3	4.19 H-2	3.75 Hep I H-5

Hep-II b(b’)	5.76 (99.7)	4.17 (80.5)	3.85 (70.7)	3.83 (67.6)	3.60 (72.8)	4.05 (70.3)	3.76 3.65 (64.5)	5.11 Hep III H-1 4.04 Hep I H-3	4.17 H-2	3.76 Hep I H-5
											Hep-III ab(c)	5.11 (102.4)	4.01 (71.4)	3.87 (70.8)	3.83 (67.0)	3.78 (71.6)	4.05 (70.3)	3.77 3.65 (64.9)	5.76 Hep II H-1 4.17 Hep II H-2	4.01 H-2	3.94 Hep IV H-3 3.59 Glc I H-4
Hep-III b(c’)	5.14 (102.4)	4.02 (71.4)	3.87 (70.8)	3.83 (67.0)	3.78 (71.6)	4.05 (70.3)	3.77 3.65 (64.9)	5.70 Hep II H-1 4.19 Hep II H-2	4.02 H-2	3.94 Hep IV H-3 3.57 Glc I H-4
											β-Glc-I ab(d)	4.64 (104.3)	3.54 (74.2)	3.40 (77.6)	3.59 (70.5)	3.51 (74.6)	4.09 3.76 (65.8)	-	4.20 Hep I H-4 4.13 Hep I H-6	3.51 H-5 3.40 H-3	5.20 Glc II H-1
β-Glc-I b(d’)	4.51	3.53	3.42	3.57	3.57	4.05	-	4.26 Hep I H-4	3.57 H-5

	(104.2)	(74.2)	(77.7)	(70.5)	(74.7)	3.83 (65.6)		4.05 Hep I H-6	3.42 H-3
											α-Glc-II ab(e)	5.20 (102.6)	3.58 (72.8)	3.81 (73.8)	3.58 (69.4)	3.91 (72.4)	3.93 3.74 (60.4)	-	4.13 Hep I H-6	3.58 H-2	4.64 Glc I H-1
Hep-IV ab(f)	4.95 (99.9)	4.17 (70.1)	3.93 (71.0)	4.19 (77.2)	3.91 (70.3)	4.32 (79.9)	3.97 3.75 (64.0)	4.09 Glc I H-6 3.77 Glc I H-6	4.17 H-2
											Hep-IV b(f’)	4.93 (99.9)	4.16 (70.1)	3.93 (71.0)	4.19 (77.2)	3.91 (70.3)	4.32 (79.9)	3.97 3.75 (64.0)	4.04 Glc I H-6 3.83 Glc I H-6	4.16 H-2
β-Gal-I b(g)	4.70 (103.2)	3.69 (71.0)	4.19 (78.5)	4.12 (68.6)	3.80 (75.7)	nd nd (nd)	-	4.19 Hep IV H-4	4.19 H-3 3.80 H-5

β-Gal-II b(h)	4.66 (104.5)	3.73 (71.0)	4.18 (78.5)	4.11 (68.6)	3.76 (75.5)	nd nd (nd)	4.32 Hep IV H-6	4.18 H-3 3.76 H-5
									PCho-I	4.38 (60.4)	3.68 (66.8)	3.22 (54.7)
PCho-II	4.38 (60.4)	3.68 (66.8)	3.21 (54.7)

Embodiment 5 present embodiments have formed Carbohydrate Research 340, the basis of one piece of document in 1253 (2005).Structural analysis from the core oligosaccharide of pasteurella multocida strain X 73.

In the present embodiment, illustrated structure from the core oligosaccharide of the lipopolysaccharides of pasteurella multocida strain X 73.This lipopolysaccharides is through multiple degradation process.By monose and methylation analysis, NMR spectrum and mass spectrum can be set up the structure of the oligosaccharides behind the purifying.Following structure shows and the similar structure of oligosaccharides that recognizes from another pasteurella multocida bacterial strain VP161 recently, but it has other phosphorylethanolamine part that the symmetry of terminal galactose residues is replaced,

Wherein, according to the NMR data, all sugar all is found to be the pyranose ring form, and Kdo is 2-ketone-3-deoxidation-octulosonic acid, and L, D-α-Hep are L-glycerine-D-sweet dew-heptose, and PEtn is that phosphorylethanolamine and PCho are phosphocholines.

Pasteurella multocida (Pm) is a Gram-negative bacteria, also is the pathogenic agent of a plurality of species, can produce very serious disease in the edible animal and the mankind.To genome bacterial strain Pm70 and a kind of toxicity serotype A: the lipopolysaccharides (LPS) among the 1 bacterial strain VP161 carries out structural analysis, demonstrates conservative kernel oligosaccharides (OS) structure that has the outer core OS structure of variation.This research is carried out on other a kind of toxicity serotype A strain X 73, and the structural analysis of the LPS product of purifying demonstrates an OS structure similar to bacterial strain VP161, but has extra symmetrical phosphorylation pattern on outer core OS.The glycan analysis of the LPS of the purifying in the strain X 73 and 8k deposited material, demonstrate to bacterial strain VP161 by similar forming, the sugar that contains in this bacterial strain, promptly glucose (Glc), semi-lactosi (Gal) and L-glycerine-D-mannoheptose (LD-Hep) separately approximate ratio be 2: 1: 4.O-deacylated tRNA LPS (LPS-OH) makes in the cell of fermentation culture, and analyzes (embodiment 5 tables 1) through CE-MS.Observe and observed similar mass spectrum pattern in bacterial strain VP161, but its main component is the trivalent ion of m/z1081.0 that compare with the most kinds (m/z 999.0) from VP161 LPS-OH, it is corresponding to two other PEtn residue.MS/MS analyzes and demonstrates all lipid A molecules is basic kinds; the disaccharides that comprises a N-acidylate (3-OH C 14:0) glucosamine residue; each residue is replaced by phosphoric acid molecules, and the molecular weight of determining this phosphoric acid molecules by the divalence and the monovalent ion of m/z 475.5 and 951.5 is 952amu.So this MS/MS analytical table is understood the extra PEtn residue of strain X 73 and is arranged in the core os zone of LPS molecule that the mass spectrum of the supposition of core os molecule is illustrated in the table 1 of embodiment 5.

Core oligosaccharide is carried out MS separately analyze, shown that a series of ion is consistent with the composition that obtains from the LPS-OH data-speculative, when comparing, show to have extra PEtn residue with bacterial strain VP161.Adopt cation mode can determine the position of PEtn residue from the MS/MS experiment.Ion with the fragmentation of the corresponding divalent ion m/z 1108 of the sugared type of maximum produces comprises m/z 183.5 ⁺(Pcho), 450.5 ⁺(PCho-Hex-PEtn), 547.5 ²⁺(2Hex is Hep) with 916.5 for 2Pcho, 2PEtn ²⁺(M-Kdo-Hex).At m/z547.5 ²⁺The place divalent ion with bacterial strain VP161 in m/z 424 ²⁺Special feature when making comparisons, divalent ion is arranged, because it is it demonstrates a sugared type with better quality 246amu, consistent with the existence of two PEtn residues.To m/z 916.5 ²⁺Divalent ion carries out MS/MS/MS to be analyzed, and shows that product ion spectrum is shown in Figure 33 a.Broken pattern PEtn residue among Figure 33 a is positioned the terminal HEX-Pcho part on the HepIV residue, in the follow-up broken m/z 450.5 ionic MS/MS/MS experiment (Figure 33 b), confirms that this ion is consistent with the initial PCho-Hex-PEtn part of inferring.

In order to confirm and expand these suppositions that fractionated core os sample is carried out the NMR experiment, and this sample includes two kinds of PEtn residues (being determined by the MS data that do not show).Except two terminal galactose residues, all ownership identical with in the acquisition of the core os of bacterial strain VP161.Observe the H-1 of galactose residue of VP161 sample and the chemical shift of H-2 resonance, but H-3 and H-4 resonance slightly drift about to low place, float to 4.21 and 4.17ppm from 4.17 and 4.12 respectively.Observe before between the NOE of galactose residue and connect, although observe connection (opposite) (embodiment 5 tables 2) to the NOE of H-5 residue now at 3.94ppm place with 3.80 and the 3.76ppm of bacterial strain VP161.In order to confirm the position of these two PEtn residues, can be by one ³¹P- ¹H-HSQC tests and finishes, and confirming has the attachment point of bestirring oneself altogether for each PEtn residue at the 4.07ppm place, and is follow-up ³¹P- ¹The H-HSQC-TOCSY experiment confirm is in the H-5 resonance (Figure 34) of 3.94ppm place galactose residue.4.07ppm ownership galactose residue H-6 resonance be by ¹³C- ¹The H-HMQC experiment is identified, and this shows as a-CH ₂A feature posivtive spike of part, (the downfield chemical shift of the C-6 atom of～65ppm) each Gal residue is consistent with phosphorylation in low district value.At last, ³¹P- ¹The H-HSQC-TOCSY experiment confirm confirms the attachment point (Figure 35) of 6 conducts of two galactose residues in extra two PEtn part of strain X 73 core os discovery at the intersection peak of C-6 and H-5 resonance (also can be described as H-5 and C-6 resonance).

So this studies confirm that from the similar core os structure among the LPS of another serotype A bacterial strain.Further research will expand the LPS structural analysis and arrive other serotype, check this unusual terminal structure whether exist with other serotype in.How much unusual the confirmation of PEtn is on 6 of hexose.PEtn finds on 6 of the heptose residues of meningococcus and hemophilus influenza usually.The nearest research in our laboratory has confirmed 6 places of PEtn at the terminal GalNAc of many hemophilus influenza bacterial strains residue, and 3-that report is recently also found at the Citrobacter sample connects the PEtn residue on 6 of galactose molecule of position.Observe the PCM1443 (serotype 039) that has similar chemical shift here.

1, experiment

1.1 the cultivation of bacterium, the separation of LPS and classification

Pasteurella multocida strain X 73 (NRCC#6235) is cultivated and is separated.In brief, with pasteurella multocida cell (～210g weight in wet base) freeze-drying, obtain～65g.Freeze drying cell is cleaned to remove lipoid and other lipotropic component with organic solvent (1 * ethanol, 2 * acetone, 2 * light sherwood oil), strengthens the LPS extraction efficiency.The cell of washing (getting 10g from～42g) extracts by hot phenol/water method, and water is merged, and the flowing water dialysis is 48 hours relatively.The retentate freeze-drying obtains～0.57g, makes about 2% the aqueous solution, handles 4 hours with DNA enzyme and RNA enzyme at 37 ℃, then handles 4 hours at 37 ℃ with Proteinase K.Little peptide is removed through dialysis.After the freeze-drying, retentate (～0.42g) make about 2% the aqueous solution, at centrifugal 15 minutes of 8000g (obtaining a kind of pact～265mg " 8K precipitation "), then to supernatant further 100, the centrifugal 5h of 000g.The precipitation that includes the LPS that purifying crosses is dissolved again and freeze-drying (obtain～3mg).Separation and classification go out LPS-OH and core os.In brief, 8K precipitation raw material (～15mg) and LPS (～3mg) under 37 ℃ of stirrings, handle 1h with anhydrous hydrazine, prepare LPS-OH, from the 8K prepared product, obtain～10mg, from LPS be～1mg.With 1% acetate (10mg/ml, 100 ℃, 1.5h) handle 8K precipitation raw material (～115mg),, isolate core os after centrifugal (5,000x g) remove insoluble lipoid A.Subsequently freeze dried supernatant liquor is further purified with Bio-Gel P-2 post with each freeze-dried component, obtains～40mg.

1.2 analytical procedure

Sugar is measured by GLC-MS with the form of its alditol acetate derivative.Methylation analysis is undertaken by NaOH/DMSO/ methyl-iodide method, and analyzes with GLC-MS.

1.3 mass spectrum and NMR spectroscopy

All mass spectrums and NMR experiment are finished by top description.

Embodiment 5, table 1: from O-deacylated tRNA LPS (LPS-OH) and the negatively charged ion CE-MS data of core os and the composition of supposition of pasteurella multocida strain X 73.Average quality unit forms according to following supposition and is used to calculate molecular weight: Hex, 162.15; Hep, 192.17; Kdo, 220.18; PEtn, 123.05; Pcho, 165.05; Lipid A-OH, 952.00.Relative intensity is expressed as the intensity with respect to trivalent ion maximum in the LPS-OH molecular spectrum.

Bacterial strain	[M-3H] 3-	[M-4H] 4-	Observed molion	The molion that calculates	Relative intensity	The lipid A size	The core os size	Infer and form
									X73	992.0	744.0	2979.5	2977.6	0.1	952	2025.6	2PCho, 3Hex, 4Hep, 2Kdo, lipid A-OH
LPS-OH	999.0 1033.0 1040.0 1074.0 1081.0 1122.0	749.0 774.0 780.0 805.0 810.0 841.0	2999.5 3101.0 3123.5 3224.1 3245.0 3368.5	2999.5 3100.7 3122.6 3223.7 3245.6 3368.7	0.2 0.2 0.4 0.3 1.0 0.2	952 952 952 952 952 952	2047.5 2148.7 2170.6 2271.7 2293.7 2416.7	2PCho, 4Hex, 4Hep, Kdo-P, lipid A-OH PEtn, 2PCho, 3Hex, 4Hep, 2Kdo, lipid A-OH PEtn, 2PCho, 4Hex, 4Hep, Kdo-P, lipid A-OH 2PEtn, 2PCho, 3Hex, 4Hep, 2Kdo, lipid A-OH 2PEtn, 2PCho, 4Hex, 4Hep, Kdo-P, lipid A-OH 3PEtn, 2PCho, 4Hex, 4Hep, Kdo-P, lipid A-OH
									The X73 core os	[M-3H] 3-	[M-2H] 2-

- - - - - 736.8

901.3 962.8 982.8 1024.3 1044.3 1106.3

1804.6 1927.6 1967.6 2050.3 2090.6 2214.0

1805.2 1928.2 1967.6 2051.3 2090.6 2213.7

- - - - - -

- - - - - -

2PCho，3Hex，4Hep，Kdo PEtn，2PCho，3Hex，4Hep，Kdo 2PCho，4Hex，4Hep，Kdo 2PEtn，2PCho，3Hex，4Hep，Kdo PEtn，2PCho，4Hex，4Hep，Kdo 2PEtn，2PCno，4Hex，4Hep，Kdo

Embodiment 5, table 2: from the stub area of the core os of pasteurella multocida strain X 73 ¹H-and ¹³The C-NMR chemical shift: every other residue has the chemical shift identical with bacterial strain VP161.

Residue	H-1	H-2	H-3	H-4	H-5	H-6	H-7	The NOE connectivity
										Hep IV	4.95 (99.9)	4.18 (70.0)	3.96 (70.9)	4.18 (77.4)	3.93 (70.2)	4.32 (79.9)	3.97 3.75 (63.5)	Between	Inner
4.09 Glc I H-6 3.77 Glc I H-6	4.18 H-2

β-Gal I	4.72 (103.4)	3.70 (70.7)	4.20 (78.2)	4.17 (68.2)	3.94 (74.0)	4.07 4.07 (65.4)	-	4.18 Hep IV H-4	4.20 H-3 3.93 H-5
										β-Gal II	4.70 (104.5)	3.73 (70.7)	4.21 (78.1)	4.17 (68.2)	3.94 (74.0)	4.07 4.07 (65.4)	-	4.32 Hep IV H-6	4.21 H-3 3.93 H-5
PEtn I	4.13 (62.7)	3.31 (40.8)
										PEtn II	4.13 (62.7)	3.31 (40.8)
PCho I	4.38 (60.4)	3.68 (66.8)	3.22 (54.7)
										PCho II	4.38 (60.4)	3.68 (66.8)	3.21 (54.7)

Embodiment 6 present embodiments have formed the basis of one piece of document among the Infect.Immun.72:3436 (2004).The heptose transferring enzyme mutant strain of a kind of pasteurella multocida produces lipopolysaccharides (LPS) structure of a brachymemma, and its perform toxic attenuation.

" rough type " LPS of wild-type LPS analysis revealed to pasteurella multocida VP161, to similar, have only the non-repetition polysaccharide unit of a weak point to link to each other with lipid A from isolated LPS of Gram-negative mucous membrane venereal disease substance such as hemophilus influenza, haemophilus ducreyi, Neisseria meningitidis and N.Gonorrhoeae or fat oligosaccharides.The inner core of pasteurella multocida LPS and hemophilus influenza, hemolytic Man bacillus, haemophilus ducreyi are similar, and have three heptose unit (Figure 30) that link to each other with lipid A via a KDO residue.In the AL251 mutant strain, the inactivation of waaQpm causes LPS to be expressed as the LPS that lacks the height brachymemma of the 3rd heptose molecule (Hep III) in inner core region.The LPS sugar type that content is the highest in the mutant strain lacks all sugar in first heptose distally equally, shows that the inactivation of waaQPM has stoped sugared further interpolation.Therefore probably because the structure picture of the LPS intermediate that the disappearance of the 3rd heptose causes changes the activity that has hindered the subsequent transfer enzyme greatly.

Material and method

Bacterial strain, plasmid, substratum and culture condition.The bacterial strain and the plasmid that use in this research are seen embodiment 6, table 1.Intestinal bacteria (Escherichia coli) are adopted conventional Luria-Bertani culture medium culturing.The pasteurella multocida bacterial strain adopts the nutritional medium of brain heart infusion (BHI) or nutrient broth (NB) substratum (adding 3% yeast extract) (Oxoid, Basingstoke, United Kingdom) to cultivate.Add 1.5% agar and prepare solid medium.When needing, in substratum, add the tsiklomitsin of 2.5 μ g/ml concentration.In structural research, pasteurella multocida bacterial strain VP161 and AL251 are incubated in the BHI substratum of 24L in 28 liters of fermentor tanks, under 37 ℃, cultivate 18h under 20% the DO saturation ratio.Add phenol to 2% to kill cell, add 1 gram Unidasa (Roche Chemicals) after keeping 3h, stir 1h, adopt Sharples continuous flow centrifuge harvested cell then.

The transposon stability study.Pasteurella multocida strains A L251 in cultivating 10ml NB, 37 ℃ of concussions.After cultivating about 10,34,58 generations, take out culture sample, suitably dilution is inoculated on the NB agar.After being incubated overnight, 100 clones transfer on the NB that contains tsiklomitsin, and 37 ℃ are incubated overnight.Transposon is lost by sensitive tetracycline clone's percentage and is recently represented.

SDS-PAGE and silver dye.The small-sized protein gelatin device of Bio-Rad is adopted in the analysis of LPS, according at Laemmli, and Nature 227, the SDS-PAGE that describes in 680 (1970) literary compositions carries out.Dye the visible LPS in back by silver.

The DNA operation.Restrictive diges-tion, connect and polymeric enzyme reaction according to the NEB of manufacturer (Beverley, MA) or Roche Diagnostics GmbH (Mannheim, the enzyme operator's manual that Germany) provides carries out.Plasmid DNA adopts the preparation of alkaline hydrolysis method, use the Qiagen post (QIAGEN GmbH, Germany) or the PEG precipitator method (Ausubel, 1995) carry out purifying.Genomic dna adopts the preparation of CTAB method.The pcr amplification of DNA uses Taq archaeal dna polymerase or Expand High Fidelity PCR system (Roche Diagnostics), uses Qiagen PCR purification kit purifying.The oligonucleotide that uses in the research is listed in embodiment 6, table 1.Dna sequence dna adopts 373 Aform DNA sequenators (Applied Biosystems) to measure, and uses Sequencher Version 3.1.1 (GenCodes, Ann Arbor, MI) software analysis.

The reverse complemental of waaQpM.From the genomic dna of pasteurella multocida VP161, use oligonucleotide fragment BAP2146 and the complete waaQpM gene of BAP2147 (embodiment 6, table 1) amplification.(embodiment 6 for the dna fragmentation connection Sail of 1.1kb after the amplification and the plasmid vector pAL99 of BamHI-digestion, table 1), can be so transcribe by pasteurella multocida tpiA promoters driven, filter out the E.Coli transformant that has correct plasmid, simultaneously, specified pAL170 plasmid is used to transform pasteurella multocida AL251 bacterial strain, produces strains A L298.The pAL99 plasmid vector is transformed AL251 separately and is produced strains A L438 with comparing (embodiment 6, table 1).

Competitive growth analysis.The method that competitive growth analysis is described according to Harper (2003) is carried out and the quantitative relative growth rate of pasteurella multocida LPS mutant strain AL251 and complementary mutant strain AL298.(external or in vivo) tetracyclin resistance clone per-cent of cultivating that (output culture) obtain from output is determined competition factor (CI) divided by cultivate the tsiklomitsin clone per-cent that (input culture) obtain from input.Weigh the relative competition factor (rCI) of growing in the body, determine divided by external CI by CI in the body with growth in vitro difference.By using monolateral z-test (one sidedz-test) (p＜0.05) statistical study, if the rCI value significantly less than 1.0, then mutant strain is confirmed as attenuation mutant.

Toxicity test.The Leghorn-cross chicken of buying in one group ten 12 ages in week is used pasteurella multocida VP161 or AL251, injects 100 μ l with two various dose chest muscles and infects.Different time points blood sampling after infecting AL251, and require to implement euthanasia to being considered to nonviable chicken according to the animal ethics.Blood sample is with the BHI dilution twice that contains heparin and be coated with the BHI flat board.Isolating pasteurella multocida clone coats NB agar plate and the NB agar plate that contains tsiklomitsin from blood.

The serum sensitivity analysis.Pasteurella multocida and E.coli adopt Chung et al in Infect.Immun.69 to the susceptibility of fresh chicken serum, and the method described in 2487 (2001) is measured..

The purifying of LPS.Pasteurella multocida cell (210g, VP161; 254g of AL251) freeze-drying gets the VP161 of 56g and the AL251 of 52g.Remove lipid or other lipophilic constituents to improve the extraction efficiency of LPS with organic solvent washing freeze-dried vaccine somatocyte.Cell after the washing (42g, VP161; 50g is AL251) with hot phenol/water law extracting and relative flowing water dialysis 48h.The retentate freeze-drying, be made into 2% aqueous solution after,, after handling 4 hours under 37 ℃ of conditions, add Proteinase K and also handled 4 hours down with DNA enzyme and RNA enzyme at 37 ℃.Little peptide is removed in dialysis.After the freeze-drying, retentate is made into 2% aqueous solution, and 8000g gets supernatant after centrifugal 15 minutes, and 100, centrifugal 5 hours of 00g.The precipitation that contains purifying LPS, heavy molten and freeze-drying.With 1% acetate (10mg/ml, 100 ℃, 1.5h) handle the LPS of purifying, 5000g is centrifugal then removes insoluble lipid A and separates and obtain core oligosaccharide (OS).

Analytical procedure.Sugar is determined by the GLC-MS of their alditol acetate derivative.LPS, reduces with the NaBD4 aqueous solution and to spend the night 100 ℃ of hydrolysis 4 hours with the 4M trifluoroacetic acid, uses diacetyl oxide 100 ℃ of acetylizes 2 hours under the catalysis of residual acetic acid sodium then.GLC-MS adopts 30 M DB-17 capillary columns (with 3.5 ℃/min, 180 ℃ to 260 ℃), and mass spectrum uses Varian Saturn II mass spectrograph electron impact pattern.Methylation analysis adopts NaOH/DMSO/ methyl-iodide method, and analyzes with above-mentioned GLC-MS.

MS analyzes.Capillary electrophoresis-electrospray ion MS (CE-ESI-MS) adopts crystal Model 310 capillary electrophoresis (CE) equipment (AYI Unicam) to carry out, and this equipment is coupled to API 3000 mass spectrographs (Perkin-Ehner/Sciex) via a little spray interface.Protection liquid (Virahol-methyl alcohol, 2: 1) joins a low dead volume Y-tube (250 μ m i.d., Chromatographic Specialties) with the 1L/min flow velocity.All aqueous solution filter through 0.45-μ m (Millipore) strainer with preceding.

Nucleus magnetic resonance.Use 3mm triple resonant ( ¹H, ¹³C, ³¹P) probe obtains the NMR spectrum on Varian Inova500MHz spectrograph.Lipophilic sugared sample dissolution is in 140 μ L (3mm) 99%D2O.Experiment is carried out under 25 ℃, with HOD (deuterate H2O) signal that is suppressed at the 4.78ppm place.The methyl resonance conduct of acetone is 2.225ppm's ¹H spectrum and 31.07ppm's ¹³C spectrographic inside or outside reference.From Varian, COSY, TOCSY, NOESY, ¹³C- ¹H HSQC, ¹³C- ¹HHSQC-TOCSY and ¹³C- ¹H HMBC, relevant with heteronuclear with the same nuclear of standard 2D pulse sequence is used for general ownership.

The result

The pasteurella multocida STM mutant strain of attenuation produces the LPS of brachymemma, and this LPS is by recovering to produce the LPS of total length with functional waaQpM gene complementation.The mutant strain of label (STM) is used to identify attenuation mutant, for use in cultivating in mouse and chicken.A mutant strain is identified (called after AL251) in aforesaid analysis, and it all shows as hypotoxicity in chicken and mouse.The sequential analysis of mutant strain shows that single transposon is inserted in the waaQpM gene, and this waaQpM gene is by the prophesy heptose based transferase inferred and a kind of responsible interpolation heptose glycosyltransferase to the LPS of being responsible for encoding.

We use polyacrylamide gel electrophoresis then the silver method of dying compared LPS structure from wild-type parent VP161 and the complementary mutant strain AL298 of strains A L251, AL251.LPS from AL251 is farther with respect to wild-type LPS migration in gel, and this shows the LPS that is produced by mutant strain, and (Figure 36 a) by remarkable shortening.And from the LPS of complementary mutant strain AL298, show identical with wild-type LPS travelling speed mutant strain AL251 and complete waaQPM gene complementation can be recovered wild-type LPS synthetic (Figure 36 a).

With waaQ _PMGrowth recovery is to the wild-type level in the body of complementary AL251 bacterial strain.Because the complementation of waaQpM gene, AL251 bacterial strain recover to produce wild-type LPS, thus we waaQPM that wants to determine whether complementary inactivation also can recover in vivo the AL251 mutant strain to the wild-type level of growth.Early-stage Study about complementary mutant strain AL298 shows, in case remove the microbiotic of this complementation plasmid pAL170 is selected, and this plasmid will significantly reduce (remaining 44% after 6 hours).Therefore, the selection mouse replaces the growth analysis of being at war with property of chicken, and as institute's elaboration before, needing only chicken infection in 6 hours from required infection time to the results thalline then will be above 12 hour.Three mouse are injected the VP161 of equivalent and the mixture of complementary strain AL298.In contrast, two mouse are injected the wild strain VP161 of equivalent and the mixture of control strain AL438 (AL251 has vector plasmid pAL99).The average rCI of complementary mutant strain AL298 is 1.0, can with wild type strain VP161 fair competition, and the average rCI value of control strain AL438 is 0.57 (p=0.03), and is similar to the rCI value of the AL251 that reports previously in mouse.These results show that waaQpm not only is the LPS that produces total length but also essential by the normal growth in the course of infection.

The waaQpm mutant strain of pasteurella multocida can not cause a disease in chicken.Strains A L251 has shown a growth velocity that extreme is slowed down in chicken.Wish to determine whether it still can cause a disease in these hosts.Chicken is by the VP161 of two kinds of various dose or AL251 test (embodiment 6, table 2).All have injected all death in 20 hours of chicken of wild-type VP161.In contrast, most of chicken with the AL251 test is kept fit in 20 hours in beginning, but in 4 days, and though which kind of dose inoculation the chicken of AL251, all die of illness and infect in fowl cholera.Isolate pasteurella multocida from the blood of the AL251-infected chicken in later stage of disease or latter stage, find that the pasteurella multocida clone that all separation obtain has sensitive tetracycline, this shows that transposon no longer exists in bacterium.The waaQPM Gene Sequence Analysis of recovering the clone shows that transposon is knocked out in all clones, has therefore rebuild a functional waaQPM gene.What is interesting is that except a chorista, sequential analysis shows that also knocking out a little nucleotide substitution at transposon causes two amino acid changes in waaQPM (aminoacids 88,89; Ser to Leu, and Asp to Cys).These amino acid changes do not influence the function of waaQPM, because the structure all identical with wild type strain (Figure 36 b) of LPS in the strain isolated of the pasteurella multocida that the chicken of testing with AL251 obtains.In sum, these conclusions show that attacking the late period of observing fowl cholera in the chicken that inoculates AL251 is because the wild-type reverse mutation of AL251 fully, thereby the bacterial strain with waaQPM gene of an inactivation can not cause a disease.

The waaQpM mutant strain is not owing to the susceptibility that has increased chicken serum to the perform toxic attenuation of chicken.In order to determine wild-type pasteurella multocida bacterial strain VP161 and LPS mutant strain AL251 the relative sensitivity of killing and wounding to complement-mediated, with the logarithmic phase cell of each bacterial strain and control strain E.coli DH5 α, in conventional or heat treated chicken serum, cultivated 3 hours.Wild-type pasteurella multocida bacterial strain VP161 in serum heating or not heating, with the growth of phase same rate, shows that it is complete seroresistance, and this is similar to other pasteurella multocida serotype A bacterial strain of reporting in the past.The bacterial activity of chicken serum confirms with the E.coli control strain, and 19 times of propagation bacterial activity in untreated serum then reduces about 9 times in heat treated serum.What is interesting is, for the AL251 mutant strain, growth in heat treated serum and normal serum and indifference, all nearly 160 times propagation.These results show that in the LPS of chicken mutant strain observed perform toxic attenuation is not because due to the susceptibility that complement has been increased.

Structural analysis from the LPS of pasteurella multocida VP161 and AL251.Sugared structural analysis from parental plant VP161 shows glucose there be (Glc), semi-lactosi (Gal), and N-acetylglucosamine (GlcNAc), L-glycerine-D-sweet dew-heptose (LD-Hep), its ratio separately is 2: 1: 1: 3.On the contrary, glucose (Glc) is only arranged from the LPS analysis revealed of mutant strain VP251, L-glycerine-D-seminose-heptose (LD-Hep), its ratio separately is 1: 3, and the semi-lactosi of trace (Gal), N-acetylglucosamine (GlcNAc).The existence of GlcNAc may be depended on two residues of expecting in the lipid A zone of each LPS molecule, the residue quantity of known serologic group hyaluronic acid pod membrane.Analyze from the CE-ES-MS of the core os sample of parent VP161 LPS and to have shown a simple mass spectrum (Figure 37 a), it conforms to the sugared type of 1967 Da with molecular weight 1805, wherein less sugared type and 2PCho, 3Hex, 4Hep, the composition unanimity of Kdo, Kdo is exclusive LPS sugar 2-ketone-3-deoxidation-octulosonic acid, PCho is the phosphonate moiety phosphorylcholine.Wherein bigger sugared type contain an extra heptose kind (embodiment 6, table 3, Figure 37 is a).Consistent with the SDS-PAGE analysis of mutant strain AL251LPS, the CE-ES-MS of its core os sample analyzes the simple mass spectrum (embodiment 6, table 3, Figure 37 b) of the molecule of the molecular weight 605Da that demonstrates the brachymemma of a height.This molecular weight meets 2Hep, the composition of 1Kdo.Observe one bigger sugared type, this sugar type meets an additional heptose residue (767 Da).Observing the molecular weight 1448Da that extends (PCho, 3Hep, 3Hex, sugared type Kdo), but in the sugared type that is observed, do not contain whole parents' 4 heptose residue complement (embodiment 6, table 3) of trace more.For the characteristic of complete sign mutant strain, parent and mutant strain core oligosaccharide have been carried out in the core os brachymemma ¹The H-NMR experiment.Lose a heptose residue because mass-spectrometric data shows among the OS in mutant strain, and the amino acid identity contrast shows that WaaQpm is a heptose based transferase, shows great attention to the resonance of heptose residue in the molecule. ¹H-NMR spectrum shows that the variability (observing in the core of the being everlasting oligosaccharide) of the Hep residue of the most contiguous Kdo residue is owing to Kdo residue rearrangement under the acid hydrolysis condition that obtains core os causes (Figure 38).To coming from the core os of parent strain, recognize the anomer proton chemical shifts of HepII at～5.7ppm, replace this residue with the 2-position and meet that (Figure 38 is a).Yet, at the OS of AL251 mutant strain ¹In the H-NMR spectrum (Figure 38 b), the chemical shift of the anomer of Hep II resonance is about 0.5ppm to high field offset, no longer is substituted consistent in the 2-position with residue.As observed in the H.somnus bacterial strain in the past, the HepII residue becomes terminal portions, and the chemical shift of H-4 resonance conforms to this arranging.Obtain mutant strain constitutional features qualitative evidence (Figure 39) really by 2D NOESY experiment.Observe the characteristic NOE of VP161 core os between HepIII and HepII anomer proton, show between HepIII and HepII residue it is α-(Figure 39) that 1-2 connects.The NOESY spectrum of the core os of AL251 mutant strain confirms that the HepII residue lacks the 2-position and replaces, and aforesaid characteristic NOE disappearance confirms not exist the HepIII residue in the OS of mutant strain.Be summarized in embodiment 6, table 4 about the chemical shift of the HepII of parent OS and HepIII residue and NOE spectroscopic data and about the chemical shift and the NOE spectroscopic data of the HepII residue of mutant strain OS.Structure technology shows that mutator gene waaQPM is to stop HepIII to add Hep II (Figure 40) in the structural effect of LPS, and this effect is consistent with the high similarity of coded albumen and known heptose based transferase.

Discuss

The pasteurella multocida LPS mutant strain AL251 that uses STM to recognize in mouse and chicken first shows the heptose transferase gene waaQ that a transposon is inserted in prediction _PMIn, and the toxicity of causing a disease in chicken and mouse significantly descends.The silver of the cytolysis thing of wild-type VP161 and AL251 dyes polyacrylamide gel and shows that the LPS from mutant strain significantly shortens (Figure 36 A), this and waaQ _PMThe heptose based transferase of being responsible for a heptose molecule is added on the core area of LPS structure of encoding one conforms to.

To the genomic analysis revealed of the Pm70 of pasteurella multocida, gene waaQ _PMMay independently transcribe, it is direct because waaQ therefore to produce the LPS structure that shortens _PMThe dipole effect of the inactivation of gene rather than downstream gene slows down pasteurella multocida and grows in the body of chicken and mouse.This point confirms by complementation test, when importing a reverse wild-type waaQ _PMGene not only recovers the structure (Figure 36 A) of LPS, and the growth recovery in mouse is to the wild-type level.

Use the postponement of the fowl cholera symptom (embodiment 6, table 2) that the toxicity test of LPS mutant strain AL251 in chicken cause to occur and have that isolating pasteurella multocida illustrates no longer to have transposon to sensitive tetracycline in the chicken of disease symptoms.Nucleic acid sequence to isolating pasteurella multocida DNA from the chicken that infects it is confirmed that waaQ _PMGene is complete, and has sequence change at the original transposon place that inserts as a rule, causes two amino acid changes.The LPS of the strain isolated that obtains from the chicken that AL251 infects shows that it is the LPS of wild-type, changes waaQ although confirm amino acid _PMGene is (Figure 36 B) that function is arranged.To sum up, these data show that observed infection only is because the reverse mutation strain is lost due to the transposon insertion in the chicken of inoculation AL251.Wild-type pasteurella multocida bacterial strain VP161 is a kind of high toxicity microorganism, is less than 50 bacteriums and just can causes fowl cholera in chicken.Our research detects from the elimination speed of AL251 transit cell stand, after ten initial generations, be 1%, (external overnight growth) rises to 4% (not display data) after 58 generations, this elimination speed causes going down to posterity and selecting of in chicken wild-type revertant, and being is enough to produce the speed that fowl cholera infects that causes death with one in process of the test.Therefore, the waaQ of a stable inactivation _PMTo cause the pasteurella multocida bacterial strain can not produce fowl cholera.Yet the reliable method that makes up the mutant strain of the pasteurella multocida that limits is not also set up.

Pasteurella multocida bacterial strain wild-type LPS analyzes and shows " rough type " LPS, with from Gram-negative mucosal disease substance, similar as isolated LPS such as hemophilus influenza, H.ducreyi, Neisseria meningitidis and N.gonorrhoeae or fat oligosaccharides (LOS), have only the non-repetition polysaccharide unit of a weak point to link to each other with core.The inner core of pasteurella multocida LPS and the LPS structural similitude of describing hemophilus influenza, hemolytic Man bacillus, haemophilus ducreyi have one three heptose unit, and this unit is via a Kdo residue link to each other with fat A (Figure 39).In the AL251 mutant strain, waaQ _PMInactivation cause giving expression to the LPS that lacks the height brachymemma of the 3rd heptose molecule (Hep III) in kernel area.The LPS sugar type that content is the highest in the mutant strain lacks all saccharide residues that are connected first heptose equally, shows waaQ _PMInactivation stoped the further interpolation (embodiment 6, table 3) of sugar.Therefore probably because the structure picture of the LPS intermediate that causes in the disappearance of most of the 3rd heptose changes the activity that has hindered the subsequent transfer enzyme greatly.

The disappearance of total length LPS molecule obviously influences the energy for growth of mutant strain AL251 in mouse and the pathogenecity in chicken.The concrete reason of this perform toxic attenuation is not clear.Yet, in wild-type pasteurella multocida VP161 LPS, recognize two PCho groups and only in a kind of very rare sugared type, contain a PCho group (embodiment 6, table 3) among the mutant strain AL251 LPS.It is unusual having more than one PCho residue in VP161 LPS; Bacterium with LPS of PCho-modification has only a continuous residue usually, although it is varied to be connected to the structural position of LPS.A kind of different bacterium is only arranged, a kind of atypia hemophilus influenzae bacterial strain, known have two PCho residues to be connected to LPS.What is interesting is that isolating the serotype A turkey on the LPS of PM70 does not have the PCho group, this bacterial strain also is nontoxic to the chicken class.

The PCho group often is connected in the lip-deep various bacteria structure of mucosal disease substance, described pathogenic agent such as hemophilus influenzae, actinobacillus actinomycetem comitans (Actinobacillusactinomycetemcomitans), streptococcus pneumoniae (Strep tococcus pneumoniae) and neisseria kind (Neisseria spp.), by being connected, play a crucial role sticking and invade in epithelium and the endothelium host cell with platelet activation acceptor (PAF).Human bronchial epithelial cell can be sticked and invade to atypical hemophilus influenzae with positive sugared type of PCho of LPS via a series of signal activity.Yet, in hemophilus influenzae and neisseria kind, to stick and invade in people's the epithelial cell be necessary although the PCho on LPS is expressed in, its existence reduces the survival in some host's ecology, have stronger serum susceptibility because express the bacterial strain of Pcho, the follow-up activation that is connected to C-activated protein and complement system by Pcho is reconciled.What is interesting is that the existing LPS mutant strain AL251 that studies show that still has the height resistance to the bacterial activity of chicken serum complement, the LPS structure that a complete wild-type be described be not bacterium have the whole serum resistance essential.Not strange, because the pod membrane of pasteurella multocida serotype A bacterial strain is given seroresistance.

In a word, the waaQ of a pasteurella multocida _PMMutant strain is expressed an extremely LPS of brachymemma.LPS molecule and the waaQ of wild-type pasteurella multocida _PMThe inner core of mutating molecule is determined, and this shows a waaQ that function is arranged _PMGene is essential to the kernel of LPS by interpolation the 3rd heptose residue.Therefore, waaQ _PMBe accredited as a heptose based transferase III and show that by toxicity test its activity is necessary in the bacterium toxicity of pasteurella multocida to the natural reservoir (of bird flu viruses) chicken.WaaQ _PMInactivation cause the disappearance fully of the 3rd heptose base in kernel, promptly produce complete wild shape sugar type.The most sugared type that recognizes from mutant strain LPS lacks the PCho residue, and in the LPS of other Gram-negative mucosal disease substances, this residue plays a crucial role in bacterium toxicity.

Embodiment 6, and table 1. is used for bacterial isolates, plasmid and the oligonucleotide (oligo) of this research.

Bacterial strain, plasmid or oligonucleotide	Associated description	Source or reference
			Bacterial strain pasteurella multocida VP161	Serotype A: 1, from Vietnam's strain isolated of chicken	Wilkie et al.Vet. Microbiol. 72，57(2000).
AL251 AL298 AL438	VP161 Tn916EΔC waaQ PMThe AL251 that mutant strain has a plasmid pAL170 has the AL251 of plasmid pAL99	Harper et al.Infect. Immun. 71, 5440 (2003). and this studies this research
			E.coli DH5α	deoR，endA1，gyrA96，hsdR17(r k -m k +)， recA1，relA1，supE44，thi-1，(lacZYA- argFV169)，Φ80lacZ ΔM15，F-	Bethesda Research Laboratories
Plasmid pPBA1100	Pasteurella multocida/shuttle vehicle	Homchampa et al. Vaccine 15，203(1997).
			pAL99	The 240bp EcoRI segment that will contain pasteurella multocida tpiA promoter region is cloned into ppBA1100 EcoRI site	This research
pAL170	Comprise waaQ PMThe pAL99 of gene	This research
			Oligonucleotide BAP2146	waaQ PMThe forward primer of amplification has the BamHI site to be used to clone GAGTAGGATCCTGAAACATGTTCCC	This research
BAP2147	waaQ PMThe amplification reverse primer has Sal I site to be used to clone GGTTGGGTCGACCAAGCCACATTACTG	This research

Embodiment 6, table 2.VP161 and the toxicity of AL251 in several groups of chickens (10 every group).

The CFU=colony-forming unit, h=hour, N.D=did not detect.

Bacterial strain	Dosage (CFU)	Dead mean time (h)	Scope (h)
				VP161	1.5×10 21.5×10 3	＜20 ＜20	ND ND
AL251
		70 7×10 2	65 30	33-120 23-42

Embodiment 6, table 3. from the negatively charged ion CE-MS data of the core os of pasteurella multocida bacterial strain VP161 (parent) and AL251 (mutant strain) and supposition form.Form according to following supposition, average quality unit is used to molecular weight and calculates: Hex, 162.15; Hep, 192.17; Kdo, 220.18; Pcho, 165.05.Relative intensity be expressed as divalence or-valency ionic relative height.

Bacterial strain	[M-H] -	[M-2H] 2-	Observed molion	The molion that calculates	Relative intensity	Infer and form a
							The VP161 core os	1804.4 1822.4 - 1966.3 1988.4	901.8 910.9 921.8 982.9 993.9	1805.6 1823.1 1845.1 1967.8 1989.1	1805.4 1823.4 1845.4 1967.6 1989.6	0.2 1.0 0.3 0.9 0.3	2PCho，4Hep，3Hex，aKdo b 2PCho，4Hep，3Hex，Kdo 2PCho，4Hep，3Hex，Kdo，Na 2PCho，4Hep，4Hex，aKdo 2PCho，4Hep，4Hex，aKdo，Na
The AL251 core os	603.5 621.5 765.5 1447.5	- - - -	604.5 622.5 766.5 1448.5	604.5 622.5 766.7 1448.2	1.0 0.9 0.8 0.1	2Hep，aKdo 2Hep，Kdo Hex，2Hep，aKdo PCho，3Hep，3Hex，aKdo

^aPCho, phosphorylcholine; Hep, heptose; Hex, hexose; Kdo, 2-ketone-3-deoxidation octulosonic acid

^bAKdo refers to dehydration-Kdo derivative

Embodiment 6, and table 4. is from the deprotected chemical displacement of the Hep II and the Hep III residue of the core os of pasteurella multocida bacterial strain VP161 (parent) and AL251 (mutant strain).In D20 in 25 ℃ of records.Do not determine the chemical shift with reference to inner acetone at 2.225ppm.nd.Because the heterogeneity of Kdo molecule after the nuclear hydrolysis, whenever corresponding-residue is observed two resonance.

	H-1	H-2	H-3	H-4	H-5	H-6	H-7	NOEs
										VP161 Hep-II	5.76	4.17	3.85	3.83	3.60	4.05	3.76 3.65	Between	Inner
5.11 Hep III H-1 4.04 Hep I H-3	4.17 H-2
		Hep-II	5.70	4.19	3.86	3.84	3.55	4.05	3.76 3.65									5.14 Hep III H-1 3.96 Hep I H-3	4.19 H-2
Hep-III	5.14									4.02	3.87	3.83	3.78	4.05	3.77 3.65	5.70 Hep II H-1 4.19 Hep II H-2	4.02 H-2
		Hep-III	5.11	4.01	3.87	3.83	3.78	4.05	3.77 3.65									5.76 Hep II H-1 4.17 Hep II H-2	4.01 H-2

AL251 Hep II	5.22	4.07	3.89	3.72	nd	nd	nd	4.03 Hep I H-3
									Hep II	5.17	4.06	3.88	3.65	nd	nd	nd	nd

Embodiment 7

Show the preparation of D-glycerine-D-sweet dew-heptose based transferase mutant strain of the hemolytic Man bacillus of the specific conservative LPS structure of a kind of beasts pathogenic agent, and to the production of antibodies and the cross reaction of this LPS structure.

Former structural research from the lipopolysaccharides of beasts pathogenic agent hemolytic Man bacillus, actinobacillus pleuropneumoniae and pasteurella multocida has been identified a kind of conservative kernel oligosaccharide structure, and this structure is present in all bacterial strains that are studied.In order to investigate the potential of this inner core, adopt a kind of mutagenesis strategy to disturb D-glycerine-D-mannoheptose transferase gene (losB) of hemolytic Man bacillus as vaccine.The enzyme of this genes encoding is responsible for increasing D-glycerine-D-mannoheptose residue, and this residue is conservative interior extranuclear first residue, and its inactivation exposes as the terminal units on the mutant LPS molecule conservative inner core.Analysis subsequently determines that the structure of mutant strain LPS is as follows, and has determined losB genes encoding a kind of α-1 with the reverse complemental of losB, 6-D-glycerine-D-mannoheptose based transferase.

In the mouse body, produce the polyclone and the monoclonal antibody of this LPS structure, find that these antibody can discern the LPS and the full cell of hemolytic Man bacillus, actinobacillus pleuropneumoniae and three kinds of bacterial strains of pasteurella multocida.

Vaccine or the simple live strain of modifying are the traditional vaccines in the practice, yet test in place and experimental research have confirmed repeatedly that vaccine is invalid, in fact often causes negative interaction.The subunit vaccine material standed for that satisfies effectively, accurately requires is explored in this work.The antigen that can be considered as vaccine candidate object is almost determined must be on the surface of the bacterium under the state of nature, to obtain the immunne response of the organic vaccine antigen that target subsequently lives.

Under this background, the beasts pathogenic agent that comprises the sugar moieties of surface exposure can be used as vaccine candidate object.This sugar moieties is lipopolysaccharides (LPS) and capsular polysaccharide.Capsular polysaccharide is the repeating unit that is directly connected in several saccharide residues of bacterium surface, and LPS is made up of three zones, a lipid A district that the LPS molecule is connected in bacterium surface via fatty acid residue, one is connected in the conservative relatively core oligosaccharide district in the 3rd district and variable polysaccharide antigen (O-antigen) with the lipid A district.The bacterial strain heterogeneity of pod membrane and O-o antigen polysaccharide o gets rid of these structures as economically viable vaccine candidate object, because their ability can only cover the bacterial strain of homologous strain or generation same structure.Another kind of situation, if can identify a conservative core LPS structure, perhaps this structure can utilize the vaccine candidate object that all bacterial strains is provided extensive covering as a kind of.

In our laboratory, before with present to three bacterial strains, App, the structural analysis of the LPS structure of Pm and Mh identifies a conservative kernel LPS structure in the bacterial strain (App, Pm and Mh) that is present in all investigations.In order to investigate the potential of conservative kernel unit, this structure must be exposed becomes terminal residue, adopts the mutagenesis strategy for this reason, will encode and be responsible for the biosynthetic glycosyltransferase gene destruction of outer core.Thereby the result of this mutagenesis makes conservative inner core be exposed.

Identification, clone and the mutagenesis from the heptose based transferase gene of hemolytic Man bacillus has been described in this research, and this heptose based transferase is responsible for the first biosynthesizing step in outer core is modified.LPS structural analysis from mutant strain is definite, the suitable brachymemma of LPS quilt.Then, mutant strain is used to the to create antagonism antibody of conservative LPS structure and the cross reaction between three target bacterial strains of those antibody tests.

Experiment

Bacterial isolates and culture condition

(Perry Fleming IBS) carries out routine in 37 ℃ and cultivates on BHI flat board or BHI meat soup for Mh strains A 1 Sh1217 (S.Highlander, Baylor College of Medicine, Houston Texas) and A1 bacterial strain 01A ADRI.E.coli DH10B (Invitrogen, Carlsbad California) is used for the clone and the preparation of recombinant plasmid, and is being added with cultivation (Ampicillin Trihydrate 100 μ g/ml, paraxin 25 μ g/ml) on an amount of antibiotic LB substratum.When needing, hemolytic Man bacillus strain is cultivated on the BHI substratum that is added with Ampicillin Trihydrate (50 μ g/ml) and paraxin (5 μ g/ml).

Comprise the construction of recombinant plasmid that is inserted into the losB gene.

To use the flank primer to pass through pcr amplification from the losB gene of the chromosomal DNA of bacterial strain 01A.Employed primer is losB-kpn 5 ' ATATGGTACCTATCAGCGGTAGAGATTC TAAC and losB-xba 5 ' TGCTC TAGACCGAACCTGCACCAAAAAGATTTAACGC.These primer amplifications go out the segment of a 2Kb, and with behind the Kpn/Xba digestion with restriction enzyme this segment being cloned into pBluescript, then electroporation is to E.coli DH10B.Use the primer 5 ' CCGCTGCGAGAGATAAGTGGATACTTTATC-3 ' and the 5 ' GACATTGGGATCTTTATTTAGATTTCAAACCGAC-3 ' of following corresponding losB structure gene to carry out, cut product and use Qiagen gel extraction kit purifying from sepharose with the inverse PCR of this plasmid as template.Modified E.C. 2.3.1.28 (Cat) box (plpCat) from pNFplpcat passes through pcr amplification, the sticky end product is connected to above-mentioned PCR product makes pSK losB::at.Restriction map and recombinant plasmid sequence determine that the Cat box is by to be inserted into losB structure gene with losB gene equidirectional.

The screening of losB bacterial strain

Plasmid pSKlosB::cat is transformed in the Mh cell by electroporation.In brief, behind the electroporation cell is transferred to immediately the BHI meat soup of the preheating of 1ml, cultivated 1.5h in 37 ℃.Plating to the BHI agar that contains 5mg/ml paraxin with the screening transformant.For determining that this transformant no longer has the pSKlosB::cat plasmid clone, to the BHI/Amp flat board, Ampicillin Trihydrate responsive clone detect by PCR with its copy plating.The insertion inactivation of multiplication reorganization back losB gene is confirmed with PCR.The primer of employed upstream and downstream sequence at losB-Kpn and losB-Xba determines that Cat cassette is inserted in the chromosome copies of losB gene in initial cloning experimentation.

The complementation of losB mutant strain and losB cdna reverse

Copy from the wild-type that pSK losB (on seeing) cuts the losB gene by the digestion with restriction enzyme that uses Xba and Kpn, be cloned among the shuttle plasmid pNF2176 to produce pNF2176AalosB.Then with this plasmid electroporation in Mh losB mutant strain and the transformant that on Amp/Cat, screens.

Mutant strain LPS feature description

Use routine techniques from as killed cells, to isolate.As described above, prepare the alditol acetate of glycan analysis and part methylization.Purifying core os and O-deacylated tRNA LPS (LPS-OH).The complete deacylated tRNA LPS of purifying.Use mass spectrometric detection method and NMR (Nuclear Magnetic Resonance) spectrum detection method.

Antibody Preparation

Mh losb 0.5ml with formalin deactivation, PBS washing wherein has 108 cells, fate (D) 0,14 and 5 female BALB/c mouse is carried out peritoneal injection (ip) immunity at 35 o'clock.Experimentize at D42 and to get blood, extract a small amount of blood, isolated serum is detected cross reactivity with Mh losB and Mh wt LPS by ELISA from the facial vein of every mouse.At D54, every mouse is accepted to repeat the ip immunization, and mouse #2 also accepts a vein and (iv) inject 0.2ml, wherein has 4 * 10 ⁷Cell.At D57, merge from these mouse cutting-out spleens and with a kind of myeloma cell line.The antigen of the initial screening of this syzygy is the purifying LPS from Mh losB and Mh wt.Mouse #3 and mouse #5 are at the D90 full cell (～10 of Mh losB ⁸) ip.Mouse #3 is at D131 Mh losB cell ip and iv booster immunization, for the splenocyte fusion of D134 is prepared; Mouse #5 merges its splenocyte at D155 at D152 full cell ip and iv injection booster immunization through the formalin deactivation from Pm bacterial strain VP161.At the antigen of the initial screening of mouse #3 and mouse #5 syzygy is purifying LPS from App serotype 5a and Pm bacterial strain VP161.Preparation contains the ascites of monoclonal antibody.

LPS ELISA

Wild-type purifying and that fully characterize and mutant strain LPS are used to the solid phase indirect ELISA to determine the binding specificity of mAb.

Full cell ELISA

Use the phenol as killed cells

The result

The identification of candidate's glycosyltransferase.

LPS performance from 3 kinds of interested bacterial strains (Mh, App and Pm) has identical inner core (embodiment 7, table 1).For investigating the potential of this conservative inner core, must remove this extra-regional outer core and modify as a kind of useful vaccine candidate object.For helping through this thing, take method in outer core is modified, to be responsible for the glycosyltransferase gene that first monose adds with identification and change.Because with respect to App, the antigenic quantity of the O-among the Mh is low, can not disturb immune Research subsequently, thereby select Mh to carry out mutagenesis research.Pm bacterial strain Pm70[24] genome sequence measure and to finish, the carrying out of Pm (bacterial strain P-3480), App ( serotype 1 and 5b) and Mh (A1 bacterial strain).In App serotype 1 and Mh strains A 1, all recognize candidate's glycosyltransferase as shown in figure 41.People such as Galameau identify the lbgA assignment of genes gene mapping among the App in the middle of two genes, and described two genes are found with to examine the oligosaccharides biosynthesizing relevant by the mini-Tn10 transposon mutagenesis.Adjacent gene lbgB shows and a D-glycerine-D-mannoheptose based transferase of haemophilus ducreyi has quite high homology.(Baylor College Houston) carries out Blast and analyzes the lbgB gene order of use App, discloses the homologue that two adjacent D-glycerine-D-sweet dew-heptose based transferases are arranged in the Mh genome sequence to the Mh genome sequence.The best lbgB homologue of being discerned is by inference for being responsible for adding the D-glycerine-D-sweet dew-heptose transferring enzyme of first D-glycerine-D-sweet dew-heptose residue in the extension of first L-glycerine-D-sweet dew-heptose residue, therefore we infer, second homologue (we are called losB) is D-glycerine-D-sweet dew-heptose transferring enzyme of being responsible for adding second D-glycerine-D-sweet dew-heptose residue.

The mutagenesis of losB among the Mh

Plasmid pSKlosB::cat reproducible not in Mh, therefore on function as a kind of suicide plasmid.Electroporation (5 μ g plasmid DNA) enters among the Mh subsequently, obtains 136 cat ^RTransformant, wherein 104 is amp ^sSelect wherein two to do further research at random.By confirming that with the PCR that comprises the primer that inserts the site two mutant strains all once had double exchange effect (not display data).For determining that influence to LPS structure (seeing below) is that inactivation by the losB gene causes, we on shuttle plasmid pNF2176 with the wild-type copy reverse complemental mutant strain of losB gene.

The sign of the LPS of losB mutant strain

Ordinary method is separated LPS.The glycan analysis of the LPS of purifying discloses, and glucose (Glc), D-glycerine-D-sweet dew-heptose (DD-Hep) and L-glycerine-D-sweet dew-heptose (LD-Hep) ratio separately is approximately 2: 1: 3, also can be observed the N-acetyl-glycosamine (GlcNAc) of trace.This sugar is formed consistent with the expected structure of mutant strain LPS, and the losB gene of hint sudden change indicates as the homology data, is specific heptose transferase gene, rather than the gene relevant with the heptose biosynthesizing, because four other heptose residues are retained among the LPS of mutant strain.Ordinary method prepares O-deacylated tRNA LPS (LPS-OH), and analyzes (embodiment 7, table 2) with CE-MS.Observe one divalence (1172.32), trivalent (781.3 are arranged ^3-) and tetravalence (585. ^4-) (Figure 42 a), the Hex2 of viewed ion and expection, Hep4, Kdo-P, lipid A-OH form consistent the simple mass spectrum of ionic.Also observe a small amount of charged ion; Divalence (1065.3 ^2-), trivalent (709.8 ^3-) and tetravalence (532.3 ^4-), with Kdo residue of many existence, to lack hexose, heptose and phosphoric acid part simultaneously corresponding.In relevant beasts pathogenic agent pasteurella multocida, observed this situation in the past.Purifying is examined oligosaccharides (OS) and is similarly detected (embodiment 7, table 2) with CE-MS, provides a monovalence (1312 ^-) and divalence (655.6 ^2-) the ionic mass spectrum, with the Hex4 of expection, Hep2, Kdo forms consistent.For the connection mode that proves mutant strain LPS does not have predisposition to become and changes, on core os, carried out methylation analysis, show terminal Glc, the Glc that 6-replaces, terminal LD-Hep, terminal DD-Hep, the LD-Hep and 3 that 2-replaces, 4,6-three replaces LD-Hep and exists with the ratio that approximately equates, this is consistent with the mutant strain LPS structure of expection again.NMR experiment on the LPS of complete deacylated tRNA has obtained the last affirmation of the core os structure of mutant strain LPS, and relatively finds clearly there is not terminal Gal-Hep disaccharides in mutant strain LPS with wild-type LPS spectrum (Figure 43).The announcement of arranging (embodiment 7, table 3) of chemical shift, all connections of conservative core os are identical with wild-type LPS's, therefore obtained the structure of wanting.Obtain LPS-OH from complementary mutant strain, the CE-ES-MS analysis confirmation goes out to have a spot of wt LPS table shape (embodiment 7, table 2, Figure 42 b) with sugared type of additional Kdo residue.

Antibody Preparation

Behind initial and booster immunization, detect serum identification Mh losB of 5 mouse and the ability (Figure 44) of Mh wt LPS.Because mouse #2 has the highest IgG titre to the wt bacterial strain, select this mouse to carry out first time fusion experiment with generation mAb.Produce the stable hybridoma of nine identification Mh losB, and detect they and Mh, the ability (Figure 45) of the cross reaction of the wt LPS of App and Pm.Yet, do not have mAb can discern App and PmLPS, and have only four mAb can discern Mh wt LPS.The detection of D42 polyclonal serum discloses, and existence can be discerned App serotype 5a, the Pm bacterial strain VP161 of purifying and X73 LPS and can not discern the antibody (Figure 46) of the LPS of App serotype 1.Therefore, on mouse #3, make fusions, but do not differentiate the hybridoma of the purifying LPS that can discern App serotype 5a and Pm bacterial strain VP161.At last, because polyclonal serum detects and demonstrates and Mh losB and wt when D152, the cross reaction of the LPS of App serotype 1 and 5a and Pm bacterial strain VP161 and X73 is so behind the deactivation intact cell last booster immunization of mouse #5 with Pm bacterial strain VP161, make fusions (Figure 47).Obtain 14 hybridomas, 11 purifying LPS that can only discern Pm bacterial strain VP161, three purifying LPS that can discern App serotype 5a and Pm bacterial strain VP161.Find that subsequently these three cross reaction hybridomas can discern the purifying LPS of App serotype 1, Pm strain X 73 and Mh losB and wt, and the hybridoma of above-mentioned 11 identification Pm VP161, also be to discern relevant Pm strain X 73 (Figure 48, embodiment 7, table 4).

There is not effective vaccine to resist at present by beasts pathogenic agent Mh, the disease that Pm and App cause.Antagonism still mainly is based on vaccine and the attenuated strain that lives by the vaccine method of the disease that Mh causes.The Mh antigen of having introduced secretion in the nearest living vaccine or having extracted is as neuraminidase, leukotoxin, sialoglycoprotein enzyme, adventitia and Unidentified albumen.Leukotoxin conventionally is being main subunit vaccine material standed for always, still part is poisonous in the calf attack model but the mutant strain of use expressing non-toxicity leukotoxin carries out immunization, and leukotoxin can not produce the protective immunne response when uniting use with capsular polysaccharide.Comparatively speaking, LPS demonstrated can be stable the leukocytolysis activity, so can bring hope based on the combined vaccine of LPS and detoxification leukotoxin.

Antagonism at present is based on attenuated strain alive by the vaccine method of the disease that App causes, contains highly unsettled Apx toxin in them, and this toxin can be induced the required neutralizing antibody of protection.As if these Apx toxin have formed the basis at the main subunit vaccine of App, but can only induce the clinical protection of part.Someone proposes adhesin (core os that comprises LPS) as the vaccine candidate object that improves.

At present the vaccine of prevention pig Pm disease is made up of toxoid and somatic antigen such as pod membrane and outer membrane protein.Pasteur (Pasteur) shows that at first Pm can cause the fowl cholera of chicken, is to utilize the Pm attenuated strain to this sick preventive means at present.Yet in general,, can not provide cross protection, so this means are subjected to very big restriction to other serotypes because this immunne response remains the serotype restriction.Yet the LPS that has shown Pm plays partial action in the immunity of infecting.

Accumulated suitable evidence recently and shown from the LPS of each in these biologies it all may is the good candidate of subunit vaccine design.Shown that LPS is visible and a main antigenic determinant on the Mh surface, helped phagolysis and be helpless to the external of complement-mediated to kill and wound by A1 LPS inductive mAb.

For pm, the fowl cholera that rrna-LPS vaccine protection chicken class is avoided being caused by homology Pm bacterial strain infects.In addition, use the LPS-albumen composition that mouse is carried out immunization, this immunization can provide 100% protection when using homologous strain to attack mouse, yet when separately using, the one-component of this mixture can't provide protection.LPS inductive MAb from Pm can only provide the part protection in mouse model, although they have conditioning phagocytosis, do not have germicidal action in the presence of complement.Yet in another experiment, can protect mouse to avoid homology fully at the mAb of PmLPS and attack, and have germicidal action.A kind of simulation can play a protective role when it is subjected to the homology biological attack in mouse model from the antiidiotype vaccine of the LPS of A type.

In App, LPS, the nuclear district of the LPS that more specifically says so is relevant with the adhesive capacity of this bacterium.The combined vaccine that BSA is connected with App serotype 1 LPS can be attacked and can not attack the back in allos and protect mouse in homology, shows that from the smooth type of serotype 5 and 1 and the combined vaccine of rough type App LPS the sugar moieties of App cell walls plays an important role in the pig immunne response.

Thereby we are engaged in this research to produce the core LPS of a conservative brachymemma, and this LPS has in all three kinds of organisms.Shown that LPS works, if can recognize a kind of conservative LPS antigen, replys perhaps the protection of homologous strain so and can extend to allos bacterial strain even bacterial classification in each the immunizing power to these beasts pathogenic agent.The integrated structure analytical data shows that all these beasts pathogenic agent all have a common conservative property inner core OS structure.Therefore the possibility based on the vaccine of LPS is explored in decision.The first step of this process is to make up mutant strain, and this mutant strain is only expressed conservative property inner core OS epi-position as the ends exposed structure.

This research obtains α-1 from Mh strains A 1, and the mutant of 6-D-glycerine-D-sweet dew-heptose based transferase gene is so that present conservative property kernel epi-position with the form of ends exposed part.In Mh, the mutagenesis strategy is simple anything but.The mutant strain of aroA gene, lpp locus, pod membrane nmaAB locus and leukotoxin lktCABD gene cluster is prepared in the research of limited quantity in the past.Although electroporation is a kind of effective ways that foreign DNA imported the Mh cell, but by homologous recombination foreign DNA is inserted in the karyomit(e) and is difficult to, and the frequency of occurrences is low, and the single cross incident of changing frequently takes place, and causes the existence of the mutant strain and the functional copy of target gene.Unsettled plasmid in Mh (suicide type plasmid) is used for this method by the several people, is successfully used in current research.The structural analysis of the LPS of mutant strain has confirmed the LPS phenotype of expection, and complementation test confirms that viewed result is because the inactivation of this gene causes really.Again the complete copy that oppositely imports the losB gene replys the LPS structure to be the wild-type confirmation, and the losB gene is α-1,6-D-glycerine-D-sweet dew-heptose based transferase.Induce mAb and pAb, with the conservative property of check this structure in the bacterial strain of the certain limit of these beasts pathogenic agent and the degree of accessibility at the LPS structure of this brachymemma.Obtained three kinds of mAb, cross reaction can take place with the LPS of all bacterial strains of studying of Ap, Pm and Mh in them, thereby has set up the possibility of conservative property cross reactivity LPS epi-position total between these the three kinds important beasts pathogenic agent.

Embodiment 7, table 1: from the structure of the conservative and diversity region of the core oligosaccharide of the LPS of beasts pathogenic agent hemolytic Man bacillus, actinobacillus pleuropneumoniae and pasteurella multocida.

Bacterial classification	Bacterial strain/serotype	R	R’	R”
					Hemolytic Man bacillus	A1	H	β-D-Galp-(1-7)-D-α-D-Hepp-(1-	H
	A8	H	D-α-D-Hepp-(1-	H
						SH1217	H	β-D-Galp-(1-7)-D-α-D-Hepp(1-	H
					Actinobacillus pleuropneumoniae	1	(1S)-GalaNAc-(1-4，6)-α-D-Gal-(1-3)-β-D-Gal-(1-	H	H
	2	β-D-Glc-(1-	D-α-D-Hep V-(1-	□

	5a	H	D-α-D-Hep V-(1-	H
						5b	H	D-α-D-Hep V-(1-	H
					Pasteurella multocida *	Pm70	β-D-Glc(1-	α-D-GalpNAc-(1-3)-β-D-GalpNAc-(1-3)-α- D-Gal-(1-4)-β-D-Gal-(1-4)-β-D-Glc-(1-	PEtn
	VP161	PCho-3-β-D-Gal-(1-	PCho-3-β-D-Gal-(1-	H
						X73	(PEtn-6)-PCho-3-β-D-Gal-(1-	(PEtn-6)-PCho-3-β-D-Gal-(1-	H

For pasteurella multocida, heptose residue Hep IV is L--D configuration, does not have glucosyl residue-Glc II in minority sugar type.

Embodiment 7, table 2: form from the O-deacylated tRNA LPS of hemolytic Man bacillus losB mutant strain and complementary mutant strain and the negatively charged ion CE-ESI-MS data and the supposition of core oligosaccharide.Average quality unit forms according to following supposition and is used to calculate molecular weight: Hex, 162.15Hep, 192.17; Kdo, 220.18; P, (lipid A-OH) is 952.00 to 79.98.O-deacylated tRNA lipid A.

Bacterial strain	Observed ion (m/z)				Molecular mass (Da)		Infer and form
									(M-H) -	(M-2H) 2-	(M-3H) 3-	(M-4H) 4-	Observed value	Calculated value
O-deacylated tRNA losB losB (comp) core os losB losB (comp)	- - - - 1312.4 -	1172.3 1065.3 1349.3 1242.3 655.6 832.8	781.3 709.8 899.3 827.8 - -	585.8 532.3 674.3 620.8 - -	2347.0 2133.0 2701.0 2486.5 1313.3 1667.6	2345.1 2131.0 2699.4 2485.3 1313.2 1667.5	2Hex, 4Hep, Kdo-P, lipid A-OH Hex, 3Hep, 2Kdo, lipid A-OH 3Hex, 5Hep, Kdo-P, lipid A-OH 2Hex, 4Hep, 2Kdo, lipid A-OH 2Hex, 4Hep, Kdo 3Hex, 5Hep, Kdo

Embodiment 7, table 3: the LPS's that handles from hemolytic Man bacillus losB mutant strain KOH ¹H-and ¹³The C-NMR chemical shift.

	H-1	H-2	H-3	H-4	H-5	H-6	H-7	H-8	NOE’s
												α-GlcN(x)	5.41 (94.3)	3.89 (54.6)	3.93 (70.5)	3.53 (70.7)	4.13 (73.7)	4.14 3.87 (68.9)			Between	Inner	Long-range
			β-GlcN(y)	4.60 (102.2)	3.80 (55.9)	3.92 (73.1)	3.94 (75.4)	3.78 (74.9)	3.75 3.59 (64.0)
Kdo(z)	-	-										2.35 2.02 (35.0)	4.59 (71.1)	4.27 (72.9)	- (nd)	- (70.3)	3.96 3.72 (64.4)
			Hep-I(a)	5.18 (100.4)	4.13 (71.1)	4.03 (75.0)	4.17 (75.0)	- (72.8)	4.11 (81.0)	nd nd (nd)											4.27 Kdo H-5	4.13 H-2
Hep-II(b)	5.60	4.24										4.01	-	-	-	3.72		5.16 Hep III H-1	4.24 H-2	3.80 Hep I H-5

	(100.5)	(80.5)	(70.9)	(67.8)	(72.4)	(69.7)	3.62 (64.6)	4.03 Hep I H-3
											Hep-III(c)	5.16 (102.4)	4.00 (71.4)	3.86 (70.8)	3.81 (67.0)	- (71.6)	- (70.3)	- - (64.9)	5.60 Hep II H-1 4.24 Hep II H-2	4.01 H-2	3.80 Hep IV H-3 3.62 Glc I H-4
β-Glc-I(d)	4.61 (103.9)	3.50 (74.3)	3.43 (77.5)	3.62 (70.6)	3.51 (74.6)	4.13 3.72 (65.6)	-	4.17 Hep I H-4 4.11 Hep I H-6	3.52 H-5 3.43 H-3	5.22 Glc II H-1
											α-Glc-II(e)	5.22 (102.2)	3.56 (73.0)	3.84 (73.8)	3.54 (69.5)	3.96 (72.4)	- - (60.4)	-	4.11 Hep I H-6	3.56 H-2	4.62 Glc I H-1
Hep-IV(f)	4.94 (100.0)	4.08 (70.5)	3.80 (71.0)	3.76 (68.3)	- (70.3)	- (79.9)	- - (64.0)	4.13 Glc I H-6 3.72 Glc I H-6	4.08 H-2 3.80 H-3

Embodiment 7, and table 4. is by the summary info of the mAb of mouse #5 syzygy preparation

MAb Mh3-	The IgG subclass	Operation extent of dilution: 1
			1	G3k	500
2	G2ak	200
			3 *	G2aλ	Undiluted
4 *	G2aλ	Undiluted
			5	G2aλ	Undiluted
6	G3k	800
			7	G3	200
8	G3k	800
			9	G3k	1000
10	G3k	1600
			11	G3	1000
12	G3k	1000
			13	G3k	2000
14	G3k	1000
			15~	G2bλ	Undiluted
16~	G2bλ	Undiluted

^*, ~; MAb 3-3 shows from identical clone with 3-16 subsequently with 3-4 and mAb 3-15.

Embodiment 8 is used for prevention by beasts pathogenic agent hemolytic Man bacillus, actinobacillus pleuropneumoniae and disease that pasteurella multocida produces, based on the screening of the glycoconjugate of LPS: combine the immune response afterwards of chemistry and mouse immune and study

In order to prepare glycoconjugate, LPS carries out derivatize by following process.The LPS (145mg) and the 8K deposited material that derive from Mh losB mutant strain are dissolved in 4N KOH (10mg/ml) and stir 30h to remove ethanoyl at 125 ℃, and this Mh losB mutant strain has object construction.Solution cool to room temperature, and neutralize with diacetyl oxide, diacetyl oxide is used for N-acetylize again by amino that this process produced here.Centrifugal (9K, 15 minutes) remove deposited salt, and Sephadex G-25 post on the supernatant liquor is that eluent carries out wash-out with water.Collect sugared male component, freeze-drying obtains KOH ' the d LPS (25mg 8K precipitation, 33.3mg LPS) of 20-25% productive rate.Room temperature treatment 2h is taking off-the O-ethanoyl in 0.1M NaOH (10mg/ml) for product, and with the SephadexG-25 column purification, then, freeze-drying obtains KOH ' the d LPS of about 20% productive rate in water.

By ¹H-NMR and ES-MS analyze and carry out quality control.MS analyzes to be presented in the LPS material that KOH handled some heterogeneities, and described heterogeneity is consistent with the variable disappearance of terminal heptose residue and glucose residue.

Dephosphorylation

Merge the product that is derived from LPS or 8K deposited material, dissolving (about 10mg/ml) is in the 0.1M NH of the pH8.0 that contains recombinant basic Phosphoric acid esterase (Roche) (140units/mg units alk.P/mg KOH ' d LPS) ₄HCO ₃In the damping fluid, and stir 4h in 37 ℃ and carry out dephosphorylation.Above-mentioned solution is heated to 100 ℃ and keeps 5min, cooling, the centrifugal 10min of 14K.The supernatant freeze-drying.

With the desalination of SephadexG-25 post, freeze-drying obtains KOH ' d alk.P ' the d LPS of 20% productive rate (48mg) to product in water.By ¹H-NMR and CE-ES-MS analyze and carry out quality control, and these analyses have confirmed the dephosphorylation of the LPS that KOH handles.

Amination

By dissolving exsiccant sugar (48mg) in 600 μ l DMSO, add the NaCNBH that 4800 μ l 2M NH4OAc methanol solutions and 120mg are dissolved in 1200 μ l MeOH ₃,, target aldehydo functional group is carried out amination at pH8.3,50 ℃ of following reaction 72h.At N ₂Protection is evaporation MeOH down, lyophilized products and in water with the SephadexG-25 column purification, freeze-drying obtains the aminating LPS of KOH ' d alk.P ' d of about 10% productive rate (32mg).By ¹H-NMR analyzes and carries out quality control, should ¹H-NMR analyzes the amination of the LPS that has confirmed that KOH handles.

Adhering to of linkers

By dissolving dry sugar (32mg) in 4000 μ l H2O, add 4000 μ l MeOH, 100 μ l squarate react 2h under pH8.2 (regulating with triethylamine (4 μ l)), room temperature, pH was detected in 15 minutes in every interval, and linkers (squarate) is connected on the product amino.At N ₂Protection is evaporation MeOH down, lyophilized products and in water with the SephadexG-25 column purification, freeze-drying obtains the aminating squarated LPS of KOH ' d alk.P ' d of about 12% productive rate (30mg).By ¹H-NMR, ¹³C- ¹H-NMR and CE-ES-MS analyze and carry out quality control, and these analyses have confirmed the connection of squarate joint.Yet MS analyzes and shows to have only 50% material to have the squarate joint.

Be attached on the protein carrier

By stir 24h under the pH9.2 room temperature, the squarate that is dissolved in the 1ml 0.02M sodium borate buffer liquid that about 20mg HSA is connected to 25 times of molar excess connects on the sugar, and sugar adds when the reaction beginning and behind the reaction 6h.Behind the 24h, take out portion, and detect, carry out Western trace (Figure 50) with sugared monoclonal antibody specific G8 by MALDI-MS and SDS-PAGE.Final reacting mixture uses PBS, and (the 10mM Trisodium Citrate pH7.5) is crossed Sepharose 6B column purification, to separate the isolate that does not have in conjunction with sugar for 50mM sodium phosphate, 100mM NaCl.Concentrate in Amicon ultra-15 10K cutoff spin post with the corresponding component in product peak.The final system of binding substances is carried out quantitatively analyzing quantitative protein content by BCA, pass through PhOH/H ₂SO ₄Method is determined sugared content, and drawing sugar is 4.5: 1 with proteic mol ratio.Simultaneously, by the nanometer-electronics in 1% acetate-scattering mass spectroscopy final binding substances and carrier proteins HAS are compared, the result shown expection molecular weight corresponding to HAS (Figure 51 a) and with the corresponding to a series of peaks of the various glycosylations of carrier proteins (Figure 51 b).

Connectivity scenario

Step 1

KOH handles Mh losB LPS

Step 2

AlkP handles Mh losB KOH ' d LPS

Step 3

The amination reaction of Mh losB KOH ' the d LPS that alkP handles

Step 4

The squarate reaction of the aminating Mh losB of KOH ' d alkP ' d LPS

Step 5

The association reaction of the aminating squarated Mh of KOH ' d alkP ' d losB LPS

The binding substances preparation:

-Mh losB-HSA (about 4CHO/CRM) is to mouse

Immunologic process

With binding substances the BALB/c mouse in 6 6-8 age in week is carried out immunity, in contrast, the BALB/c mouse in 3 female 6-8 ages in week is carried out immunity with blended sugar and HAS.All vaccines all are dissolved in aseptic PBS solution, and every 0.1ml sc injection is added with 10 μ g sugar in the Ribi adjuvant.

Mouse carries out immunity according to following timetable:

Pre-blood drawing in 0 day and initial injection

14 days booster immunizations for the first time

Tentative blood drawing in 23 days

35 days booster immunizations for the second time

Mouse blood drawing in 45 days

Show that 23 days tentative blood drawings and 45 days final blood drawing the #V2 mouse shows the IgG reaction to carbohydrate antigen, as the LPS ELISA of anti-Mh losBLPS discloses (Figure 52 and 53).To deriving from the polyclonal serum of the #V2 mouse that has carried out three kinds of immunologic processes, itself and three kinds of target compound cross reaction abilities are detected.The LPS of Ap, Mh and Pm and full cell can both be discerned (Figure 54 and 55) by this polyclonal serum.Yet the LPS and the full cell that derive from Neisseriameningitides strain L3galE and L2galE also can be discerned in LPS and full cell ELISA respectively.This phenomenon gives the credit to the part degraded of carbohydrate antigen in the process of KOH Processing of Preparation binding substances, and this can produce the various forms disappearance (seeing Figure 49) of terminal heptose residue and hexose residue.This will cause, and some this carbohydrate antigen contains antigenic determinant in final binding substances, and this antigenic determinant can be simulated meningitis bacterium LPS district (being used to test polyclonal serum V2), and then causes this observed cross-reactivity.But, carry out the serum that mice immunized cultivates with this binding substances serum and can discern LPS and the full cell that derives from beasts pathogenic agent Ap, Pm and Mh.

Embodiment 9 usefulness are to the sterilization experiment of the conservative specific monoclonal antibody of kernel lipopolysaccharides

The intact cell (Figure 56) of the polyclonal serum of mouse #1 identification Mh when D140, and comprise specific antibody (Figure 57) to the kernel LPS of Mh, mAb G3 in sterilization experiment, G8,3-5 and 3-16 (Figure 58-61) ascites is used as the serum source of sterilization experiment together with contrast ascites L2-16.The method of this experimental basis Sutherland A.D.1988.Vet.Microbiol.16:263-271 is carried out.In brief, in 100ml BHI meat soup, cultivate the Mh cell to～5 * 10 ³The level of growth of cfu/ml.Use the culture of 10ml, wherein cell at 5000 * g, is made bead for 4 ℃, and with D-PBS (contain Ca and Mg[Gibco # 14040-133]) washed twice.Final cell pellet resuspending is in the D-PBS of 10ml.Experiment serum and ascites sample are at 56 ℃ of hot deactivation 30min, to destroy endogenous complement.Experiment is based upon the 96-hole, the tissue culture level, and on the flat-bottom microtiter plates (NUNC), triplicate.Every hole is added in the antiserum(antisera) 20ul of appropriateness dilution among the D-PBS, then adds bacterial suspension (100ul), and flat board is cultivated 15min at RT.Every hole adds complement, and (#CL3441-S Cedarlane), cultivates 30min with flat board at 37 ℃ for 80ul, young rabbit.Flat board is placed on termination reaction on ice, every Kong Sanfen sample (50ul) coated plate on the BHI agar plate, 37 ℃ of overnight incubation.Also comprise in every group of experiment and only contain bacterial suspension, the bacterial suspension of complement is arranged and the control wells of bacterial suspension of the antibody of an amount of dilution is arranged.

The deadly percentage ratio with respect to contrast is calculated in the growth of counting bacterium.

Seen in following table and Figure 62-64, mAb G3 and G8 and polyclonal serum all promote the CML effect of MhA1 wt cell.The inefficacy of the ascites of mAb 3-5 and 3-16 is that (operation extent of dilution 1: 50 was with respect to 1: 10 because the very low titre of these serum ⁶).

The fungicidal activity that mAb G3 and G8 and polyclonal serum show is illustrated, and can discern the full cell of Mh to the antibody of conservative kernel LPS epitope specificity among the Mh, and also is activated to the full cell of Mh on function.

Embodiment 9, and table 1.mAb G3 and G8 are to the fungicidal activity of Mh A1 cell

Experiment condition	The average CFU of Mh cell in 50 μ l experiment volume (+/-SE)
									Contrast	1∶10,000	1∶20,000	1∶40,000	1×10 -5	1×10 -6	1×10 -7	1×10 -8
	The Mh cell is independent	65+/-2.7	NA	NA	NA	NA	NA	NA									NA
Mh cell+complement									55+/-4.6	NA	NA	NA	NA	NA	NA	NA
	Mh cell+complement+G3	-	11+/-2.8	7+/-2.8	3+/-2.3	0	0	4+/-0.8									48+/-3.8
Mh cell+G3									-	83+/-9.5	82+/-9	61+/-7.5	75+/-5.2	75+/-0.88	78+/-0.88	71+/-3
	Mh cell+complement+G8	-	27+/-3	8+/-0.88	3+/-2.5	0	0	2+/-0.88									52+/-2.3
Mh cell+G8									-	69+/-12	62+/-11	86+/-4.9	18+/-10	68+/-2.9	75+/-6	82+/-11

SE=SD/ √ n is the n=sample capacity wherein

Embodiment 9, and polyclonal serum Mh#1 is to the fungicidal activity of Mh A1 cell during table 2.D140

Experiment condition	The average CFU of Mh cell in 50 μ l experiment volume (+/-SE)
					Contrast	1∶640	1∶1280	1∶1256
	The Mh cell is independent	87+/-2.3	NA	NA					NA
Mh cell+complement					80+/-6	NA	NA	NA
	Mh cell+Mh#1 D140	NA	110+/-0.6	150+/-25					126+/-12
Mh cell+complement+Mh#1 D140					NA		2+/-0.7	2+/-0.6		0

SE=SD/ √ n is the n=sample capacity wherein

Embodiment 10 uses the passive protection experiment to the conservative specific monoclonal antibody of kernel lipopolysaccharides

This experimental basis Lopez et al.1982.Can, the method for J.Comp.Med.46:314-316 uses method and improvement as described below to carry out.

Mouse and reagent:

The IgG of purifying mAb ascites on the albumin A post, sterile filtration (Figure 65) is to be used for the passive protection experiment.

The mAb G3 and the G8:G8 of test, IgG2b, 3.8mg/ml; G3, IgG2a, 4.7mg/ml.

Contrast mAb:L2-16, IgG2b, 1.9mg/ml.

The Balb/c mouse: 40 are female, age in 6-8 week, CRL.5 mouse/group.

Hemolytic Man bacillus A1:7.5 * 10 ⁷The cfu/ mouse.

Experimental plan and grouping

Group	Reagent treatment	Treatment condition
			A	-	-
B	Contrast MAB	External incubation
			C	G3	External incubation
D	G8	External incubation
			E	Contrast MAb	Interior	1 hour of body
F	G3	Interior					1 hour of body
			G	G8	Interior	1 hour of body

D-1	The purifying of mAb G3, G8 and L2-16 and quantitative
		D-1	On BHI agar, build Mh A1 flat board
D0	Using Mh inoculation BHI meat soup to collect Mh at OD about 1.2 or when higher is used for inoculation and determines that by viable count inoculum gives E-G group mouse with about 10 with mAb IP 8Individual Mh IN give A group and E-G organize mouse with Mh with mAb vitro culture 30min with about 10 8The Mh of individual preincubation gives B-D group mouse
		D1	Observe mouse every day and write down clinical indication to the experiment end

D3	Finish experiment and collection: ● the overall incidence of lung ● the excision lung is to carry out anatomic tissue

Group	Clinical condition million i		Macroscopic view changes ii	Histology changes iii
					The 2nd day	The 3rd day
	A	++++ iv					+++	+++ v	+++ vi
B			++++	++	+++	+++
	C	++(2) vii					-	++	++
D			++(2)	-	++	++
	E	++++					++(4)	++	+++
F			+++	-(4)	++	+ arrive ++
	G	+++					+ arrive ++ (4)	++	+ arrive ++

ⁱAll mouse show clinical condition million in various degree, as coarse fur, dewater and be reluctant on DPI2 and move.Yet C and D group mouse are healthy generally, although F and G group mouse have coarse fur, keep active.On DPI 3, A and B group mouse serious dehydration, and body weight reduction, G group mouse also has slight symptom.

^IiAll mouse show adhesion of lung (lung consolidarion) in various degree, do not take to attempt the area size to determine to relate to.

^IiiThe key distinction between each group is that A, B and E organize that the mouse than other groups has more neutrophilic granulocyte in the lung that whole mouse are presented at them.Yet all mouse in any case handle, all show pneumonia to a certain degree.

^Iv++ ++: coarse fur, moderate reduces to the body weight of severe, is reluctant to move; The coarse fur of +++:, light to moderate body weight reduce and dehydration, but keep active; ++: coarse fur and slight body weight reduce; +: slight coarse fur.

^vThe adhesion of the middle amount area of +++:; ++: the adhesion of small area.

^ViDuring following, the bronchopneumonia of +++: moderate measures the appearance of a large amount of neutrophilic granulocytes and the lymphocytic remarkable infiltration that blood vessel reaches the segmental bronchus peripheral region on every side; ++: mired is followed the appearance of a spot of neutrophilic granulocyte and the lymphocytic infiltration that blood vessel reaches the segmental bronchus peripheral region on every side to the bronchopneumonia of moderate; +: the bronchopneumonia of mired is followed around occurring once in a while of a spot of neutrophilic granulocyte and the blood vessel and the lymphocytic mired of segmental bronchus peripheral region is infiltrated.

^ViiThe mouse quantity of performance clinical symptom

Show that based on this experimental experiment mAb handles, and particularly uses the external preincubation of hemolytic Man bacillus, demonstrates moderate influence on the histopathology to clinical disease and infected mouse.

Figure 66 shows in the medium sized bronchial lumen of control mice B; the appearance of the neutrophilic granulocyte of middle amount; conform to pathogeny; in some zones of the lung of the C that but Figure 67 shows and Figure 66 kills simultaneously group mouse; demonstrate disappearing of pneumonia that the existence owing to a spot of lymphoidocyte causes, consistent with the protection to a certain degree that provides by external premixed mAb G3 and Mh cell.

Biological preservation

Hemolytic Man bacillus strain A1 losB carries out preservation on May 4th, 2005 at IDAC.Deposit number is IDAC 040505-01.

Sequence table

＜110〉Canadian National Research Council (National Research Council of Canada)

＜120〉as the conservative property kernel lipopolysaccharide epitopes of many species vaccine candidate object

<130>PAT 2817W-90

<150>CA 2,467,329

<151>2004-05-14

<150>US 60/571,489

<151>2004-05-17

<160>6

<170>PatentIn version 3.2

<210>1

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of waaQPM amplification; Have the BamHI site and be used for the clone

<400>1

gagtaggatc ctgaaacatg ttccc 25

<210>2

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of waaQPM amplification has the SalI site and is used for the clone

<400>2

ggttgggtcg accaagccac attactg 27

<210>3

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉losB-kpn primer

<400>3

atatggtacc tatcagcggt agagattcta ac 32

<210>4

<211>37

<212>DNA

＜213〉artificial sequence

<220>

＜223〉losB-xba primer

<400>4

tgctctagac cgaacctgca ccaaaaagat ttaacgc 37

<210>5

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉with the interior corresponding primer of sequence of losB structure gene

<400>5

ccgctgcgag agataagtgg atactttatc 30

<210>6

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉with the interior corresponding primer of sequence of losB structure gene

<400>6

gacattggga tctttattta gatttcaaac cgac 34

Claims (33)

1. an isolating lipopolysaccharides part is made up of the conservative property two-glucosyl-four-heptose base kernel portion that does not contain variable outer core oligonucleotide chain extension basically.

2. isolating lipopolysaccharides part, form by the glucosyl-heptose base kernel portion of general formula I basically:

Wherein, Glc is a glucose; Hep is a heptose; R is H or phosphorylethanolamine; R ' " is the O-antigen in H or the actinobacillus pleuropneumoniae; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid; Q ¹Be H or α-Glc; Q ²Be H, Kdo or-P-R, wherein P is a phosphoric acid ester, R is H or phosphorylethanolamine; Q ³Be H or toxicide lipid A; Q ⁴Be H or

Wherein, R ' and R " each is H or oligosaccharides extension naturally, and condition is if R ' " are H, and Q ²Be-P-R that wherein R is H or phosphorylethanolamine, Q so ¹Be α-Glc.

3. an isolating lipopolysaccharides part is made up of glucosyl-heptose base kernel portion of general formula I a basically;

Wherein, Glc is a glucose; Hep is a heptose; R is H or phosphorylethanolamine; " each is H or oligosaccharides extension naturally for R ' and R; R ' " is the O-antigen in H or the actinobacillus pleuropneumoniae; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid; Q ¹Be H or α-Glc; Q ²Be H, Kdo or-P-R, wherein P is a phosphoric acid ester, R is H or phosphorylethanolamine; Lipid A is a toxicide, and condition is if R ' " be H, and Q ²Be-P-R that wherein R is H or phosphorylethanolamine, Q so ¹Be α-Glc.

4. isolating lipopolysaccharides part, form by two-glucosyl with structure I-four-heptose base kernel portion basically:

Structure I

Wherein, Glc is a glucose; Hep is a heptose; P is a phosphoric acid ester; R is H or phosphorylethanolamine; " each is H or oligosaccharides extension naturally for R ' and R; R ' " is the O-antigen in H or the actinobacillus pleuropneumoniae; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid; Lipid A is a toxicide.

5. isolating lipopolysaccharides part, form by the glucosyl with structure I I-four-heptose base kernel portion basically:

Structure I I

Wherein, Glc is a glucose; Hep is a heptose; R is H or phosphorylethanolamine; " each is H or oligosaccharides extension naturally for R ' and R; R  is the O-antigen in H or the actinobacillus pleuropneumoniae; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid; Lipid A is a toxicide.

6. each lipopolysaccharides part of claim 1 to 5, wherein the group that O-connects in kernel portion is substituted at an arbitrary position.

7. pharmaceutical composition comprises each lipopolysaccharides part of claim 1 to 6, and acceptable carrier in the pharmacy.

8. the pharmaceutical composition of claim 7, wherein acceptable carrier has immunogenicity in the pharmacy.

9. functional antibodies, cross reaction can take place at hemolytic Man bacillus, actinobacillus pleuropneumoniae and pasteurella multocida in described antibody, and described antibody can be in conjunction with the epi-position in each the lipopolysaccharides part of claim 1 to 6.

10. method for preparing and obtain at the functional cross-reacting antibody of hemolytic Man bacillus, actinobacillus pleuropneumoniae and pasteurella multocida, this method comprises:

(a) produce at each the antibody of lipopolysaccharides part of claim 1 to 6;

(b) will test at the multiple bacterial strain of hemolytic Man bacillus, actinobacillus pleuropneumoniae and pasteurella multocida from the antibody that step (a) obtains;

(c) antibody of cross reaction all takes place in all bacterial strains of selection and hemolytic Man bacillus, actinobacillus pleuropneumoniae and pasteurella multocida.

11. by the application in the medicine of the disease that infectation of bacteria caused of Pasteurellaceae, described bacterium has this conservative property inner core to the composition of claim 7 or 8 in the preparation treatment.

12. by the application in the medicine of the disease that infectation of bacteria caused of Man bacillus, actinobacillus or Pasteurella, described bacterium has this conservative property inner core to the composition of claim 7 or 8 in the preparation treatment.

13. by the application in the medicine of the disease that infectation of bacteria caused of hemolytic Man bacillus, actinobacillus pleuropneumoniae or pasteurella multocida bacterial classification, described bacterium has this conservative property inner core to the composition of claim 7 or 8 in the preparation treatment.

14. according to each application of claim 11 to 13, wherein said disease is selected from pig scleroproein hemorrhagic necrosis pleuropneumonia, fowl cholera, haemorrhagic septicomia of cattle, atrophic rhinitis, sheep and ox pneumonia pasteurellosis (shipping fever) and loombriz.

15. hemolytic Man bacillus strain A1 losB (IDAC 040505-01).

16. an attenuated vaccine comprises the bacterial isolates of Pasteurellaceae, described bacterial isolates lacks pathogenecity, and presents the lipopolysaccharide epitopes from the conservative property inner core.

17. according to the attenuated strain of claim 16, wherein said bacterial isolates is selected from Man bacillus, actinobacillus or Pasteurella.

18. an attenuated vaccine, it is included in the hemolytic of sudden change Man bacillus strain A1 losB on the leukotoxin gene.

19. a method for preparing the lipopolysaccharides part, described lipopolysaccharides part is made up of the conservative property two-glucosyl with structure I-four-heptose base kernel portion basically:

Structure I

Wherein, Glc is a glucose; Hep is a heptose; P is a phosphoric acid ester; R is H or phosphorylethanolamine; " each is H or oligosaccharides extension naturally for R ' and R; R ' " is the O-antigen in H or the actinobacillus pleuropneumoniae; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid; Lipid A is a toxicide; Described method comprises:

(a) mutant strain of separation glycosyltransferase gene inactivation from hemolytic Man bacillus, actinobacillus pleuropneumoniae or pasteurella multocida bacterial classification is so that lipopolysaccharides partly presents with the form of terminal units;

(b) being suitable for expressing under the condition of lipopolysaccharides part, cultivate the mutant strain of the hemolytic Man bacillus, actinobacillus pleuropneumoniae or the pasteurella multocida that from step (a), obtain;

(c) separate and identify the lipopolysaccharides part that obtains; With

(d) make lipopolysaccharides lipid A part detoxification partly.

20. a method for preparing the lipopolysaccharides part, described lipopolysaccharides part is made up of the conservative property two-glucosyl with structure I-four-heptose base kernel portion basically:

Structure I

Wherein, Glc is a glucose; Hep is a heptose; P is a phosphoric acid ester; R is H or phosphorylethanolamine R ' and R, and " each is H or oligosaccharides extension naturally; R ' " is H; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid; Lipid A is a toxicide; Described method comprises:

(a) mutant strain of separation losB gene inactivation from hemolytic Man bacillus species;

(b) being suitable for expressing under the condition of lipopolysaccharides part, cultivate the hemolytic Man bacillus mutant strain that from step (a), obtains;

(c) separate and identify the lipopolysaccharides part that obtains;

(d) make lipopolysaccharides lipid A part detoxification partly.

21. a method for preparing the lipopolysaccharides part, described lipopolysaccharides part is made up of the conservative property two-glucosyl with structure I-four-heptose base kernel portion basically:

Structure I

Wherein, Glc is a glucose; Hep is a heptose; P is a phosphoric acid ester; R is H or phosphorylethanolamine; " each is H or oligosaccharides extension naturally for R ' and R; R ' " is the O-antigen in H or the actinobacillus pleuropneumoniae; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid; Lipid A is a toxicide; Described method comprises:

(a) mutant strain of separation lbgA or rfbP gene inactivation from actinobacillus pleuropneumoniae serotype 1 bacterial strain;

(b) being suitable for expressing under the condition of lipopolysaccharides part, cultivate the actinobacillus pleuropneumoniae mutant strain that from step (a), obtains;

(c) separate and identify the lipopolysaccharides part that obtains;

(d) make lipopolysaccharides lipid A part detoxification partly.

22. a method for preparing the lipopolysaccharides part, described lipopolysaccharides part is made up of the conservative property two-glucosyl with structure I-four-heptose base kernel portion basically:

Structure I

Wherein, Glc is a glucose; Hep is a heptose; P is a phosphoric acid ester; R is H or phosphorylethanolamine; " each is H or oligosaccharides extension naturally for R ' and R; R ' " is H; Kdo is 3-deoxidation-D-sweet dew-methyln-hexyl ketone saccharic acid; Lipid A is a toxicide; Described method comprises:

(a) mutant strain of separation PM0223 or PM1143 gene inactivation from pasteurella multocida bacterial strain Pm70;

(b) being suitable for expressing under the condition of lipopolysaccharides part, cultivate the pasteurella multocida mutant strain that from step (a), obtains;

(c) separate and identify the lipopolysaccharides part that obtains;

(d) make lipopolysaccharides lipid A part detoxification partly.

23. a monoclonal antibody, it can combine with the epi-position in each defined lipopolysaccharides part of claim 1 to 6.

24. each method of claim 19 to 22, its monoclonal antibody specific that further comprises the epi-position that will comprise in described lipopolysaccharides part and the described kernel lipopolysaccharides part contacts, and discerns this lipopolysaccharides part.

25. the method for claim 24, wherein said monoclonal antibody such as claim 23 definition.

26. a glycoconjugate, it comprise be connected with immunogenic carrier, each defined lipopolysaccharides part of claim 1 to 6.

27. according to the glycoconjugate of claim 26, wherein the lipopolysaccharides part is connected by linkers with immunogenic carrier.

28. the glycoconjugate of claim 26 or 27, wherein said linkers are selected from squarate, cystamine, adipic dihydrazide, epsilon-amino caproic acid, Mecoral dimethylacetal, D-glucuronolactone and p-Nitroaniline.

29. each glycoconjugate of claim 26 to 28, wherein said carrier is selected from detoxification pseudomonal toxin A, Toxins,exo-, cholera/toxoid, Toxins, pertussis/toxoid, clostridium perfringens extracellular toxin/toxoid, hepatitis B surface antigen, hepatitis B virus core antigen, rotavirus VP 7 albumen, respiratory syncytial virus F and G albumen, diphtheria toxoid CRM ₁₉₇Toxoid,tetanus TT, human serum albumin (HSA), hemolytic Man bacillus leukotoxin toxoid, hemolytic Man bacillus PlpE lipoprotein, actinobacillus pleuropneumoniae OmlA, hemolytic Man bacillus or actinobacillus pleuropneumoniae TbpA and B (transporting conjugated protein), hemolytic Man bacillus sialoglycoprotein enzyme, actinobacillus pleuropneumoniae is selected from Apx I toxoid outside the Apx of IV, actinobacillus pleuropneumoniae or pasteurella multocida Plp-40 lipoprotein, pasteurella multocida Omp28 major outer membrane albumen, pasteurella multocida 39kDa protein clostridium and pasteurella multocida PlpB (39kDa intersection barrier cream albumen).

30. a vaccine composition, it comprises each glycoconjugate and adjuvant of claim 26 to 29.

31. the vaccine composition of claim 30, wherein said vaccine are made liposome, Archimycetes body (archaeosome) or from Archimycetes lipid (archaeolipid).

32. the vaccine composition of claim 30 or 31, described composition after Mammals is carried out immunization, can induce can with the antiserum(antisera) of the full cell generation cross reaction of the bacterium of Pasteurellaceae.

33. a multivalent vaccine composition, it comprises the mixture of each defined glycoconjugate of claim 26 to 29 and adjuvant.

Images